SEARCH

SEARCH BY CITATION

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results and discussion
  5. Conclusion
  6. Experimental procedures
  7. Acknowledgements
  8. References

The rate and extent of a cell's response to an extracellular stimulus is influenced by regulators that act on the intracellular signalling machinery. Although not directly involved in propagating the intracellular signal, regulators control the activity of the proteins that transmit the signals. To understand this aspect of cell signalling, we have studied the pheromone response pathway in the fission yeast Schizosaccharomyces pombe, a relatively simple signalling system in a genetically tractable organism. We demonstrate this approach by investigating the role of Rgs1, a member of the Regulator of G protein Signalling (RGS) family of proteins. The rgs1 gene was identified through the Sz. pombe genome sequencing project (accession number Q09777) and recognized as having similarity to RGS proteins [Tesmer et al. (1997) Cell 89: 251–261], but this is the first report concerning the activity of the protein. Strains lacking rgs1 (Δrgs1) are hypersensitive to pheromone stimulation and unable to conjugate with a mating partner. Inhibition of mating occurs at a relative late stage in the process as Δrgs1 strains exhibit pheromone-dependent transcription and form shmoos. Expression of SST2 (an RGS protein that regulates pheromone signalling in the budding yeast Saccharomyces cerevisiae) overcomes the hypersensitivity of the Δrgs1 strains but fails to rescue their mating defect.


Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results and discussion
  5. Conclusion
  6. Experimental procedures
  7. Acknowledgements
  8. References

The growth, differentiation and general metabolic activity of most cells can be influenced by exposure to extracellular ligands; stimulation of the appropriate receptors at the cell surface activates the intracellular machinery responsible for bringing about changes in cell behaviour. Persistent stimulation of these receptors does not, however, generally bring about a continuous response as the cell adapts to the presence of the stimulus and becomes desensitized. Such desensitization is a normal physiological process that both limits the extent of the response and allows cells to recover their resting state. The molecular basis for desensitization in eukaryotic cells is complex and involves a variety of processes that can affect the signalling machinery at almost every level (reviewed in Freedman and Lefkowitz, 1996; Böhm et al., 1997).

To gain further insights into these events, we have studied desensitization of the pheromone response pathway in the fission yeast Schizosaccharomyces pombe (reviewed in Davey, 1998). Conjugation between two haploid Sz. pombe cells involves the reciprocal exchange of diffusible mating pheromones; M-cells (of mating type Minus) release M-factor and respond to the P-factor released by P-cells (mating type Plus). Binding of the pheromones to specific 7-span receptors on the surface of the target cell activates an intracellular signalling pathway, which leads to changes in cell behaviour in readiness for mating. At the heart of the signal transduction machinery are a heterotrimeric G protein, a mitogen-activated protein (MAP) kinase cascade and at least one transcription factor, although there are many other components that influence the extent of signalling. Responses induced by the pheromones include a G1 arrest of the cell cycle, an increase in agglutination, and the elongation of the cell to form a shmoo.

Desensitization is an integral feature of the pheromone response process. Cells that fail to mate recover from the effects of stimulation and resume mitotic growth (Davey and Nielsen, 1994; Imai and Yamamoto, 1994). Recovery occurs in the presence of extracellular pheromone and confirms that the cells become desensitized to continued stimulation. Such desensitization also appears to be important in the conjugation process itself as mutations that reduce the ability to recover from stimulation lead to reduced fertility (Fukui et al., 1986; Egel, 1992; Imai and Yamamoto, 1992). The best characterized mechanism of desensitization in Sz. pombe involves the carboxypeptidase Sxa2 (Imai and Yamamoto, 1992; Ladds et al., 1996). M-cells exposed to P-factor secrete Sxa2, which inactivates the extracellular pheromone by removing the C-terminal leucine residue. Sxa2 is not produced by P-cells or by unstimulated M-cells.

To identify and characterize other proteins involved in the desensitization process, we have constructed a series of yeast strains that express a variety of reporter proteins under the control of pheromone-dependent promoters. Mutations that reduce the ability of cells to recover from pheromone stimulation affect the expression of the reporter protein, and the corresponding mutants can be isolated by appropriate screening procedures. This approach has allowed us to isolate several desensitization mutants, and the molecular characterization of these strains is under way. The reporter strains can also be used to investigate the activity of Sz. pombe homologues of proteins involved in desensitization in other systems. Such homologues are being identified through the Sz. pombe genome sequencing project and a simple quantitative system is required to assay their role in desensitization. Here we demonstrate the use of these strains to investigate the function of YA8c, a hypothetical protein identified as part of the sequencing project (accession number Q09777). Sequence analysis predicts that YA8c belongs to the regulator of G protein signalling (RGS) family of proteins.

RGS proteins have been discovered in Saccharomyces cerevisiae (SST2) (Chan and Otte, 1982; Dohlman et al., 1995; 1996), Caenorhabditis elegans (EGL10) (Koelle and Horvitz, 1996) and Aspergillus nidulans (FlbA) (Lee and Adams, 1994), and at least 20 mammalian family members have now been identified (reviewed in Dohlman and Thorner, 1997; Berman and Gilman, 1998). Most RGS proteins are thought to act as GTPase-activating proteins (GAPs) that promote inactivation of Gα-GTP subunits. In the resting cell, heterotrimeric G proteins contain a β-subunit, a γ-subunit and an α-subunit, which is bound to GDP. Activation of the receptor by an extracellular ligand stimulates the release of GDP, and the consequent binding of GTP causes the Gα subunit to dissociate from the βγ dimer. The separated components then regulate downstream effectors. Signalling is terminated when the Gα subunits hydrolyse GTP, return to the GDP-bound state and reassociate with βγ dimers to form inactive heterotrimers. The slow intrinsic GTPase activity of the Gα subunits is increased by the RGS proteins, which appear to stabilize the flexible switch regions of Gα proteins in conformations that mimic those found in the transition state (reviewed in Berman and Gilman, 1998). Recent evidence suggests that certain RGS proteins can also speed up the activation of signalling (reviewed in Zerangue and Jan, 1998).

Here, we demonstrate that YA8c negatively regulates the pheromone response in Sz. Pombe such that strains lacking the ya8c gene are hypersensitive to stimulation. Furthermore, loss of ya8c can be partly overcome by expression of SST2 from S. cerevisiae. Our results, combined with previous sequence analysis (Tesmer et al., 1997), suggest that YA8c is an RGS protein and we previously suggested referring to it as Rgs1 (Davey, 1998); although reluctant to change the name of YA8c, Rgs1 would appear to reflect more accurately the function of this protein.

