SEARCH

SEARCH BY CITATION

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

The interaction between the plant pathogen Xanthomonas campestris pv. vesicatoria and its host plants is controlled by hrp genes (hypersensitive reaction and pathogenicity), which encode a type III protein secretion system. Among type III-secreted proteins are avirulence proteins, effectors involved in the induction of plant defence reactions. Using non-polar mutants, we investigated the role of 12 hrp genes in the secretion of the avirulence protein AvrBs3 from X. c. pv. vesicatoria and a heterologous protein, YopE, from Yersinia pseudotuberculosis. Genes conserved among type III secretion systems (hrcQ, hrcR, hrcS and hrcT) as well as non-conserved genes (hrpB1, hrpB2, hrpB4, hrpB5, hrpD5 and hrpD6) were shown to be required for secretion. Protein localization studies using specific antibodies showed that HrpB1 and HrpB4, as well as the putative ATPase HrcN, were mainly found in the soluble fraction of the bacterial cell. In contrast, HrpB2 and HrpF, which is related to NolX of Rhizobium fredii, are secreted into the culture medium in an hrp-dependent manner. As HrpB2, but not HrpF, is essential for type III protein secretion, there might be a hierarchy in the secretion process. We propose that HrpF, which is dispensable for protein secretion but required for AvrBs3 recognition in planta, functions as a translocator of effector proteins into the host cell.


Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

In many Gram-negative plant pathogenic bacteria, the interaction with the plant is determined by two types of genes, basic pathogenicity (hrp) and host-specificity (avr) genes. hrp (hypersensitive reaction and pathogenicity) genes are required for the bacteria to cause disease in susceptible host plants and to induce the hypersensitive reaction (HR), a rapid localized plant cell death reaction, in resistant plants. hrp genes have been described for Erwinia spp., Ralstonia solanacearum and pathovars (pvs) of Pseudomonas syringae and Xanthomonas campestris and are generally clustered in large chromosomal regions encoding 20–25 proteins whose main function is in type III protein secretion (Alfano and Collmer, 1997). Secretion by type III systems, which have been identified in many bacterial pathogens of plants and animals, is sec independent and occurs without cleavage of an N-terminal signal sequence. Nine proteins involved in type III secretion have been shown to be conserved between different bacterial species, suggesting that they probably constitute the core secretion machinery (for a comprehensive review of type III systems, see Hueck, 1998). In plant pathogenic bacteria, these conserved genes were renamed hrc (for hrpconserved), followed by the letter of the homologous ysc gene of Yersinia (Bogdanove et al., 1996a). Hrp type III-secreted proteins include essential pathogenicity factors, e.g. the subunit of the P. s. pv. tomato and R. solanacearum Hrp pilus (Roine et al., 1997; Van Gijsegem et al., 2000) and DspA (also called DspE) of Erwinia amylovora (Gaudriault et al., 1997; Bogdanove et al., 1998), non-specific elicitors of the HR (He et al., 1993; Arlat et al., 1994; Bogdanove et al., 1996b; Charkowski et al., 1998; Kim and Beer, 1998) and avirulence proteins (van Dijk et al., 1999; Mudgett and Staskawicz, 1999; Rossier et al., 1999). Avirulence (avr) genes are found in spp. of P. syringae and Xanthomonas and govern recognition, i.e. HR induction, of bacteria by certain host plants carrying a corresponding resistance (R) gene (Leach and White, 1996). In the absence of the bacterial avr or the plant R gene, no recognition occurs and the infection leads to disease.

