New insights into the role of CcmC, CcmD and CcmE in the haem delivery pathway during cytochrome c maturation by a complete mutational analysis of the conserved tryptophan-rich motif of CcmC

Authors


Abstract

Maturation of c-type cytochromes in Escherichia coli is a complex process requiring eight membrane proteins encoded by the ccmABCDEFGH operon. CcmE is a mediator of haem delivery. It binds haem transiently at a conserved histidine residue and releases it for directed transfer to apocytochrome c. CcmC, an integral membrane protein with six transmembrane helices, is necessary and sufficient to incorporate haem covalently into CcmE. CcmC contains a highly conserved tryptophan-rich motif, WGXXWXWD, in its second periplasmic loop. Here, we present the results of a systematic mutational analysis of this motif. Changes of the non-conserved T121 and W122 to A resulted in wild-type CcmC activity. Changes of the single amino acids W119A, G120A, W123A, W125I and D126A or of the spacing within the motif by deleting V124 (ΔV124) inhibited the covalent haem incorporation into CcmE. Enhanced expression of ccmD suppressed this mutant phenotype by increasing the amounts of CcmC and CcmE polypeptides in the membrane. The ΔV124 mutant showed the strongest defect of all single mutants. Mutants in which six residues of the tryptophan-rich motif were changed showed no residual CcmC activity. This phenotype was independent of the level of ccmD expression. Our results demonstrate the functional importance of the tryptophan-rich motif for haem transfer to CcmE. We propose that the three membrane proteins CcmC, CcmD and CcmE interact directly with each other, establishing a cytoplasm to periplasm haem delivery pathway for cytochrome c maturation.

Introduction

Haem is a cofactor associated with proteins involved in various biological activities. In c-type cytochromes, haem is attached covalently to a conserved CXXCH sequence motif. Although the synthesis of haem and apocytochrome c takes place in the cytoplasm, the covalent attachment of haem to apocytochrome c is a periplasmic process.

Numerous pathogenic bacteria are able to take up haem via TonB-mediated import systems to use it as a source of iron (reviewed by Moeck and Coulton, 1998; Wandersman and Stojiljkovic, 2000). However, it is unknown how the amphipathic haem molecule is exported through the membrane during biogenesis of periplasmic cytochromes. Cook and Poole (2000) recently showed that haem is translocated into everted membrane vesicles of Escherichia coli by an energy-independent mechanism, but no evidence for a specific haem export system was obtained.

E. coli synthesizes up to five different c-type cytochromes under anaerobic growth conditions (Iobbi-Nivol et al., 1994). They are involved in the electron transfer to terminal reductases of the anaerobic respiratory chain with nitrate, nitrite or TMAO (trimethylamine-N-oxide) as electron acceptors. These c-type cytochromes are either localized in the periplasm as soluble proteins or found attached to the membrane, with their functional domains facing the periplasm.

In E. coli, eight genes, named ccmA–H, have been found to be essential for cytochrome c maturation (Thöny-Meyer et al., 1995; Grove et al., 1996a). CcmE binds haem covalently at a single histidine residue and then transfers it to apocytochrome c, thereby acting as a periplasmic haem chaperone (Schulz et al., 1998). Recently, we showed that the activity of CcmC is necessary and sufficient to incorporate haem covalently into CcmE (Schulz et al., 1999). The small, integral membrane protein CcmD was found to be involved in stabilising CcmE (Schulz et al., 1999).

The membrane topology of the Rhodobacter capsulatus CcmC homologue HelC and the Pseudomonas fluorescens ATCC 17400 CcmC was analysed by Goldman et al. (1998) and Gaballa et al. (1998). CcmC contains six transmembrane helices, separated by two cytoplasmic and three periplasmic loops. Two strictly conserved histidines in the first and third periplasmic loop are essential for the function of CcmC in E. coli (Schulz et al., 1999). The most conserved domain in CcmC homologues is the tryptophan-rich motif PXWGS/TφWXWDA/PRLT present in the second periplasmic loop, where φ represents an aromatic amino acid residue (Fig. 1) (Thöny-Meyer et al., 1994; Thöny-Meyer, 1997; Kranz et al., 1998; Xie and Merchant, 1998). These conserved residues, together with the two histidines, have been postulated to be involved in an interaction with haem. It was reported that CcmC in P. fluorescens and Paracoccus denitrificans had an additional function in the biogenesis and/or secretion of pyoverdine, a siderophore which – like haem – is an amphiphilic organic iron complex (Gaballa et al., 1996; Page and Ferguson, 1999). A similar, conserved tryptophan-rich motif WGGφWXWD and flanking histidine residues in periplasmic loops are present in CcmF and its orthologue NrfE of E. coli, which are thought to interact with haem (Fig. 1). CcmF and NrfE have been suggested to function as bacterial cytochrome c haem lyases, catalysing the formation of the thioether bonds between apocytochrome c and haem (Grove et al., 1996b; Eaves et al., 1998). Another conserved tryptophan-rich motif is present in CcsA homologues from Gram-positive bacteria, ε-subclass of proteobacteria and plant chloroplasts (Kranz et al., 1998; Xie and Merchant, 1998). In Chlamydomonas reinhardtii, ccsA is required for the maturation of c-type cytochromes (Xie and Merchant, 1996). This further substantiates the model that the tryptophan-rich motif forms a hydrophobic surface, facilitating the binding of haem. A minimal consensus sequence of the tryptophan-rich motifs WGXφWXWD of CcmC, CcmF and CcsA is shown in Fig. 1. By performing a systematic mutational analysis of the minimal consensus motif of E. coli CcmC, we tested the involvement of each individual amino acid in haem transfer to CcmE and on cytochrome c biogenesis.