Results and discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results and discussion
  5. Conclusion
  6. Experimental procedures
  7. Acknowledgements
  8. References

Sequence analysis of Rgs1

The Sz. pombe sequencing project identified Rgs1 as a hypothetical protein with similarity to members of the RGS family of proteins (Fig. 1). Family members share a ≈ 130 residue domain that is similar at the primary level and is predicted to fold into highly conserved secondary and tertiary structures (the RGS fold) (Tesmer et al., 1997). Structural analysis of the RGS fold of rat RGS4 revealed nine α-helices that fold into a small terminal subdomain and a bundle subdomain that includes most of the residues that interact with the Gα subunit (Tesmer et al., 1997). Rgs1 can be fitted to this structure by introducing insertions in regions not thought to be involved in the folding of the RGS domain (Fig. 1A; Tesmer et al., 1997). Such insertions are found in several RGS proteins from lower eukaryotes and in at least one mammalian RGS protein (Fig. 1B), but their functional significance remains unknown.

image

Figure 1. . Sequence analysis of Rgs1. A. Predicted amino acid sequence of Rgs1 from Sz. pombe. The rgs1 gene was identified as part of the Sz. pombe sequencing project (accession number Q09777). Residues conserved among the RGS family members are indicated by * and ^; residues marked by * are believed to make direct contact with the Gα subunit and those marked by ^ form the hydrophobic core of the RGS domain (Tesmer et al., 1997). Underlining and dashed lines indicate insertions in the Sz. pombe sequence that maximize similarity to the RGS domain of mammalian RGS4 (Tesmer et al., 1997). B. Comparison of the RGS domain of Rgs1 with other members of the family. Pairwise comparisons performed with the bestfit programme from the GCG package (Genetics Computer Group) using a Gap creation penalty of 3.0, a Gap extension penalty of 0.1, and the default amino acid comparison table. RGS domains were identified by comparison with that determined for rat RGS4 (Tesmer et al., 1997). Thus, the RGS domain of rat RGS4 includes residues 51–178 while that for Sz. pombe Rgs1 is composed of four sections covering residues 311–322, 345–383, 394–437 and 450–480. The following sequences were used for the comparison: S. cerevisiae SST2 (accession number P11972); A. nidulans FlbA (P38093); C. elegans EGL-10 (P49809); human GAIP (P49795); human RGS1(Q08116); human RGS2 (P41220); human RGS3 (P49796); human RGS4 (P49798); human RGS5 (O015539); human RGS6 (O75576); human RGS7 (P49802); rat RGS8 (D1024561); human RGS9 (O75916); human RGS10 (O43665); human RGS11 (O75883); human RGS12 (O14924); human RGS13 (O14921); rat RGS14 (O08773); human RGS16 (O15492); bovine RET-RGS1 (G1895060); human RGSZ1 (O76081); human axin (O15169); mouse D-AKAP2 (O88845); C. elegans C05B5.7 (P34295); C. elegans C29H12.3 (Q18312); C. elegans F16H9.1 (P49808).

Download figure to PowerPoint

Rgs1 contains a long N-terminal extension that we believe is either involved in regulating the RGS domain or required for additional activities that remain to be characterized (J. Davey, P. Watson and C. Pateman, in preparation). Although isolated RGS domains can function as GAPs both in vitro and in vivo (Faurobert and Hurley, 1997; Popov et al., 1997), there is considerable evidence to suggest that sequences outside these conserved domains are required for correct biological activity. Truncation of the N-terminal domains of several RGS proteins, including SST2 (Dohlman et al., 1996), eliminates their activity (Chen et al., 1997; Srinivasa et al., 1998). The mapping of a gain-of-function allele within this region of SST2 further illustrates its functional importance (Dohlman et al., 1995). No catalytic activity has been demonstrated for these additional sequences, and most appear to be involved in facilitating interactions with other proteins or with cell membranes. For example, both axin (Itoh et al., 1998), D-AKAP2 (Huang et al., 1997) and GAIP (De Vries et al., 1998) bind to target proteins through regions outside their RGS domains, and other family members contain motifs known to promote protein–protein interactions (Snow et al., 1998a). Targeting to the membrane could provide additional regulation. Several RGS proteins become palmitoylated (De Vries et al., 1996; Srinivasa et al., 1998), whereas others can interact directly with the Gβ subunits (Snow et al., 1998b) — at least one is thought to contain a transmembrane domain (Faurobert and Hurley, 1997). Establishing the function(s) of the N-terminal domain of the Sz. pombe Rgs1 will be important for a complete understanding of the protein.

Constructing a mat1-Pm>lacZ reporter

The mat1-Pm gene encodes a protein required for entry into meiosis (Kelly et al., 1988). It is only expressed in P-cells and the low level of expression observed during mitotic growth is increased dramatically by pheromone stimulation (Nielsen et al., 1992; Aono et al., 1994; Davey and Nielsen, 1994). To identify and characterize factors involved in regulating the pheromone response, we constructed a P-cell carrying a mat1-Pm>lacZ reporter gene (JY464) (Fig. 2). JY464 has several differences to a mat1-Pm>lacZ reporter strain used previously to assay the response to M-factor (Aono et al., 1994). First, the mat1-Pm>lacZ reporter construct is integrated into the chromosomal mat1-Pm locus so that each individual gives a more uniform response when stimulated, and we avoid the variability that can complicate the use of plasmid-borne reporters (Aono et al., 1994). Second, our strain lacks the mat2 and mat3 loci and is therefore unable to switch from the M-type information encoded at the mat1 locus (Klar and Miglio, 1986). Finally, the strain lacks the cyr1 gene that encodes adenylate cyclase (Yamawaki-Kataoka et al., 1989; Young et al., 1989). Nutritional regulation of the pheromone response pathway complicates mating-related studies in Sz. pombe as cells are derepressed for mating during mitotic growth. The mechanism by which cells detect nutritional status is unclear, but mating functions are inhibited by high intracellular levels of cAMP. Mutants defective in cyr1 respond to pheromones during mitotic growth (Davey and Nielsen, 1994; Imai and Yamamoto, 1994).