Our laboratory studies X. c. pv. vesicatoria, the causal agent of bacterial spot disease on pepper and tomato. The 23 kb hrp gene cluster contains six operons, designated hrpA to hrpF (Bonas et al., 1991). Two regulatory genes, hrpG and hrpX, located outside the large gene cluster, activate expression of hrp genes in both the plant and synthetic inducing medium XVM2 (Wengelnik and Bonas, 1996; Wengelnik et al., 1996a). Based on DNA sequence analysis, the hrp gene cluster encodes nine Hrc proteins and 12 proteins with low or no homology to components of type III secretion systems (Fenselau and Bonas, 1995; Wengelnik et al., 1996b; Huguet and Bonas, 1997; Huguet et al., 1998; U. Bonas, unpublished). We demonstrated recently that X. c. pv. vesicatoria secretes the avirulence protein AvrBs3 as well as heterologous proteins, such as PopA from R. solanacearum and the Y. pseudotuberculosis YopE, into the culture medium in an Hrp type III-dependent manner (Rossier et al., 1999). AvrBs3 is a member of a large protein family in Xanthomonas and contains functional nuclear localization signals (NLS) that are required for AvrBs3 function, i.e. HR induction on Bs3 pepper plants (Van den Ackerveken et al., 1996). This, together with the finding that transient expression of avrBs3 in the plant induces a genotype-specific HR (Van den Ackerveken et al., 1996), suggests that AvrBs3 is translocated into the plant cell via the Hrp secretion system.

As mentioned above, the hrp gene cluster in X. c. pv. vesicatoria contains conserved and non-conserved genes. Elucidation of the contribution of individual hrp genes to pathogenicity and HR induction is at an early stage. Analysis of non-polar mutations in each of the six genes in the X. c. pv. vesicatoria hrpD operon led to the discovery of an hrp-associated gene, hpaA, which is required for disease symptom formation in susceptible plants (Huguet et al., 1998). As the mutant is still able to induce the HR in resistant plants, the HpaA protein is probably not part of the type III secretion apparatus (Huguet et al., 1998). Here, we describe the effect of non-polar mutations in genes of the hrpB, hrpD and hrpF loci on protein secretion and on interaction with the plant. Our data indicate the existence of a hierarchy in protein secretion.

Results

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

Non-polar mutagenesis of four genes in the hrpB operon

The hrpB operon encodes eight proteins, three of which are conserved in type III secretion systems (Fenselau and Bonas, 1995; Bogdanove et al., 1996a) (Fig. 1). HrcJ (HrpB3) is a putative lipoprotein, HrcN (HrpB6) a predicted ATPase and HrcT (HrpB8) an inner membrane protein. HrpB5 shows weak homology to YscL from Yersinia spp. (Michiels et al., 1991) and has an overall hydrophilic sequence (Fenselau and Bonas, 1995). The role of individual genes in the hrpB operon from X. c. pv. vesicatoria has not been studied, as all transposon insertions available are likely to have polar effects (Fenselau and Bonas, 1995). To unravel the function of those genes that are not well conserved among plant and animal pathogens, we introduced non-polar deletions into hrpB1, hrpB2, hrpB4 and hrpB5. The corresponding proteins have counterparts only in R. solanacearum (Fenselau and Bonas, 1995). Using a suicide plasmid, mutations were introduced into the genome of strain 85-10, which expresses the avirulence gene avrBs1 (Minsavage et al., 1990). Each deletion mutant, designated 85-10ΔhrpB1, 85-10ΔhrpB2, 85-10ΔhrpB4 and 85-10ΔhrpB5, had a clear hrp phenotype: mutants were no longer able to cause disease in the susceptible pepper plant ECW or to induce the HR in the resistant pepper plant ECW-10R, which contains the corresponding resistance gene Bs1 (data not shown). When avrBs3, introduced on plasmid pDS300F (Van den Ackerveken et al., 1996), was expressed in these mutants, they failed to induce the HR in the resistant pepper line ECW-30R, which carries Bs3, as expected (data not shown). Thus, hrpB1, hrpB2, hrpB4 and hrpB5 are true hrp genes. The hrpB1 mutant was complemented with plasmid pXV9::35 (Bonas et al., 1991), which contains the operons hrpA to hrpE and carries a Tn3gus insertion in hrpB2. Mutants in hrpB2, hrpB4 and hrpB5 were complemented using plasmid pXV9::2 (Bonas et al., 1991), which contains a polar Tn3gus insertion in hrpB7.

image

Figure 1. Genetic organization of the 23 kb hrp gene cluster of X. c. pv. vesicatoria. The arrows indicate the orientation of the six hrp operons, hrpA to hrpF. The open boxes correspond to open reading frames (ORFs). The hrpE locus consists of three ORFs that are not characterized in this study. hrc genes encode proteins conserved among type III secretion systems; hrp genes and hpaA encode non-conserved proteins.