Figure 1.

Amino acid sequence alignment of the tryptophan-rich motif of CcmC homologues from representative organisms. Strictly conserved residues are shaded in black, aromatic amino acids in grey and the flanking putative transmembrane helices are indicated. For comparison, the tryptophan-rich motifs of E. coli CcmF/NrfE and C. reinhardtii CcsA are shown, where the black-shaded residues are also conserved in homologues from other organisms. The minimal consensus sequence of the motif is shown below. X, any amino acid, φ, aromatic amino acid. Ec, E. coli; Bj, Bradyrhizobium japonicum (Ramseier et al., 1991); Hi, Haemophilus influenzae (Fleischmann et al., 1995); Pc, Pantoea citrea (Pujol and Kado, 2000); Pd, P. denitrificans (Page et al., 1997); Pf, P. fluorescens (Gaballa et al., 1996); Pp, Pseudomonas putida (AJ131925); Ra, Reclinomonas americana (Lang et al., 1997); Rc, R. capsulatus (Beckman et al., 1992); Rp, Rickettsia prowazekii (Andersson et al., 1998); Rs, Rhodobacter sphaeroides (U83136); Sp, Shewanella putrefaciens (AF044582); At, Arabidopsis thaliana (Marienfeld et al., 1996); Cr, C. reinhardtii (Chen and Moroney, 1995).

Results

The tryptophan-rich motif is involved in haem transfer to CcmE

Most residues of the tryptophan-rich motif in CcmC (Fig. 1) were changed to the small uncharged amino acid alanine. The residue V124 was deleted in order to change the spacing within the motif rather than the side-chain of this non-conserved amino acid. The residue W125 was changed to isoleucine for reasons of practicality during mutant construction.

As we have shown previously, CcmC is sufficient to trigger haem binding to CcmE. We now analysed the ability of the mutants to attach haem covalently to CcmE in a minimal system, i.e. in the absence of other ccm genes. The Δccm mutant EC06, in which the ccmA–H genes are deleted (Thöny-Meyer et al., 1995), was co-transformed with plasmid pEC458 (pccmE) and with plasmids expressing different ccmC mutant alleles. Figure 2A (top) shows that in the presence of wild-type CcmC (lane 2) haem was incorporated into CcmE, whereas in most of the ccmC mutants and in the negative control (vector only) no haem attachment to CcmE occurred (lanes 1, 3, 4, 7–10). Only the non-conserved residues T121 and W122 (lanes 5 and 6) could be replaced by alanines without loss of activity. These results demonstrate that the conserved residues W119, G120, W123, V124, W125 and D126 of the tryptophan-rich motif of CcmC are involved in holo-CcmE formation.

Figure 2.

Functional analysis of point mutants in the tryptophan-rich motif of CcmC and dissection of the role of CcmD in the cytochrome c biogenesis pathway. The Δccm mutant EC06 was co-transformed with plasmids expressing genes encoding different CcmC point mutants plus either pEC458 expressing ccmE (top) or with pEC459 expressing ccmDE (bottom) respectively.

A. Activity stain for covalently bound haem of 100 µg membrane proteins after 15% SDS–PAGE. CcmC point mutants were analysed for their ability to accumulate holo-CcmE either in the absence (top) or presence (bottom) of CcmD.

B. Immunoblot of the same membrane fractions (20 µg protein) as in A probed with anti-CcmE serum. All preparation steps for SDS–PAGE, Western blot transfer and detection were performed at the same time. Thus, for all samples, the intensity of the bands is proportional to the amount of CcmE present in the sample.

C. Immunoblot of the same membrane fractions (50 µg protein) as in A probed with anti-CcmC serum. As for B, visualization of all samples was performed at the same time. Lanes: 1, vector pACYC184; 2, wt, pEC439 pccmC (wild-type); 3, W, pEC450 pccmC (W119A); 4, G, pEC454 pccmC (G120A); 5, T, pEC455 pccmC (T121A); 6, W, pEC456 pccmC (W122A); 7, W, pEC471 pccmC (W123A); 8, V, pEC457 pccmC (ΔV124); 9, W, pEC451 pccmC (W125I); 10, D, pEC452 pccmC (D126A), 11, A6, pEC477 pccmC (W119A/[W122–D126]A); 12, Δ5, pEC478 pccmC (W119A/Δ[W122–D126]); 13, H, pEC470 pccmC (H184A).