image

Figure 2. . Constructing the mat1-Pm>lacZ reporter strains. The mat1-Pm ORF was first replaced with a 1.8 kb Sz. pombe ura4+ cassette (Grimm et al., 1988). The complete mat1-Pm locus was amplified by PCR using the sense primer JO531 (gggcaTATGCGCTCTAACTTGG; lower-case letters are not complementary to mat1-Pm, but the oligonucleotide includes an emboldened NdeI site so that digestion leaves ends that are fully homologous to the chromosomal sequence) and the antisense primer JO532 (gggcaTATGAAAAACAAAAACCGAATG; cleavage at the NdeI site again leaves ends that are fully homologous to the chromosome). The resulting PCR product was cloned into the NdeI site of pGEM5Zf (Promega) and the clone used as template for PCR with JO748 (AATGAATTGCTTAAAATAAAAC; an antisense primer complementary to a region immediately upstream of the ATG initiator codon for mat1-Pm) and JO747 (TGAATTATGTTAGCTTAG; a sense primer that includes the TGA stop codon and immediate downstream region of mat1-Pm). This product (corresponding to the upstream and downstream regions of mat1-Pm cloned into the NdeI site of pGEM5Zf) was ligated to either the ura4+ cassette (to generate JD699, pGEM5Zf containing a construct suitable for disruption of mat1-Pm) or a PCR product corresponding to the lacZ ORF (to generate JD806, pGEM5Zf containing the mat1-Pm>lacZ reporter construct). The lacZ ORF was prepared by amplification using the sense primer JO660 (ATGCAGCTGGCACGACAGGTTTCCCGAC; includes the ATG initiator codon and the next 25 bases of the lacZ ORF) and the antisense primer JO706 [TTTTTGACACCAGACCAACTGGTAATGGTAGCGACCGGCGCTCAGCTGGAATTCCGCCGATACTGACGGGCTCCAGGAG TCGTCGCCACCAATCCCCATgTGGAAACCGTCG; complementary to the 3′ end of the lacZ ORF except for a single base change (a T-to-c change when considered in the sense direction) that destroys the NdeI site without changing the coding potential of lacZ [both the original CAT and the newly created CAc encode histidine]. JY357 (a mating stable P-cell lacking cyr1) was transformed with an NdeI fragment corresponding to the mat1-Pm::ura4+ construct (isolated from JD699), and stable Ura+ transformants were initially screened by PCR and replacement of the mat1-Pm locus was confirmed by Southern blot. A correct mat1-Pm disruptant (JY412) was then transformed with an NdeI fragment corresponding to the mat1-Pm>lacZ reporter construct (isolated from JD806). Stable Ura-transformants (selected by their ability to grow in the presence of 5′-fluoroorotic acid; Boeke et al., 1987) were screened by PCR and homologous integration of the reporter construct at the mat1-Pm locus confirmed by Southern blot (JY464).

Download figure to PowerPoint

Exposing the JY464 reporter strain to M-factor results in a time- and pheromone-dependent production of β-galactosidase that can be detected by a colony colour assay or quantified using a liquid assay (Fig. 3). Low-level production of β-galactosidase in the absence of M-factor increased after about 8 h and reached a plateau after 16 h. Because of differences outlined in the previous section, our results cannot be compared with an earlier study that also used a mat1-Pm>lacZ reporter construct (Aono et al., 1994). In some respects, our strain shows greater similarity to one in which the pheromone-dependent induction of mat1-Pm was monitored using Northern blot analysis (Davey and Nielsen, 1994); both strains are cyr1 and both studies effectively monitor the activity of the mat1-Pm promoter at its correct chromosomal locus. However, a direct comparison is still difficult as the first study measured transcript levels, whereas the current work monitors the activity of a reporter enzyme — a process that requires transcription, translation and assembly into an active conformation. These differences probably explain why the pheromone-dependent increase in mat1-Pm transcripts occurred about 6 h before any increase in β-galactosidase activity (compare Fig. 3 with results in Davey and Nielsen, 1994). Furthermore, differences in the stabilities of the β-galactosidase protein and the mat1-Pm transcript presumably explain why β-galactosidase activity remained high (Fig. 3), even though the level of mat1-Pm transcripts decreased rapidly following a peak at 5 h (Davey and Nielsen, 1994). Monitoring the level of mat1-Pm>lacZ transcripts rather than the activity of β-galactosidase could avoid some of these problems, but differences in the stability of the two transcripts would still be likely to complicate any comparison between the two studies.

image

Figure 3. . Pheromone-dependent production of β-galactosidase. The mat1-Pm>lacZ reporter strain (JY464) was exposed to M-factor and β-galactosidase production assayed using o-nitrophenyl-β-d-galactoside as substrate. A. Cells were exposed to M-factor at either 0 or 10 units ml−1 and assayed at hourly intervals. B. Cells were exposed to various concentrations of M-factor for 16 h before being assayed. β-Galactosidase activity was determined colorimetrically and expressed as the ratio of o-nitrophenol product to cell density (see Experimental procedures). The values shown are the means of triplicate determinations.

Download figure to PowerPoint

Disruption of rgs1

To investigate the effect of Rgs1 on the pheromone response, we used a one-step gene replacement strategy to disrupt the rgs1 gene in the mat1-Pm>lacZ reporter strain (Fig. 4). Polymerase chain reaction (PCR)-based technology was used to prepare a construct in which the complete rgs1 coding region was replaced with a ura4+ cassette. Southern blot analysis confirmed homologous integration of this fragment following transformation of JY464. Disruption of rgs1 had no significant effect on growth (not shown).

image

Figure 4. . Disrupting the rgs1 gene. A limited restriction map of the rgs1 locus showing the extent and direction of the open reading frame. The ura4+ fragment used to disrupt the rgs1+ gene is shown below the map. The upstream non-coding region of rgs1 was amplified by PCR using the sense primer JO595 (CGGTTTCAATTGGGTAGG; complementary to the region from position −2267 to −2250 relative to the rgs1 ATG) and the antisense primer JO597 [GCGGGgATCCAAAGCTGATTCTTAC; complementary to a region immediately upstream of the ATG and includes a single base change (a G-to-c change, when considered in the sense direction), which simultaneously destroys the initiator ATG (the anticodon is CAT) and introduces a BamHI site]. The resulting PCR product was cloned as a SpeI–BamHI fragment into pBluescript (Stratagene). The downstream non-coding region of rgs1 was amplified using the sense primer JO598 (gggggatcCATAGAAAACAATCGTGTTTTAAATC; introduces a BamHI site immediately downstream of the rgs1 stop codon) and JO596 (GTTGACGCATTAAACACC; complementary to the region from position 3402–3385 relative to the rgs1 ATG — the rgs1 stop codon is at position 1444–1446). The PCR product was cloned as a BamHI–HindIII fragment into the pBluescript clone already containing the upstream non-coding region of rgs1. The ura4+ cassette was cloned into the BamHI site between the two flanking regions, and a SpeI–HindIII fragment prepared from the final construct (corresponding to rgs1::ura4+) was used to transform various yeast strains. In each case, homologous integration at the rgs1 locus was confirmed by both PCR and Southern blot (genomic DNA was digested with BamHI and probed with the fragment shown above the map). Disruption of rgs1 in the mat1-Pm>lacZ reporter strain JY464 generated JY508. JY471 was generated by disrupting rgs1 in a strain not containing the reporter construct (JY383).