Download figure to PowerPoint

Localization studies of HrpB proteins

Protein studies were performed using polyclonal antibodies raised against HrpB1, HrpB2, HrpB4, HrcJ and HrcN (see Experimental procedures). When X. c. pv. vesicatoria was grown in hrp-inducing XVM2 medium, none of these proteins was detectable in immunoblotting analyses. The problem of low expression levels was solved using X. c. pv. vesicatoria strains 85* and 82*, which express hrpG*, a constitutively active form of the key regulator HrpG, in the chromosome (Wengelnik et al., 1999). This allowed immunodetection of HrpB1, HrpB2, HrpB4, HrcJ and HrcN in total protein extracts (Fig. 2, lane 1). To test the specificity of the antisera, non-polar mutants in the corresponding genes were constructed in strain 85*. As shown in Fig. 2A, the HrpB1 antiserum reacted with an 18 kDa protein in total extracts of mutants in hrpB2 and hrpB4, but not in the hrpB1 deletion mutant. Specificity of the antisera directed against the other HrpB proteins was demonstrated in a similar way (Fig. 2A). The fact that HrpB4 was detected in the hrpB1 and hrpB2 deletion mutants confirmed that the mutations are non-polar. The antiserum directed against HrcN detected a 48 kDa protein that was present in total protein extracts from strain 85-10(pDG72-1), but absent from 85-10::B35 (pDG72-1) (Fig. 2B). The latter strain contains a polar transposon insertion in hrpB2 and was used because non-polar mutants in hrcJ and hrcN were not available (Fenselau and Bonas, 1995; Wengelnik and Bonas, 1996); both strains express hrpG* from plasmid pDG72-1 (Wengelnik et al., 1999).

image

Figure 2. Detection and localization of proteins encoded in the hrpB operon of X. c. pv. vesicatoria.

A. Total protein extract of strain 82* (lane 1) grown in secretion medium was separated into total soluble (lane 2) and total insoluble (membrane) proteins (lane 3). Lanes 4–6 refer to total extracts of mutants 85*ΔhrpB1, 85*ΔhrpB2 and 85*ΔhrpB4 respectively. Equal amounts of proteins were separated by SDS–PAGE and transferred to nitrocellulose. The blot was incubated with polyclonal antisera specific for HrpB1, HrpB2 and HrpB4. The molecular mass (kDa) of the proteins is indicated on the right. For further details, see Experimental procedures.

B. Total protein extract of 82* (lane 1) was fractionated into total soluble (lane 2) and total membrane proteins (lane 3). Lanes 4 and 5 refer to total protein extracts of 85-10(pDG72-1) (wild type) and 85::B35(pDG72-1) (Tn3gus insertion in hrpB2). Equal amounts of proteins were analysed by immunoblotting. Blots were reacted with polyclonal antibodies directed against HrcJ (top) and HrcN (bottom).

C. HrpB2 is secreted in an hrp-dependent manner. Bacteria were incubated for 4 h in secretion medium. Total protein extracts (T, lanes 1 and 2) and filtered supernatants (SN, lanes 3 and 4) were precipitated with TCA and concentrated 50 times and 200 times respectively. Protein samples (5 µl) of strain 82* (lanes 1 and 3) and strain 82*ΔhrcV (lanes 2 and 4) were analysed by immunoblotting and using HrpB2-specific antibody.