A different picture emerged when the Δccm mutant was transformed with plasmid pEC459, (pccmDE) from which the small membrane protein CcmD is produced concomitantly with CcmE, and with a plasmid expressing individual ccmC mutant alleles (Fig. 2A, bottom). Upon enhanced expression of ccmD, all single CcmC point mutants were active in haem attachment to CcmE (Fig. 2A, top, lanes 3–10), albeit to various extents. The mutant ΔV124 showed a significantly reduced activity compared with the other point mutants (Fig. 2A, bottom, lane 8). The finding that expression of ccmD from a constitutive promoter of a low copy number plasmid was able to suppress the mutant phenotype prompted us to test whether more dramatic changes in the tryptophan-rich motif lead to an entire loss of CcmC function. For this purpose, one mutant was constructed in which six residues (W119, W122–D126) were changed to alanine (abbreviated by A6) and another mutant was constructed in which W119 was changed to alanine and W122–D126 were deleted (abbreviated by Δ5). Both the A6 and the Δ5 mutants were no longer able to attach haem to CcmE, even if ccmD was co-expressed (Fig. 2A, bottom, lanes 11 and 12). They showed the same phenotype as the previously described mutant H184A (Schulz et al., 1999) (Fig. 2A, bottom, lane 13), demonstrating the importance of the tryptophan-rich motif for CcmC activity.

CcmD influences the amount of both CcmC and CcmE in the membrane

To analyse the amount of CcmE polypeptide present in the mutants, an immunoblot with the same membrane fractions as in Fig. 2A was probed with anti-CcmE serum (Fig. 2B). The individual point mutations in CcmC did not seem to influence the abundance of CcmE polypeptide in the membrane (Fig. 2B). Thus, the different abilities of the ccmC mutants to form holo-CcmE, as observed in Fig. 2A, were not due to different levels of CcmE but rather to different activities of CcmC. However, there was a significant difference in the amount of CcmE detectable in membranes depending on the presence of CcmD (compare Fig. 2B top and bottom); when CcmD was present, more CcmE polypeptide accumulated in the membrane. Note that the cultivation of cells, the preparation of membranes, the determination of protein concentrations, the haem stain analysis and the Western blot transfer and immunodetection of all samples analysed in Fig. 2 were carried out at the same time.

To investigate the possibility that the observed phenotypes were due to a reduced level of CcmC mutant polypeptides, an immunoblot analysis with the same membrane fractions as in Fig. 2A and B was performed using polyclonal anti-CcmC serum (Fig. 2C). Although various strong cross-reacting bands were detected, the CcmC polypeptide could be identified unambiguously as a 23 kDa protein because of the absence of a band in membranes lacking CcmC (Fig. 2C, lane 1). Note, that non-specific cross-reacting bands can be used as internal controls for the amount of protein loaded. In the absence of CcmD (Fig. 2C, top), CcmC polypeptide was detected in membranes from the wild type (lane 2), from mutants W119A, G120A, T121A, W122A, W123A, ΔV124, H184A and – although at lower levels – from mutants W125I and D126A. By contrast, CcmC polypeptide was not detected in the mutants A6 and Δ5. However, in the presence of CcmD (Fig. 2C, bottom) the CcmC polypeptide was found in membrane fractions of all ccmC mutants. CcmC mutant polypeptides with multiple changes showed a slightly different mobility in the gel (Fig. 2C, bottom, lanes 11 and 12), which may be due to small changes in protein folding. Our results indicate that mutations A6 and Δ5 lead to reduced accumulation of CcmC polypeptide, probably because the mutant form is destabilized. We suggest that the presence of CcmD stabilises mutant forms of CcmC (see next section). However, partial or complete loss of haem attachment to CcmE in the presence of ccmD (Fig. 2A, bottom, lanes 8, 11–13) was not due to instability of these CcmC mutant polypeptides. Rather, the mutations ΔV124, A6, Δ5 and H184A strongly affected the enzymatic activity of CcmC.

The CcmC A6 mutant is functionally inactive but forms a stable polypeptide in the membrane

Our polyclonal antibodies against synthetic peptides of CcmC are not very sensitive (Fig. 2C). Therefore, it was not possible to determine whether low levels of the CcmC A6 polypeptide were present even in the absence of overproduced CcmD. A hexa-histidine tag was fused to the C-terminus of wild-type and the A6 mutant CcmC to enhance detection of these proteins by using a monoclonal anti-penta-histidine antibody. The hexa-histidine-tagged mutant CcmC was present in the membranes in the absence of CcmD, although it accumulated at slightly lower levels than the corresponding wild-type protein (Fig. 3A). Hence, the lack of a CcmC-specific band in Fig. 2C (top, lane 11) was due to the low sensitivity of the polyclonal anti-CcmC antibody and was not due to an instability of the mutant protein. This implies that the tryptophan-rich motif per se is critical for the activity of CcmC. The histidine tag did not interfere with the activity of the protein because the histidine-tagged wild-type CcmC protein was capable of attaching haem to CcmE (Fig. 3B) and supported cytochrome c maturation (Fig. 3C, see below).

Figure 3.