Download figure to PowerPoint

Pheromone–dependent transcription of the mat1-Pm>lacZ reporter

Strains with and without rgs1 were assayed for β-galactosidase activity following exposure to M-factor (Fig. 5). Loss of rgs1 did not affect the maximum level of β-galactosidase activity, but did increase production in the absence of pheromone, and increased the sensitivity of the cells to pheromone stimulation. These changes are due to the loss of rgs1 as they were overcome by expression of a plasmid-borne rgs1 gene. Furthermore, expression of SST2 (encodes an RGS protein from the budding yeast S. cerevisiae) also overcame the loss of rgs1. Our results suggest that Rgs1 is a negative regulator of the pheromone response pathway and, consistent with predictions from sequence analysis, that it probably functions as an RGS protein.

image

Figure 5. . The influence of Rgs1 on pheromone-dependent transcription. Pheromone-dependent transcription of a mat1-Pm>lacZ reporter construct was assayed by monitoring β-galactosidase activity in cells with different combinations of RGS proteins. Control strains possessing the wild-type rgs1 gene (JY464, rgs1+), or strains lacking rgs1 (JY508, Δrgs1), were transformed with the expression vector pREP3X (JY572 and JY584) or with constructs containing rgs1 from Sz. pombe (JY580 and JY592) or SST2 from S. cerevisiae (JY576 and JY588). Cells were grown to mid-exponential phase and treated with M-factor for 16 h before being harvested. β-Galactosidase activity was determined colorimetrically and expressed as the ratio of o-nitrophenol product to cell density (see Experimental procedures). The values shown are the means of triplicate determinations.

Download figure to PowerPoint

The pheromone-independent expression of mat1-Pm involves the same basic elements as those responsible for pheromone-induced transcription (Aono et al., 1994), and it is perhaps not surprising that Rgs1 plays a role in suppressing signalling in the absence of pheromone. Spontaneous dissociation of the receptor-coupled G protein, for example, would activate expression of mat1-Pm>lacZ, and this would be increased in the absence of Rgs1. In contrast, overexpression of rgs1 (or SST2) did not reduce pheromone-independent signalling in rgs1+ cells [Fig. 5, compare JY572 (rgs1+) with JY580 (rgs1+ and Rgs1) or JY576 (rgs1+ and SST2)], indicating that at least some of this signalling is independent of Rgs1. Very similar results were reported for SST2 in S. cerevisiae (Dohlman et al., 1996).

RGS proteins do not necessarily decrease signalling intensity, and loss of rgs1 did not affect the maximum level of pheromone-dependent β-galactosidase production (Figs 3 and 5). It did, however, make the cells more sensitive to low levels of M-factor. Pheromone-dependent activity in rgs1+ cells required at least 0.1 U ml−1 M-factor whereas the Δrgs1 strain was some 100-fold more sensitive to stimulation and responded to pheromone at 0.001 U ml−1 [Fig. 5, compare JY572 (rgs1+) with JY584 (Δrgs1)]. An alternative measure of a cell's sensitivity is given by the EC50, the concentration of ligand required to induce a half-maximal response. This is not easily calculated for some of the strains but, allowing for differences in the pheromone-independent production of β-galactosidase, the EC50 for the Δrgs1 strain (JY584) was ≈ 0.04 U ml−1 and that for the rgs1+ strain (JY572) ≈ 1.5 U ml−1. This suggests that the Δrgs1 strain is about 40-fold more sensitive than the rgs1+ strain.

Expression of rgs1 from the nmt1 promoter (Maundrell, 1990; 1993) overcame the increased pheromone sensitivity of rgs1-strains. Indeed, the cells were less sensitive than wild-type (rgs1+) strains, and the EC50 for JY592 (Δrgs1 and Rgs1) was ≈ 6 U ml−1 [compared with ≈ 1.5 U ml−1 for JY572 (rgs1+)]. The level of Rgs1 protein appears to be limiting even in wild-type (rgs1+) cells, as expressing rgs1 from the powerful nmt1 promoter further reduced the sensitivity of these cells to stimulation [EC50 for JY580 (rgs1+ and Rgs1) is ≈ 6 U ml−1]. Increasing the level of Rgs1 did not affect the maximum level of β-galactosidase activity. Further work is required to determine whether the removal of Gα-GTP is indeed the rate-limiting step in the recovery process.

SST2 partly overcame the loss of rgs1, increasing the EC50 from ≈ 0.04 U ml−1 for JY584 (Δrgs1) to ≈ 0.7 U ml−1 for JY588 (Δrgs1 and SST2). Such a result is not unexpected given the sequence similarity between the Sz. pombe Gα subunit, encoded by the gpa1 gene, (Obara et al., 1991) and its S. cerevisiae counterpart (GPA1) (Miyajima et al., 1987; Nakafuku et al., 1987). Indeed, many RGS proteins have relatively broad specificities and can act as GAPs for several Gα subunits. Mammalian RGS4, for example, stimulates GTP hydrolysis for all Gα subtypes except Gs (for which no RGS protein has yet been identified) (Berman et al., 1996; Hepler et al., 1997; Huang et al., 1997) and can partly suppress the loss of SST2 in S. cerevisiae (Druey et al., 1996). Several other mammalian RGS proteins can also complement the loss of SST2 (Druey et al., 1996; Chen et al., 1997).

There are several reasons that could explain the inability of SST2 to rescue fully the loss of rgs1, and also its lack of effect when expressed in an rgs1+ strain [there was little difference between JY572 (rgs1+) and JY576 (rgs1+ and SST2)]. Differences in the level of expression of rgs1 and SST2 from the nmt1 promoter, for example, or differences in the stabilities of the two proteins or in their respective GAP activities towards Gpa1 could all contribute to the effect observed. Alternatively, the differences could be due to Sz. pombe being able to regulate the activity of Rgs1 but not SST2. It is also possible that Rgs1 is not only a GAP for Gpa1, but that it plays additional roles in regulating the pheromone response, roles that cannot be performed by SST2. These possibilities are discussed further in a later section.