Download figure to PowerPoint

To determine the subcellular localization of the proteins under study, total protein extracts of an hrpG*-expressing strain were separated into soluble and insoluble (membrane) proteins. HrpB1, HrpB4 and HrcN were mainly detected in the soluble fractions (95%, 60% and 70% respectively) (Fig. 2, lane 2). HrpB2 and HrcJ were present in both soluble and membrane fractions (Fig. 2). Membrane protein fractionation on sucrose gradients showed that HrcJ was localized in both the inner and the outer membrane (data not shown).

To determine whether any of the HrpB proteins are secreted, bacteria were incubated in secretion medium (Rossier et al., 1999). Indeed, HrpB2 was secreted (Fig. 2C), whereas HrpB1, HrpB4, HrcJ and HrcN were not detectable in the supernatant of strain 82* (data not shown). Secretion of HrpB2 was abolished in a mutant carrying a deletion in hrcV, which encodes a protein conserved in type III secretion systems (Fig. 2C). Thus, HrpB2 is secreted in an hrp-dependent manner; however, secreted amounts varied in independent experiments.

Role of hrpB genes in secretion of AvrBs3 and YopE

We have shown recently that X. c. pv. vesicatoria secretes the avirulence protein AvrBs3 in an hrp-dependent manner (Rossier et al., 1999). To determine the role of individual hrpB genes in secretion, avrBs3 (on plasmid pDS300F; Van den Ackerveken et al., 1996) was introduced into strain 85* and the hrpB mutants described above. AvrBs3 as well as HrpB2 was secreted by the wild-type strain 85*(pDS300F), but not by any of the hrpB1, hrpB2, hrpB4 and hrpB5 mutants (Fig. 3A). Secretion of AvrBs3 and HrpB2 from 85*(pDS300F) was not caused by lysis because HrcN, used as a cytoplasmic marker, was not detectable in the supernatant (Fig. 3A). Identical results were obtained with strain 82* and its hrpB mutant derivatives (data not shown). To establish whether hrcT, the last gene in the hrpB operon (Fig. 1), is important for secretion, two transposon-derived mutations in hrcT (Tn5 insertion numbers 14 and 77; Fenselau and Bonas, 1995) were introduced into the chromosome of 85* by marker exchange mutagenesis, giving 85*::B5014 and 85*::B5077. Mutants showed a typical hrp phenotype, as expected (see Table 1), and were unable to secrete AvrBs3 (provided on pDS300F) and HrpB2 (Fig. 3A, lanes 13 and 14). Thus, hrpB1, hrpB2, hrpB4, hrpB5 and hrcT are essential for AvrBs3 secretion.

image

Figure 3. hrpB mutants are defective for secretion of AvrBs3, HrpB2 and YopE.

A. Detection of AvrBs3 (122 kDa), HrpB2 (14 kDa) and HrcN (48 kDa). 85*-derived mutants expressed avrBs3 from pDS300F. Proteins were analysed by SDS–PAGE, transferred to nitrocellulose and incubated with specific antisera. Total protein (lanes 1–7) and supernatants (lanes 8–14) of the following strains were analysed: 85* (wild type; lanes 1 and 8); 85*ΔhrpB1 (lanes 2 and 9); 85*ΔhrpB2 (lanes 3 and 10); 85*ΔhrpB4 (lanes 4 and 11); 85*ΔhrpB5 (lanes 5 and 12); 85*::B5014 (hrcT mutant; lanes 6 and 13); 85*::B5077 (hrcT mutant; lanes 7 and 14).

B. Detection of YopE (23 kDa) and YerA (14 kDa) from Y. pseudotuberculosis. 85*-derived mutants expressed yopE and yerA from pLKW1. Loading was as for (A). HrcN and YerA were used as controls for the detection of cytoplasmic proteins.

Download figure to PowerPoint

Table 1. Phenotype of the different mutants generated in this study.
Xanthomonas mutantsa In planta b In vitro secretionc
AvrBs3HrpB2HrpFHrcNPopAYopEYerA 
  • a

    . Mutants generated in strains 85

  • * 

    and/or 82

  • * 

    * (see text).