Analysis of the activity and the presence of His-tagged wild-type CcmC and His-tagged CcmCA6 in membrane protein fractions.

A. The Δccm mutant EC06 was co-transformed with plasmids expressing His-tagged wild-type CcmC or His-tagged CcmCA6 and with a plasmid expressing ccmE. Immunoblot of membrane protein fractions (50 µg) probed with anti-penta-His monoclonal antibodies.

B. Haem stain of the same membrane proteins (100 µg) as in A.

C. The ΔccmC mutant EC28 was transformed with plasmids expressing genes which encode either His-tagged wild-type CcmC or His-tagged CcmCA6. In addition, the strains contained the plasmid pRJ3291 expressing the B. japonicum cycA gene, which encodes cytochrome c550 (Cyt c550). Cells were grown anaerobically in the presence of nitrite, and TCA-precipitated periplasmic proteins (50 µg) were stained for covalently bound haem. ccmC wt, His-tagged wild-type CcmC; ccmCA6, His-tagged W119A/[W122-D126]A) CcmC.

Effect of point mutations in the tryptophan-rich motif of CcmC on the biogenesis of c-type cytochromes

The ability of the point mutants of CcmC to form holocytochrome c was tested. The periplasmic B. japonicum cytochrome c550 (Cyt c550) encoded by cycA can be expressed in E. coli from plasmid pRJ3291 upon addition of arabinose (Schulz et al., 1999). E. coli strain EC28, containing an in frame deletion mutation in ccmC (ΔccmC), was transformed with pRJ3291 and with plasmids expressing different ccmC alleles. The cells were grown anaerobically in the presence of nitrite as electron acceptor to ensure expression of the ccm operon and the structural genes napBC, which encode the c-type cytochromes of the periplasmic nitrate reductase (Potter and Cole, 1999). After induction of cycA expression, holocytochrome c formation was analysed by haem staining of periplasmic proteins. Wild-type ccmC and the ccmC mutant alleles W119A, G120A, T121A, W122A, W123A, W125I and D126A (Fig. 4, lanes 2–7, 9–10) were able to complement the ΔccmC mutant phenotype. Both the endogenous E. coli c-type cytochrome NapB and the heterologously expressed cytochrome c550 from B. japonicum were formed. Although the mutants G120A, T121A, W122A and W123A (Fig. 4, lanes 4–7) produced similar amounts of holocytochrome c to the wild type (Fig. 4, lane 2), the mutants W119A, W125I and D126A (lanes 3, 9–10) showed a slight reduction in cytochrome c formation. In contrast, cells expressing no ccmC (Fig. 4, lane 1) or the ccmC mutant alleles ΔV124, A6, Δ5 and H184A (Fig. 4, lanes 8, 11–13) were not able to synthesize holo-cytochrome c. These results further confirm that the tryptophan-rich motif is important for CcmC-mediated haem transfer during cytochrome c maturation.

Figure 4.

Ability of point mutants in the tryptophan-rich motif of CcmC to form holocytochrome c. The ΔccmC mutant EC28 was transformed with plasmids expressing genes encoding different CcmC point mutants. In addition, the strains contained the plasmid pRJ3291 expressing the B. japonicum cycA gene, which encodes cytochrome c550 (Cyt c550). E. coli cells were grown anaerobically in the presence of nitrite. A haem stain of TCA-precipitated periplasmic proteins (25 µg) separated by 15% SDS–PAGE is shown. Lanes: 1, vector pACYC184; 2, wt, pEC439 pccmC (wild type); 3, W, pEC450 pccmC (W119A); 4, G, pEC454 pccmC (G120A); 5, T, pEC455 pccmC (T121A); 6, W, pEC456 pccmC (W122A); 7, W, pEC471 pccmC (W123A); 8, V, pEC457 pccmC (ΔV124); 9, W, pEC451 pccmC (W125I); 10, D, pEC452 pccmC (D126A), 11, A6, pEC477 pccmC (W119A/[W122-D126]A); 12, Δ5, pEC478 pccmC (W119A/Δ[W122-D126]); 13, H, pEC470 pccmC (H184A).

CcmC ΔV124 requires overexpression of ccmD to complement a ΔccmC mutant

The CcmC ΔV124 mutant was able to attach haem to CcmE when ccmD was overexpressed from the constitutive promoter of a plasmid (Fig. 2A, lane 8, bottom). However, this activity was the lowest of all point mutants tested (Fig. 2A). Nevertheless, the ΔV124 ccmC allele did not allow cytochrome c maturation in the ΔccmC mutant EC28 (Fig. 4, lane 8). In this genetic background, ccmD was expressed only from its chromosomal copy. Thus, we tested whether overexpression of ccmD from a plasmid could support holocytochrome c formation in EC28 carrying a plasmid-borne ccmC V124Δ allele. E. coli cells were grown under anaerobic conditions with TMAO as terminal electron acceptor to induce the expression of the c-type cytochrome TorC, which is involved in the TMAO reductase pathway. Membrane proteins were isolated and analysed for covalently bound haem (Fig. 5A). The ΔccmC strain co-transformed with plasmids expressing ccmCΔV124 and ccmDE was capable of synthesizing both holo-CcmE and the c-type cytochrome TorC (Fig. 5A, lane 6). This activity was strictly dependent on expression of ccmD from a plasmid (Fig. 5A, compare lanes 5 and 6).