Shmoo formation

We next investigated the involvement of Rgs1 in events that occur after the induction of mat1-Pm. Shmoo formation, the pheromone-dependent elongation of a responding cell, can be quantified using an assay that monitors the increase in cell volume following exposure to pheromone (Davey, 1992). Although a non-synchronous culture contains cells of various sizes, the increase in cell volume extends to the median cell volume of the culture. This is the volume that divides the distribution into two equal groups such that 50% of the cells are smaller than the median volume and 50% of the cells are larger than the median volume. Cells are exposed to pheromone and the size distribution of the responding culture is monitored using a Coulter Channelyser. The percentage of cells that are larger than the median volume of a culture not exposed to pheromone is then calculated, and subtracting 50 from this value provides the ‘shmoo response’. An additional feature of the assay is that it is performed under conditions of nitrogen starvation, and the increase in volume is irreversible because the cells are unable to divide and recover their original size. The auxotrophic requirements and the lack of functional cyr1 and mat1-Pm genes precludes the use of the original mat1-Pm>lacZ reporter strain in the shmoo assay, and we therefore disrupted the rgs1 gene in a more appropriate strain (JY383, to generate JY471) using the strategy described in Fig. 4. Homologous integration of the disrupted construct was confirmed using Southern blot analysis and the results of the cell volume assay are shown in Fig. 6.

image

Figure 6. . The influence of Rgs1 on shmoo formation. The pheromone-dependent increase in cell volume was assayed in cells with different combinations of RGS proteins. Control strains possessing the wild-type rgs1 gene (JY330, rgs1+) or strains lacking rgs1 (JY471, Δrgs1) were transformed with the expression vector pREP3X (JY510 and JY478) or with constructs containing rgs1 from Sz. pombe (JY527 and JY535) or SST2 from S. cerevisiae (JY514 and JY518). Growing cells were used to inoculate SSL at 1 × 106 cells ml−1 and cultured for 24 h at 29°C before being used to inoculate SSL containing appropriate levels of M-factor. The increase in cell volume was monitored using a Coulter Channelyser after incubation at 29°C for 48 h (Davey, 1992). Calculation of the ‘Shmoo response’ value is described in the text.

Download figure to PowerPoint

Loss of rgs1 did not affect the maximum level of shmoo response but increased the sensitivity of cells to pheromone. The EC50 for JY478 (Δrgs1) was ≈ 0.04 U ml−1 and that for JY510 (rgs1+) was ≈ 0.8 U ml−1, an increase in sensitivity of about 20-fold. Overexpression of rgs1 in either rgs1+ or Δrgs1 strains had little effect on the maximum level of response but increased the EC50 to ≈ 4 U ml−1. This is consistent with the results of the β-galactosidase assay, and further supports the suggestion that the amount of Rgs1 in wild-type strains is limiting with respect to its ability to regulate the pheromone response.

As predicted from the mat1-Pm>lacZ results, expressing SST2 decreased the sensitivity of both rgs1+ and Δrgs1 strains, although not quite as effectively as rgs1. Unexpectedly, however, SST2 limited the maximum shmoo response attained in the assay: increasing the M-factor beyond 10 U ml−1 did not increase the shmoo response above 16%. A 16% shmoo response can be monitored easily using the Coulter Channelyser; however, this is too small an increase for differentiation between responding cells and control cells under microscopic examination. Rgs1 is not required for the formation of highly elongated shmoos. [JY478 (Δrgs1) forms such elongated shmoos, however it does so at pheromone concentrations lower than those required by rgs1+ strains.] Therefore, the reduced elongation of strains overexpressing SST2, regardless of whether they are rgs1+ or Δrgs1, suggests that SST2 partially inhibits shmoo formation. We are currently investigating whether this inhibition is due to the inability of Sz. pombe to correctly regulate SST2 activity.

Mating

The effect of Rgs1 on conjugation and sporulation was assessed using a quantitative mating assay (Fig. 7). Mating was completely inhibited by loss of rgs1, but could be recovered (to 80% of the control level) by expression of rgs1 from the nmt1 promoter. Expression of SST2 failed to rescue the mating defect of a Δrgs1 strain but did not inhibit mating of an rgs1+ strain.

image

Figure 7. . The influence of Rgs1 on mating. Strains containing different combinations of RGS proteins were tested for their ability to mate with an M-strain (JY291). P-strains possessing the wild-type rgs1 gene (JY330, rgs1+) or strains lacking rgs1 (JY471, Δrgs1) were transformed with the expression vector pREP3X (JY510 and JY478) or with constructs containing rgs1 from Sz. pombe (JY527 and JY535) or SST2 from S. cerevisiae (JY514 and JY518). All strains were grown to mid-exponential phase in minimal medium, washed and resuspended in distilled water at 1 × 106 cells ml−1. Equal volumes of the two strains to be tested were mixed and 10 μl spotted onto SSA plates. After 4 days at 29°C, the plates were exposed to iodine vapour to stain spores dark brown and provide a qualitative measure of mating (Egel et al., 1994). To provide a more quantitative comparison, mating mixtures were resuspended in water and the numbers of spores and vegetative cells determined by light microscopy. Under the conditions used, rgs1+ cells (JY510) have a mating efficiency of ≈ 35%.

Download figure to PowerPoint

The loss of mating ability of Δrgs1 strains contrasts with the residual mating ability of S. cerevisiae strains lacking SST2 (3–10% of wild-type efficiency; Chan and Otte, 1982). This may reflect a difference in the roles of the two proteins or could simply be due to differences in the efficiencies with which the two yeast initiate mating. In natural cultures, Sz. pombe exists primarily as a haploid organism whereas S. cerevisiae generally exists as a diploid, and their promiscuity may reflect these preferences. The essential requirement for Rgs1 in the mating process is yet to be defined, but our earlier results suggest that it is likely to be a relatively late event in the process as loss of rgs1 prevents neither pheromone-dependent transcription nor shmoo formation. Examination of the mating mixtures involving Δrgs1 strains reveals that the cells fail to agglutinate with an appropriate partner (not shown); it will be interesting to discover whether the mating-specific agglutinins are expressed and whether they are targeted to the leading tip of the elongated shmoo.

Expression of SST2 in an rgs1+ strain did not inhibit mating, despite the fact that it limited shmoo formation in the same cells (see Fig. 6). The shmoos of reduced elongation, produced in the presence of SST2, are able to mate. Indeed, examination of a standard mating mixture of M-cells and P-cells indicates that the majority of cells in the mixture do not become highly elongated. Only a few cells, possibly those that fail to identify a mating partner, develop into the highly elongated shmoos observed in the cell volume assay.