  • b

    .+, disease in susceptible plants, HR induction in resistant plants; –, no disease symptoms, no HR induction; ±, intermediate phenotype: few disease symptoms, partial HR.

  • c

    . Presence (+) or absence (–) of the protein in the culture supernatant.

  • d

    . Wild-type strains 85

  • * 

    * and 82

  • *

    .

  • e

    . ND, not determined.

Wtd++++++ 
hrpB1 NDeND 
hrpB2 ND 
hrpB4 NDND 
hrpB5 NDND 
hrcT NDND 
hrcV  
hrcQ NDNDND 
hrcR NDNDND 
hrcS NDNDND 
hpaA ±+NDND+ 
hrpD5 NDNDND 
hrpD6 NDNDND 
hrpF ++ND+ 

To test whether the lack of detectable secretion by hrpB mutants was specific for AvrBs3 and HrpB2 or whether other proteins were also affected, we examined the fate of the heterologous protein YopE. YopE is a type III-secreted cytotoxin from Y. pseudotuberculosis that was recently shown to be secreted by X. c. pv. vesicatoria in an hrp-dependent manner (Rossier et al., 1999). Plasmid pLKW1, expressing both yopE and its chaperone yerA under the control of the lac promoter (Rossier et al., 1999), was introduced into 85* and the isogenic mutant strains described above. All strains expressed YopE and YerA (Fig. 3B, lanes 1–7), but only the wild type secreted detectable amounts of YopE (Fig. 3B, lane 8). No cell lysis was observed, as indicated by the absence of the cytoplasmic protein YerA in the supernatant (Fig. 3B). Thus, the hrpB genes analysed are also required for YopE secretion in X. c. pv. vesicatoria.

Genes in the hrpD operon function in protein secretion

Recently, non-polar mutagenesis of the six genes in the hrpD operon (Fig. 1) revealed that, with the exception of hpaA, they were essential for the interaction with the plant (Huguet et al., 1998). The first three genes, hrcQ, hrcR and hrcS, encode conserved type III components, whereas little is known about the function of hpaA, hrpD5 and hrpD6. To study the role of individual hrpD genes in secretion, non-polar mutations (Huguet et al., 1998) were introduced into strain 82*, resulting in strains 82*ΔhrcQ, 82*ΔhrcR, 82*ΔhrcS, 82*ΔhpaA, 82*ΔhrpD5 and 82*ΔhrpD6. Strain 82* was chosen because it carries an endogenous copy of avrBs3. To analyse YopE secretion, plasmid pLKW1 (yopE, yerA) was introduced into 82* and 82*-derived mutants in hrpD. Although AvrBs3 and YopE were well expressed in all strains, they were detectable only in the supernatant of the wild type and the hpaA mutant (Fig. 4A). However, AvrBs3 and YopE secretion by this mutant was reduced two- to fivefold compared with the wild type (Fig. 4; note that the supernatants of the wild-type and mutant strains were concentrated 75-fold and 150-fold respectively). Analyses using antisera specific for YerA and HrcN showed that these normally cytoplasmic proteins were not detectable in the supernatants (Fig. 4A; data not shown). Hence, all genes in the hrpD operon, except for hpaA, are essential for secretion of AvrBs3 and YopE in X. c. pv. vesicatoria. Surprisingly, when we tested for secretion of PopA from R. solanacearum (provided on pLAZ13), a protein secreted by the X. c. pv. vesicatoria Hrp system with an efficiency similar to AvrBs3 secretion (Rossier et al., 1999), PopA was not detectable in the supernatant of hpaA mutants (Fig. 4B).

image

Figure 4. The hpaA mutant secretes AvrBs3 and YopE, but not PopA.