Figure 5.

Influence of ccmD expression on the activity of ccmC point mutants. The ΔccmC mutant EC28 was co-transformed with plasmids expressing genes encoding different CcmC point mutants and with a plasmid expressing either ccmE (–ccmD) or ccmDE (+ccmD). E. coli cells were grown anaerobically in the presence of TMAO.

A. Membrane proteins (100 µg) were separated by 15% SDS–PAGE and stained for covalently bound haem.

B. Immunoblot of identical membrane fractions (20 µg) as in A probed with anti-CcmE serum. vector, pACYC184; wt, ccmC (wild type); ΔV124, ccmC (ΔV124); D126A, ccmC (D126A).

For comparison, we also analysed the ccmC D126A mutant in more detail as it displays an intermediate phenotype. The CcmC D126A polypeptide was not able to catalyse holo-CcmE formation in the absence of overproduced CcmD (Fig. 2A, lane 10, top), but it could complement the ΔccmC mutant to form holo-cytochrome c (Fig. 4, lane 10). In the presence of a chromosomal copy of ccmD, the D126 mutant was capable of synthesizing holo-CcmE and TorC, whereas mutant ΔV124 required overexpression of ccmD for activity.

An immunoblot with the same membrane proteins as in Fig. 5A was probed with anti-CcmE serum (Fig. 5B). The amount of CcmE polypeptide detected in the membrane fractions increased when ccmD was overexpressed from a plasmid (even number lanes in Fig. 5B). In contrast to the experiments presented in Fig. 2B, in the experiment shown in Fig. 5A chromosomal copy of ccmD was always expressed. Thus, the level of CcmE polypeptide accumulating in the membrane fraction was not only dependent on the presence but also on the amount of CcmD in the membrane. However, further interpretations of the effects of overexpression of CcmD will only be possible when specific antibodies for CcmD are available.

The differing amounts of CcmE in the membrane fraction were also reflected by the intensities of the haem-staining bands of CcmE (Fig. 5A). When the ΔccmC mutant was complemented either with wild-type ccmC or with ccmC D126A, the amount of holo-CcmE was dependent on the level of ccmD expression (Fig. 5, compare lanes 3 and 4 and lanes 7 and 8). However, the amount of the holo-TorC produced was not limited by the level of ccmD expression and therefore by the amount of holo-CcmE present in the membrane (Fig. 5A, compare lanes 3 and 4 and lanes 7 and 8).

Discussion

One of the most striking common features of cytochrome c maturation proteins of Gram-negative as well as of Gram-positive bacteria, plant and protist mitochondria and chloroplasts is the presence of at least one membrane protein with several membrane-spanning segments that contains a well-conserved, tryptophan-rich motif exposed to the compartment where the mature c-type cytochromes reside. In E. coli, the three CcmC, CcmF and NrfE proteins of this type have been shown to be required for attachment of haem to CcmE, to the CXXCH haem-binding site of c-type cytochromes and to the unusual CWSCK haem-binding site of NrfA respectively (Thöny-Meyer, 1997; Eaves et al., 1998; Schulz et al., 1999). It has been proposed previously that the tryptophan-rich motif forms a hydrophobic platform for haem binding and that two conserved histidines in neighbouring periplasmic loops are axial ligands of the haem iron (Thöny-Meyer et al., 1994; Goldman et al., 1998; Xie and Merchant, 1998).

The role of CcmC in the cytochrome c biogenesis pathway was dissected in this work by analysing the ability of CcmC to attach haem covalently to CcmE. A minimal system consisting of CcmC and CcmE was used to study the effect of small changes within the tryptophan-rich motif of CcmC. Point mutations in the non-conserved residues T121 and W122 had no effect on the ability of CcmC to attach haem to CcmE. In contrast, mutants in the strictly conserved CcmC residues (W119A, G120A, W123A, ΔV124, W125I and D126A) were no longer able to attach haem to CcmE, demonstrating that these residues were critical for the activity of CcmC. These findings support the idea of a hydrophobic surface in CcmC on the periplasmic side of the membrane that may be used for binding of haem and presenting it to CcmE.

Earlier attempts to identify essential residues in the CcmC homologues of R. capsulatus and P. fluorescens have not led to a clear picture of how much the tryptophan-rich motif is involved in haem trafficking during cytochrome c maturation. For example, the R. capsulatus HelC derivatives W117L, G118A and D124E (see Fig. 1) were functional in anaerobic photosynthetic growth that requires mature c-type cytochromes (Goldman et al., 1998), whereas the P. fluorescens mutants W126I and D127A were fully or partially defective in cytochrome c maturation (Gaballa et al., 1998). To compare our findings with those mentioned above, we also tested our point mutants for cytochrome c maturation. Interestingly, we found that in the presence of other ccm genes, the ccmC mutants had a less drastic phenotype, not only with respect to cytochrome c maturation but also regarding haem attachment to CcmE. Unfortunately, the effect of mutated CcmC polypeptide on cytochrome c formation cannot be tested in the absence of other ccm genes because all ccm gene products are essential for cytochrome c formation. However both haem attachment and cytochrome c formation were abolished when multiple changes or deletions of residues within the tryptophan-rich motif were introduced.