Rgs1 in M-cells

This paper focuses on the role of Rgs1 in P-cells, but we have obtained almost identical results in M-cells stimulated with P-factor (not shown). Loss of rgs1 causes cells to become hypersensitive to P-factor (as judged by shmoo formation and the expression of a lacZ reporter construct that is dependent upon stimulation by P-factor) and leads to an inability to mate. The hypersensitivity but not the mating defects are overcome by expression of SST2.

Conclusion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results and discussion
  5. Conclusion
  6. Experimental procedures
  7. Acknowledgements
  8. References

Sequence analysis of Rgs1 [an open reading frame (ORF) identified by genome sequencing, previously called YA8c] suggests it belongs to the RGS family of signal regulators (Tesmer et al., 1997). Results presented in this investigation agree with this suggestion, demonstrating that Rgs1 is a negative regulator of the pheromone response pathway. Loss of rgs1 increases sensitivity of pheromone signalling as measured by pheromone-dependent transcription and the mating-specific elongation of the cell to form a shmoo. The failure of Δrgs1 strains to conjugate may indicate that Rgs1 is not simply a regulator of the response but may play a second role in the mating process. This suggestion is supported by the ability of SST2 (an RGS protein that negatively regulates pheromone signalling in S. cerevisiae) to overcome the hypersensitivity of the Δrgs1 strains but not to overcome its mating defect. Further work will be required to determine more completely the role of Rgs1 in the mating process.

The regulation of Rgs1 activity is another aspect that requires further investigation. Results presented in this report are consistent with the constitutive expression of the rgs1 gene but, in common with many RGS proteins (including SST2; Dohlman et al., 1996), one might expect expression to be increased following cell stimulation (Siderovski et al., 1994; Druey et al., 1996). The presence of multiple TR-box motifs close to the start of the rgs1 gene are consistent with this expectation (Kjaerulff et al., 1997). It is also likely that the activity of Rgs1 is regulated through interactions with other proteins. Finally, one might also expect the Rgs1 protein to be relatively unstable. Information about the transcription of rgs1 and the stability and regulation of Rgs1 will be described elsewhere (J. Davey, P. Watson and C. Pateman, in preparation).

The mat1-Pm >lacZ reporter strain has been invaluable for quantifying the involvement of Rgs1 in the pheromone response pathway and can be applied to any protein suspected of having a role in this process. It is also suitable for use in high-throughput screens to identify desensitization mutants in a population of randomly mutagenized cells, and should allow isolation of further components from the recovery machinery.

Experimental procedures

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results and discussion
  5. Conclusion
  6. Experimental procedures
  7. Acknowledgements
  8. References

Strains, reagents and general methods

The yeast strains used in this study are listed in Table 1. General yeast procedures were performed as described previously (Davey et al., 1995; Watson and Davey, 1998). Details for the cell volume assay and the mating assay are included in the appropriate figure legends. Culture media used were YE (yeast extract, routine cell growth), PM (a defined minimal medium), SSL (a synthetic sporulation medium with a low level of nitrogen) and SSA [SSL containing 1.6% (w/v) agar; Davey et al., 1995]. M-factor was purified from culture medium using methods described previously (Davey, 1992). DNA manipulations were performed by standard methods. Amplification by PCR was performed in 50 μl volumes using Pwo DNA polymerase (from Pyrococcus woesei; supplied by Boehringer Mannheim), as this has a 3′–5′ exonuclease (proofreading) activity and reduces the introduction of errors during amplification. All constructs were sequenced by the dideoxynucleotide method with double-stranded DNA as template to confirm that no errors had been introduced during amplification. Oligonucleotides were synthesized by either Alta Bioscience or Zeneca Pharmaceuticals.

Table 1. . Sz. pombe strains.Thumbnail image of

Constructing pREP3X-Rgs1 and pREP3X-SST2

The pREP series of Sz. pombe vectors allows the expression of particular genes to be under the control of the thiamine-repressible nmt1 promoter (Maundrell, 1990; 1993). Thiamine-mediated repression of the nmt1 promoter in pREP3X is not complete and there is significant expression of genes cloned into this vector under all conditions (Basi et al., 1993). The rgs1 ORF was amplified using the sense primer JO599 (ggggatatccaccATGCCCGCCCTTCATAACCCTTC; includes an EcoRV site and the initiator ATG, the sequence immediately upstream of the ATG has been modified from the normal TTTGG to one that is expected to be more favourable for translation; Yun et al., 1996) and the antisense primer JO600 (ggggatatCATTAAATACCGAGCCCCCCATTC; includes an EcoRV site and the TTA stop anticodon for rgs1). The PCR product was digested with EcoRV and cloned into the end-filled BamHI site of pREP3X to generate JD1013 (pREP3X-Rgs1). The SST2 ORF was amplified using the sense primer JO601 (ggggatatccaccATGGTGGATAAAAATAGGA CGTTGC; includes an EcoRV site and the initiator ATG, the sequence immediately upstream of the ATG has been changed to one that is expected to be more favourable for translation) and the antisense primer JO602 (ggggatatCAAT GAAATTAGCACTTTTCTTGGATTTC; includes an EcoRV site and the TTA stop anticodon for SST2) and cloned as an EcoRV fragment into pREP3X to generate JD986 (pREP3X-SST2).

β-Galactosidase assay

Cells were cultured in PM to ≈ 4 × 105 cells ml−1 and 500 μl aliquots added to 2-ml Eppendorf Safe-Lock tubes (Sigma, Poole, Dorset, UK). M-factor was added in 5 μl of methanol (from a stock solution at 1000 units ml−1 in methanol) and samples rotated at 29°C (standard assay conditions used a 16 h incubation period). Cells were harvested and resuspended in 800 μl of Z buffer [0.1 M sodium phosphate (pH 7.0), 10 mM KCl, 1 mM MgSO4, 50 mM 2-mercaptoethanol] with 0.5% (v:v) chloroform and 0.005% (wt:vol) SDS and 2.25 mM o-nitrophenyl-β-d-galactoside (ONPG) substrate. After 90 min, the reaction was stopped by the addition of 200 μl Na2CO3 (0.4 M final concentration). Samples were analysed colourimetrically and β-galactosidase activity units expressed as the ratio of o-nitrophenol product (optical density at 420 nm) to cell density (optical density at 600 nm) using the formula (OD420 − OD600) ÷ OD600 (Guarente, 1983).