A. Immunoblotting analyses of total protein (lanes 1–7) and supernatants (lanes 8–14) of 82*-derived mutants in hrpD genes using antibodies specific for AvrBs3, YopE and YerA. The following strains, all expressing yopE and yerA from pLKW1, were used: 82* (wild type; lanes 1 and 8); 82*ΔhrcQ (lanes 2 and 9); 82*ΔhrcR (lanes 3 and 10); 82*ΔhrcS (lanes 4 and 11); 82*ΔhpaA (lanes 5 and 12); 82*ΔhrpD5 (lanes 6 and 13); 82*ΔhrpD6 (lanes 7 and 14). The supernatants were concentrated 150-fold except for the wild type (75-fold).

B. A mutant in hpaA does not secrete PopA. Total protein (lanes 1–3) and supernatants (lanes 4–6) of 82*(pLAZ13) (lanes 1 and 3), 82*ΔhrcV(pLAZ13) (lanes 2 and 5) and 82*ΔhpaA(pLAZ13) (lanes 3 and 6) were analysed by immunoblotting analysis using PopA-specific antibody.

Download figure to PowerPoint

HrpF is not required for secretion of AvrBs3 and YopE

hrpF is located at the right border of the hrp gene cluster (Fig. 1) and encodes an 87 kDa protein that shows 67% similarity to the Rhizobium fredii NolX protein (Huguet and Bonas, 1997). To determine the role of HrpF in protein secretion, two Tn3gus insertions, numbers 314 and 440, which are located in the 5′ region of hrpF and inactivate the gene (Huguet and Bonas, 1997), were introduced into strain 85* by marker exchange. The resulting strains, 85*::F314 and 85*::F440, display a typical hrp phenotype in planta, as expected (Table 1). Interestingly, both hrpF mutants secreted the HrpB2 and AvrBs3 (expressed from pDS300F) proteins into the culture medium (Fig. 5A). Secretion of AvrRxv, another secreted avirulence protein from X. c. pv. vesicatoria (Whalen et al., 1988; Rossier et al., 1999), was also not affected by the hrpF mutations (data not shown). Furthermore, when YopE was expressed in hrpF mutants, it was detected in the supernatant (Fig. 5B). Thus, hrpF mutants are not impaired in protein secretion in vitro, although they have a clear hrp phenotype in planta.

image

Figure 5. Mutants in hrpF secrete AvrBs3, HrpB2 and YopE. Immunoblotting analyses of total protein (lanes 1–4) and supernatants (lanes 5–8) using specific antibodies was performed as in Fig. 3. Strains used were 85*-derived mutants expressing avrBs3 from pDS300F (A) or yopE and yerA from pLKW1 (B).

A. Detection of AvrBs3, HrpB2 and HrcN. Lanes 1 and 5, 85* (wild type); lanes 2 and 6, 85*ΔhrcV; lanes 3 and 7, 85*::F314 (hrpF mutant); lanes 4 and 8, 85*::F440 (hrpF mutant). Note that the quantity of HrpB2 in total protein (lanes 3 and 4) has been variable. The reason is unknown.

B. Detection of YopE and YerA. Loading was as for (A).

Download figure to PowerPoint

HrpF is secreted in an Hrp-dependent manner

Interestingly, the HrpF homologue NolX of the symbiont Rhizobium spp. NGR234 is secreted via a type III system (Viprey et al., 1998). To investigate whether HrpF is secreted by X. c. pv. vesicatoria, the Flag epitope-tagged HrpF protein was expressed under the control of its own promoter in 82* using plasmid pLFF (Huguet and Bonas, 1997). As shown in Fig. 6, HrpF-Flag was present in the supernatant of 82*(pLFF) but absent in the supernatant of the hrcV and hrpB2 mutants. Approximately 20% of the total amount of HrpF protein was secreted. The intracellular control, HrcN, was only detectable in total protein extracts but not in the supernatants (Fig. 6). Thus, HrpF is unique in that it is dispensable for type III secretion in vitro but essential for the interaction with the host and is itself secreted by the Hrp system.