We have observed previously that the small membrane protein CcmD can affect the abundance of CcmE in the membrane (Schulz et al., 1999). We suspected that the presence or absence of CcmD may also influence the effect of single base mutations in ccmC. In fact, the defective phenotype of these mutants could be partially complemented by expression of ccmD from a plasmid. This finding strongly suggests that CcmC and CcmD interact with each other in the membrane. Moreover, it explains the wild-type phenotype of the R. capsulatus HelC point mutants because in the R. capsulatus experiments the CcmD homologue HelD was always present.

We have tried to fit our findings into a model that predicts the interaction of the transmembrane segments and periplasmic domains of CcmC, CcmD and CcmE. CcmC is believed to assemble in the membrane such that the tryptophan-rich motif between helices III and IV resides on the surface of the periplasmic side of the membrane and interacts with one of the hydrophobic faces of haem. The two histidines of CcmC in the periplasmic loops I and II and V and VI would help to position haem correctly by liganding the central haem iron. At least one of the vinyl groups is exposed to the surface, where it might bind to H130 in the periplasmic domain of CcmE. CcmD is embedded in the membrane making contact with both CcmC and CcmE because its presence reinforces the function of the tryptophan-rich motif and enhances the levels of CcmE polypeptide in the membrane. Our model, although still highly speculative, is in agreement with the current knowledge on the haem delivery pathway of cytochrome c biogenesis in Gram-negative bacteria and serves as a basis to understand better the mechanisms of haem transfer between proteins.

Experimental procedures

Growth conditions

E. coli cells were grown at 30°C in Luria–Bertani medium (Sambrook et al., 1989) either aerobically or anaerobically with 10 mM TMAO as electron acceptor. For analysis of periplasmic c-type cytochromes, cells were grown anaerobically at 30°C in minimal salts medium (Iobbi-Nivol et al., 1994) supplemented with 0.4% glycerol, 40 mM fumarate and 5 mM nitrite as electron acceptors. Antibiotics were added at the following final concentrations: ampicillin, 100 µg ml−1; chloramphenicol, 10 µg ml−1; kanamycin, 50 µg ml−1. For the expression of cycA, which encodes B. japonicum cytochrome c550, cells were grown to mid-exponential phase and then induced with 0.1% arabinose.

Construction of plasmids and site-directed mutagenesis

E. coli strain DH5α was used as host for cloning (Hanahan, 1983). Plasmid pEC99 (Table 1) contains a 1190 bp ccmCD AflII–SspI fragment cloned into the EcoRV site of the tetracycline resistance gene of pACYC184 (Chang and Cohen, 1978) in the same orientation as the resistance gene. For the construction of pEC439, which only contains ccmC, the 470 bp BglI–BamHI fragment of pEC422 was ligated to the 2.9 kb BglI–BclI fragment of pEC99. In pEC86, the whole ccmABCDEFGH gene cluster is expressed from the tet promoter of pACYC184 (Arslan et al., 1998). To construct plasmids expressing ccmE (pEC458) and ccmDE (pEC459) from the tet promoter of pBR322, a 998 bp FspI–BamHI fragment or a 1.65 kb MscI–BamHI fragment of pEC86, respectively, were cloned into a 4.17 kb EcoRV–BamHI fragment of pBR322.

Table Table1. Strains and plasmids used in this work
StrainsRelevant genotype/resistanceReference
DH5α supE44 ΔlacU169 (Φ80lacZΔM15) hsdR17 recA1 endA1 gyrA96 thi-1 relA1 Hanahan (1983)
MC1061 hsdR mcrB araD139 Δ(araABC-leu)7679ΔlacX74 galU galK rpsL thi Meissner et al. (1987)
EC06ΔccmA-H derivative of MC1061; KmR Thöny-Meyer et al. (1995)
EC28ΔccmC derivative of MC1061 Throne-Holst et al. (1997)
Plasmids
pEC86 ccmABCDEFGH cloned into pACYC184; CmR Arslan et al. (1998)
pEC99 ccmCD cloned into pACYC184; CmRThis work
pEC422H6ccmC cloned into pISC-3, ApR Schulz et al. (1999)
pEC436H6ccmCH184A cloned into pISC-3, ApR Schulz et al. (1999)
pEC439 ccmC cloned into pACYC184; CmRThis work
pEC449 ccmC W123A cloned into pUCBM20, ApRThis work
pEC450 ccmC W119A cloned into pACYC184; CmRThis work
pEC451 ccmC W125I cloned into pACYC184; CmRThis work
pEC452 ccmC D126A cloned into pACYC184; CmRThis work
pEC453H6ccmCW123A cloned into pISC-3, ApRThis work
pEC454 ccmC G120A cloned into pACYC184; CmRThis work
pEC455 ccmC T121A cloned into pACYC184; CmRThis work
pEC456 ccmC W122A cloned into pACYC184; CmRThis work
pEC457 ccmC ΔV124 cloned into pACYC184; CmRThis work
pEC458 ccmE cloned into pBR322; ApRThis work
pEC459 ccmDE cloned into pBR322; ApRThis work
pEC465 ccmC′ H184A cloned into pACYC184; CmRThis work
pEC466 ccmC′ W123A cloned into pACYC184; CmRThis work
pEC470 ccmC H184A cloned into pACYC184; CmRThis work
pEC471 ccmC W123A cloned into pACYC184; CmRThis work
pEC477 ccmC W119A,W122–D126A cloned into pACYC184; CmRThis work
pEC478 ccmC W119A, ΔW122–D126 cloned into pACYC184; CmRThis work
pEC483H6ccmC′ cloned into pACYC184; CmRThis work
pEC484H6ccmC′W119A,W122–D126A cloned into pACYC184; CmRThis work
pEC486H6ccm cloned into pACYC184; CmRThis work
pEC487H6ccmCW119A,W122–D126A cloned into pACYC184; CmRThis work
pRJ3291 B. japonicum cycA cloned into pISC-2; KmR Schulz et al. (1999)