Acknowledgements

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results and discussion
  5. Conclusion
  6. Experimental procedures
  7. Acknowledgements
  8. References

We thank Masayuki Yamamoto and Olaf Nielsen for strains and plasmids. This work was supported by the Cancer Research Campaign, UK (Ref. SP1972; P.W. and K.D.), and a Cooperative Award in Science and Engineering from the Biotechnology and Biological Sciences Research Council and Zeneca Pharmaceuticals (M.D.). J.D. is a Lister Institute Research Fellow.

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results and discussion
  5. Conclusion
  6. Experimental procedures
  7. Acknowledgements
  8. References
  • 1
    Aono, T., Yanai, H., Miki, F., Davey, J., Shimoda, C. (1994) Mating pheromone-induced expression of the mat1-Pm gene of Schizosaccharomyces pombe: identification of signalling components and characterisation of upstream controlling elements. Yeast 10: 757770.
  • 2
    Basi, G., Schmid, E., Maundrell, K. (1993) TATA box mutations in the Schizosaccharomyces pombe nmt1 promoter affect transcription efficiency but not the transcription start point or thiamine repressibility. Gene 123: 131136.
  • 3
    Berman, D.M. & Gilman, A.G. (1998) Mammalian RGS proteins: barbarians at the gate. J Biol Chem 273: 12691272.
  • 4
    Berman, D.M., Wilki, T.M., Gilman, A.G. (1996) GAIP and RGS4 are GTPase-activating proteins for the Gi subfamily of G protein α-subunits. Cell 86: 445452.
  • 5
    Boeke, J.D., Trueheart, J., Natsoulis, G., Fink, G.R. (1987) 5′-fluroorotic acid as a selective agent in yeast molecular genetics. Methods Enzymol 152: 164175.
  • 6
    Böhm, S.K., Grady, E.F., Bunnett, N.W. (1997) Regulatory mechanisms that modulate signalling by G protein-coupled receptors. Biochem J 322: 118.
  • 7
    Chan, R.K. & Otte, C.A. (1982) Physiological characterization of Saccharomyces cerevisiae mutants supersensitive to G1 arrest by a-factor and α-factor pheromones. Mol Cell Biol 2: 2129.
  • 8
    Chen, C., Zheng, B., Han, J., Lin, S.-C. (1997) Characterization of a novel mammalian RGS protein that binds to Gα proteins and inhibits pheromone signaling in yeast. J Biol Chem 272: 86798685.
  • 9
    Davey, J. (1992) Mating pheromones of the fission yeast Schizosaccharomyces pombe: purification and structural characterisation of M-factor and isolation and structural characterisation of two genes encoding the pheromone. EMBO J 11: 951960.
  • 10
    Davey, J. (1998) Fusion of a fission yeast. Yeast 14: 15291566.
  • 11
    Davey, J. & Nielsen, O. (1994) Mutations in cyr1 and pat1 reveal pheromone-induced G1 arrest in the fission yeast Schizosaccharomyces pombe. Curr Genet 26: 105112.
  • 12
    Davey, J., Egel, R., Nielsen, O. (1995) Pheromone procedures in fission yeast. In Methods in Molecular Genetics, Vol. 6. Adolph, K.W. (ed.). San Diego: Academic Press, pp. 247263.
  • 13
    De Vries, L., Elenko, E., Huber, L., Jones, T.L.Z., Farquhar, M.G. (1996) GAIP is membrane-anchored by palmitoylation and interacts with the activated (GTP-bound) form of Gαi subunits. Proc Natl Acad Sci USA 93: 1520315208.
  • 14
    De Vries, L., Lou, X., Zhao, G., Zheng, B., Farquhar, M.G. (1998) GIPC, a PDZ domain containing protein, interacts specifically with the C-terminus of RGS-GAIP. Proc Natl Acad Sci USA 95: 1234012345.
  • 15
    Dohlman, H.G. & Thorner, J. (1997) RGS proteins and signaling by heterotrimeric G proteins. J Biol Chem 272: 38713874.
  • 16
    Dohlman, H.G., Apaniesk, D., Chen, Y., Song, J., Nusskern, D. (1995) Inhibition of G protein signalling by dominant gain-of-function mutations in Sst2p, a pheromone desensitisation factor in Saccharomyces cerevisiae. Mol Cell Biol 15: 36353643.
  • 17
    Dohlman, H.G., Song, J.P., Ma, D.R., Courchesne, W.E., Thorner, J. (1996) SST2, a negative regulator of pheromone signalling in the yeast Saccharomyces cerevisiae: expression, localisation and genetic interaction and physical association with GPA1 (the G protein α subunit). Mol Cell Biol 16: 51945209.
  • 18
    Druey, K.M., Blumer, K.J., Kang, V.H., Kehrl, J.H. (1996) Inhibition of G protein-mediated MAP kinase activation by members of a novel mammalian gene family. Nature 379: 742746.
  • 19
    Egel, R. (1992) Pheromone detection and pheromone hypersensitive mutants in the fission yeast Schizosaccharomyces pombe. Yeast 8: S363.
  • 20
    Egel, R., Willer, M., Kjaerulff, S., Davey, J., Nielsen, O. (1994) Assessment of pheromone production and response in fission yeast by a halo test of induced sporulation. Yeast 10: 13471354.
  • 21
    Faurobert, E. & Hurley, J.B. (1997) The core domain of a new retina specific RGS protein stimulates the GTPase activity of transducin in vitro. Proc Natl Acad Sci USA 94: 29452950.
  • 22
    Freedman, N.J. & Lefkowitz, R.J. (1996) Desensitisation of G protein-coupled receptors. Recent Prog Hormone Res 51: 319353.
  • 23
    Fukui, Y., Kozasa, T., Kaziro, Y., Takeda, T., Yamamoto, M. (1986) Role of a ras homolog in the life cycle of Schizosaccharomyces pombe. Cell 44: 329336.
  • 24
    Grimm, C., Kohli, J., Murray, J., Maundrell, K. (1988) Genetic engineering of Schizosaccharomyces pombe: a system for gene disruption and replacement using the ura4 gene as a selectable marker. Mol Gen Genet 215: 8186.
  • 25
    Guarente, L. (1983) Yeast promoters and lacZ fusions designed to study expression of cloned genes in yeast. Methods Enzymol 101: 181191.
  • 26
    Hepler, J.R., Berman, D.M., Gilman, A.G., Kozasa, T. (1997) RGS4 and GAIP are GTPase-activating proteins for Gαq and block activation of phospholipase C-β by γ-GTP-Gαq. Proc Natl Acad Sci USA 94: 428432.
  • 27
    Huang, C., Hepler, J.R., Gilman, A.G., Mumby, S.M. (1997) Attenuation of Gi- and Gq-mediated signaling by expression of RGS4 or GAIP in mammalian cells. Proc Natl Acad Sci USA 94: 61596163.
  • 28
    Imai, Y. & Yamamoto, M. (1992) Schizosaccharomyces pombe sxa1+ and sxa2+ encode putative proteases involved in the mating response. Mol Cell Biol 12: 18271834.
  • 29
    Imai, Y. & Yamamoto, M. (1994) The fission yeast mating pheromone P-factor: its molecular structure, gene structure and physiological activities to induce gene expression and G1 arrest in the mating partner. Genes Dev 8: 328338.
  • 30
    Itoh, K., Krupnik, V.E., Sokol, S.Y. (1998) Axis determination in Xenopus involves biochemical interactions of axin, glycogen synthase kinase-3 and β-catenin. Curr Biol 8: 591594.
  • 31
    Kelly, M., Burke, J., Smith, M., Klar, A., Beach, D. (1988) Four mating-type genes control sexual differentiation in the fission yeast. EMBO J 7: 15371547.
  • 32
    Kjaerulff, S., Dooijes, D., Clevers, H., Nielsen, O. (1997) Cell differentiation by interaction of two HMG-box proteins: Mat1-Mc activates M cell-specific genes in S. pombe by recruiting the ubiquitous transcription factor Ste11 to weak binding sites. EMBO J 16: 40214033.
  • 33
    Klar, A.J.S. & Miglio, L.M. (1986) Initiation of meiotic recombination by double-strand DNA breaks in S. pombe. Cell 46: 725731.
  • 34
    Koelle, M.R. & Horvitz, H.R. (1996) EGL-10 regulates G protein signalling in the C. elegans nervous system and shares a conserved domain with many mammalian proteins. Cell 84: 115125.
  • 35
    Ladds, G., Rasmussen, E.M., Young, T., Nielsen, O., Davey, J. (1996) The sxa2-dependent inactivation of the P-factor mating pheromone in the fission yeast Schizosaccharomyces pombe. Mol Microbiol 20: 3542.
  • 36
    Lee, B.N. & Adams, T.H. (1994) Overexpression of FlbA, an early regulator of Aspergillus asexual sporulation, leads to activation of BrlA and premature initiation of development. Mol Microbiol 14: 323334.
  • 37
    Maundrell, K. (1990) nmt1 of fission yeast: a highly transcribed gene completely repressed by thiamine. J Biol Chem 265: 1085710864.
  • 38
    Maundrell, K. (1993) Thiamine-repressible expression vectors pREP and pRIP for fission yeast. Gene 123: 127130.
  • 39
    Miyajima, I., Nakafuku, M., Nakayama, N., Brenner, C., Miyajima, A., Kaibuchi, K. et al (1987) GPA1, a haploid-specific essential gene, encodes a yeast homolog of mammalian G protein which may be involved in mating factor signal transduction. Cell 50: 10111019.
  • 40
    Nakafuku, M., Itoh, H., Nakamura, S., Kaziro, Y. (1987) Occurrence in Saccharomyces cerevisiae of a gene homologous to the cDNA coding for the α-subunit of mammalian G proteins. Proc Natl Acad Sci USA 84: 21402144.
  • 41
    Nielsen, O., Davey, J., Egel, R. (1992) The ras1 function of Schizosaccharomyces pombe mediates pheromone-induced transcription. EMBO J 11: 13911395.
  • 42
    Obara, T., Nakafuku, M., Yamamoto, M., Kaziro, Y. (1991) Isolation and characterisation of a gene encoding a G-protein α-subunit from Schizosaccharomyces pombe: involvement in mating and sporulation pathways. Proc Natl Acad Sci USA 88: 58775881.
  • 43
    Popov, S., Yu, K., Kozasa, T., Wilkie, T.M. (1997) The regulators of G protein signalling (RGS) domains of RGS4, RGS10, and GAIP retain GTPase activating protein activity in vitro. Proc Natl Acad Sci USA 94: 72167220.
  • 44
    Siderovski, D.P., Heximer, S.P., Forsdyke, D.R. (1994) A human gene encoding a putative basic helix-loop-helix phosphoprotein whose mRNA increases rapidly in cycloheximide-treated blood mononuclear cells. DNA Cell Biol 13: 125147.
  • 45
    Snow, B.E., Hall, R.A., Krumins, A.M., Brothers, G.M., Bouchard, D., Brothers, C.A., et al (1998a) GTPase activating specificity of RGS12 and binding specificity of an alternatively spliced PDZ (PSD-95/Dlg/ZO-1) domain. J Biol Chem 273: 1774917755.
  • 46
    Snow, B.E., Krumins, A.M., Brothers, G.M., Lee, S.-F., Wall, M.A., Chung, S. et al (1998b) A G protein γ subunit-like domain shared between RGS11 and other RGS proteins specifies binding to Gβ5 subunits. Proc Natl Acad Sci USA 95: 1330713312.
  • 47
    Srinivasa, S.P., Bernstein, L.S., Blumer, K.J., Linder, M.E. (1998) Plasma membrane localization is required for RGS4 function in Saccharomyces cerevisiae. Proc Natl Acad Sci USA 95: 55845589.
  • 48
    Tesmer, J.J.G., Berman, D.M., Gilman, A.G., Sprang, S.R. (1997) Structure of RGS4 bound to AlF (4-) -activated Gαi1: stabilisation of the transition state for GTP hydrolysis. Cell 89: 251261.
  • 49
    Watson, P. & Davey, J. (1998) Characterization of the Prk1 protein kinase from Schizosaccharomyces pombe. Yeast 14: 485492.
  • 50
    Yamawaki-Kataoka, Y., Tamaoki, T., Choe, H.-R., Tanaka, H., Kataoka, T. (1989) Adenylate cyclases in yeast: a comparison of the genes from Schizosaccharomyces pombe and Saccharomyces cerevisiae. Proc Natl Acad Sci USA 86: 56935697.
  • 51
    Young, D., Riggs, M., Field, J., Vojtek, A., Broek, D., Wigler, M. (1989) The adenylyl cyclase gene from Schizosaccharomyces pombe. Proc Natl Acad Sci USA 86: 79897993.
  • 52
    Yun, D.-F., Laz, T.M., Clements, J.M., Sherman, F. (1996) mRNA sequences influencing translation and the selection of AUG initiator codons in the yeast Saccharomyces Cerevisiae. Mol Microbiol 19: 12251239.
  • 53
    Zerangue, N. & Jan, L.Y. (1998) G protein signaling: fine-tuning signaling kinetics. Curr Biol 8: R313R316.