Point mutations W119A, G120A, T121A, W122A, ΔV124, W125I and D126A of CcmC were constructed following the ‘Quick change’ protocol (Stratagene Europe), leading to plasmids pEC450, pEC454, pEC455, pEC456, pEC457, pEC451 and pEC452 respectively. The high-performance liquid chromatography (HPLC)-purified forward and reversed primers (Microsynth) listed in Table 2 were used. Plasmid pEC439 was used as the template.

Table 2. Nucleotide sequences of primers used for the construction of point mutations in ccmC and for DNA sequencing.
PrimerNucleotide sequence (5′−3′)
ccmCW119A/KpnIfGCATGGGGAAAACCGATGGCGGGTACCTGGTGGGTATGGG
ccmCW119A/KpnIrCCCATACCCACCAGGTACCCGCCATCGGTTTTCCCCATGC
ccmCG120AfGGGAAAACCGATGTGGGCCACCTGGTGGGTATGGGATGC
ccmCG120ArGCATCCCATACCCACCAGGTGGCCCACATCGGTTTTCCC
ccmCT121A/EheIfGGGAAAACCGATGTGGGGCGCCTGGTGGGTATGGGATGC
ccmCT121A/EheIrGCATCCCATACCCACCAGGCGCCCCACATCGGTTTTCCC
ccmCW122A/KpnIfGGGAAAACCGATGTGGGGTACCGCGTGGGTATGGGATGC
ccmCW122A/KpnIrGCATCCCATACCCACGCGGTACCCCACATCGGTTTTCCC
ccmCV124Δ/KpnIfGGAAAACCGATGTGGGGTACCTGGTGGTGGGATGCACGTCTG
ccmCV124Δ/KpnIrCAGACGTGCATCCCACCACCAGGTACCCCACATCGGTTTTCC
ccmCW125I/ClaIfGGCACCTGGTGGGTAATCGATGCACGTCTGACTTCTGAACTGG
ccmCW125I/ClaIrCCAGTTCAGAAGTCAGACGTGCATCGATTACCCACCAGGTGCC
ccmCD126A/KpnIfCCGATGTGGGGTACCTGGTGGGTATGGGCTGCACGTCTGACTTC
ccmCD126A/KpnIrGAAGTCAGACGTGCAGCCCATACCCACCAGGTACCCCACATCGG
ccmCW123AGCACCTGGGCGGTATGGGATGC
ccmCAla5CTCGGTACCGCGGCGGCGGCGGCTGCACGTCTGACTTCTGAACTG
ccmC-WmotifCTCGGTACCGCACGTCTGACTTCTGAACTGG
ccmC15854–872GGCTGGTTTATACCGTGGC
ccmCNCGGGATCCATATGTGGAAAACACTGC
ccmCCCGGAATTCTCATTTACGGCCTCTTTTCAG
ccmCH6BclICCTGATCAGTGGTGGTGGTGGTGGTGTTTACGGCCTCTTTTCAG
pACYC3961–3941CCCCCGTTTTCACCATGGGC

The point mutation W123A was constructed using PCR-mediated mutagenesis. Vent polymerase (New England Biolabs) was used for all PCR reactions. A 400 bp fragment was amplified using primers ccmCW123A and ccmCC, and plasmid pEC86 served as template. The amplified fragment was then used as a primer together with primer ccmCN for a second PCR of ccmC, using plasmid pEC86 as the template. This resulted in a 745 bp DNA fragment. The product was cleaved with BamHI and EcoRI and ligated into a 2.7 kb BamHI–EcoRI-digested pUCBM20 (Roche Diagnostics) fragment, resulting in plasmid pEC449. For the construction of pEC453, the 520 bp NsiI–EcoRI wild-type ccmC fragment of pEC422 was replaced with the 520 bp NsiI–EcoRI W123A mutant ccmC fragment of pEC449. To express the W123A and the H184A mutations from the tet promoter of pACYC184, plasmids pEC453 and pEC436 were digested with NsiI and SspI. The 715 bp ccmC fragments were ligated into a 3.55 kb NsiI–NruI-digested fragment of pEC99, resulting in plasmids pEC466 and pEC465 respectively. After digestion with BglI, the 850 bp fragments of pEC466 and pEC465 were ligated into a 3.78 kb BglI fragment of pEC99, resulting in plasmids pEC471 and pEC470 respectively.

The plasmids pEC477 expressing ccmC W119A/[W122–D126]A and pEC478 expressing ccmC W119A/[ΔW122–D126] were constructed by PCR mutagenesis. Primers ccmCAla5 and ccmCWmotif were used together with primer pACYC3961–3941; pEC439 served as template. The amplified fragments were cleaved with NcoI and KpnI to give 780 bp DNA fragments, which were ligated into a 2.6 kb NcoI–KpnI fragment of pEC450, resulting in plasmids pEC477 and pEC478 respectively.

For the construction of a histidine tag at the C-terminus of CcmC, primers ccmCH6BclI and ccmC15854–872 were used. Plasmids pEC439 (ccmC wild type) and pEC477 (ccmC W119A/[W122–D126]A) were used as templates for the PCR reaction. The amplified fragments were digested with BclI and NsiI. The resulting 540 bp fragments were ligated into the 2.84 kb BclI–NsiI fragment of pEC471 to give plasmids pEC483 (ccmC′ wild type) and pEC484 (ccmC′ W119A/[W122–D126]A). The 870 bp BglI–NcoI fragments of these plasmids were ligated into a 2.5 kb BglI–NcoI fragment of pEC439. The final plasmids pEC486 and pEC487 expressed C-terminally histidine-tagged versions of wild-type CcmC and W119A/[W122–D126A] CcmC.

All mutations and PCR products were confirmed by DNA sequencing using an ABI Prism 310 Genetic Analyzer (Perkin Elmer).

Fractionation of E. coli cells

Periplasmic fractions of 500 ml anaerobically grown cultures were isolated by treatment with polymyxin B sulphate (Fluka). The cells were harvested by centrifugation at 4000 g, washed in cold 50 mM tris-HCl, pH 8.0, and resuspended (2 ml g−1 wet cells) in cold extraction buffer (1 mg ml−1 polymyxin B sulphate, 20 mM tris-HCl, 500 mM NaCl, 10 mM EDTA, pH 8.0). The suspension was stirred for 60 min at 4°C and centrifuged at 40 000 g for 20 min at 4°C. The supernatant contained the periplasmic fraction.

Membrane fractions of 250 ml aerobically or 500 ml anaerobically grown cultures were prepared as follows. The cells were harvested by centrifugation at 4000 g, washed in cold 50 mM tris-HCl, pH 8.0, resuspended in 3 ml cold 50 mM tris-HCl, pH 8.0 containing 10 µg ml−1 desoxyribonuclease I and passed twice through a French pressure cell at 110 MPa. Cell debris was separated by centrifugation at 40 000 g for 20 min at 4°C. The supernatant was subjected to ultracentrifugation at 140 000 g for 60 min at 4°C. The membrane fraction was washed once with 1 ml cold 50 mM tris-HCl, pH 8.0, buffer and resuspended in 200 µl of the same buffer.

Biochemical methods

Protein concentrations of periplasmic and membrane proteins were determined using the Bradford assay (Bio-Rad).

Haem staining of proteins separated by SDS–PAGE was carried out using o-dianisidine (Sigma) as substrate. The gel was incubated for 10 min in 10% TCA. After extensive washing with water, the gel was stained using 20 mg of o-dianisidine dissolved in 20 ml of 50 mM trisodium citrate, pH 4.4, 0.7% hydrogen peroxide.

Immunoblot analysis was performed using antiserum directed against three synthetic peptides of CcmC (CcmC1, KTLHQLAIPPRLYQIC; CcmC2, CNTLHQGSTRMQQSID; CcmC3, CEKRRPWVSELILKRGRK) (purchased from Tana Laboratories). The antiserum was preadsorbed with acetone powder prepared from E. coli (EC28) ΔccmC. Antibodies against CcmE have been described previously (Schulz et al., 1998). Signals were detected using goat anti-rabbit IgG alkaline phosphatase conjugate (Bio-Rad) as secondary antibody and 3-{4-methoxyspiro[1,2-dioxetan-3,2′-(5′chloro) tricyclo(3.3.1.13,7)decan]-4-yl} phenyl-phosphate (CSPD) (Roche Diagnostics) as substrate. Immunoblot analysis against the histidine-tagged versions of CcmC was performed using monoclonal penta-His antibodies (Qiagen). Signals were detected using goat anti-mouse IgG alkaline phosphatase conjugate (Bio-Rad) as secondary antibody and CSPD as substrate.

Acknowledgements

We thank E. Furter-Graves for critical comments on the manuscript. This work was supported by grants from the Swiss National Foundation for Scientific Research and from the ETH.

Ancillary