image

Figure 6. HrpF is secreted in an hrp-dependent manner. Immunoblotting analysis of total protein (lanes 1–4) and supernatants (lanes 5–8) using a Flag-specific antibody and an HrcN-specific antibody. Strains used were: lanes 1 and 5, 82*(pLAFR3) (wild type containing empty vector); lanes 2 and 6, 82*(pLFF) (wild type expressing HrpF-Flag); lanes 3 and 7, 82*ΔhrcV(pLFF); and lanes 4 and 8, 82*ΔhrpB2(pLFF). For this experiment, total protein extracts and supernatants were concentrated 50- and 200-fold respectively. Proteins were analysed by SDS–PAGE and immunoblotting as in Fig. 3.

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

In this study, 12 genes in the large hrp gene cluster of X. c. pv. vesicatoria were analysed with respect to their role in Hrp type III secretion (for a summary, see Table 1). The finding that the conserved proteins HrcQ, HrcR, HrcS and HrcT are essential for in vitro secretion is in good agreement with the prediction that they are part of the core secretion machinery (Bonas, 1994; Bogdanove et al., 1996a). Previous studies in plant pathogens have shown several hrc genes to be necessary for protein secretion, i.e. hrcC (He et al., 1993; Arlat et al., 1994), hrcJ (Deng and Huang, 1999), hrcT (Bogdanove et al., 1996b), hrcU (Huang et al., 1995) and hrcV (Wei and Beer, 1993; Arlat et al., 1994; Rossier et al., 1999). Interestingly, some of the non-conserved hrp genes of X. c. pv. vesicatoria were also required for secretion and may therefore encode additional proteins associated with the secretion apparatus. All the mutants defective in secretion of the endogenous avirulence protein AvrBs3 also failed to secrete the heterologous protein YopE from Y. pseudotuberculosis. Thus, no mutant specifically defective in the secretion of AvrBs3 was found. This indicates that none of the genes studied here encodes auxiliary proteins specific for AvrBs3 secretion, such as a chaperone or a protein required for recognition of an AvrBs3-specific secretion signal. Future localization and interaction studies will help to understand the role of each individual component of the secretion apparatus.

For most of the hrp mutants studied in this paper, we found a correlation between their phenotype in the interaction with the plant and the ability to secrete in vitro, i.e. most hrp mutants were defective in secretion (Table 1). A similar correlation could be made for the hpaA mutant of X. c. pv. vesicatoria, which has reduced capability to cause disease but still induces a partial HR on resistant plants. Thus, Avr protein delivery into the plant cell still occurs, albeit with lower efficiency (Huguet et al., 1998). Using the in vitro secretion assay, AvrBs3 and YopE were detected in the supernatant of the hpaA mutant, although amounts were reduced two- to fivefold compared with the wild-type strain. In contrast, the heterologous protein PopA was not secreted by this mutant. Therefore, HpaA is not essential for protein secretion, but appears to be required for efficient secretion of a subset of proteins. In addition, HpaA could also have a role in the plant cell. This hypothesis is supported by preliminary evidence for secretion of HpaA (K. Hahn and U. Bonas, unpublished data) and the fact that HpaA contains nuclear localization signals required for its function (Huguet et al., 1998).

Among the non-conserved proteins of X. c. pv. vesicatoria shown to be required for Hrp type III secretion, HrpB2 is particularly intriguing. The observation that HrpB2 is secreted by the Hrp system and is crucial for the secretion of other proteins travelling the type III pathway might indicate a ‘hierarchy’ in protein secretion. Stepwise secretion was reported for other type III secretion systems. For example, in Salmonella typhimurium, Collazo and Galan (1996) showed that InvJ and SpaO are not only substrates of the invspa type III secretion system, but are also needed for the secretion of SipB and SipC. Recent work on Yersinia pestis revealed that YscO, YscP and YscX are type III-secreted proteins that are necessary for Yop secretion (Payne and Straley, 1998; 1999; Day and Plano, 2000). Another example of a hierarchy in secretion is the flagellum assembly in S. typhimurium. The core components of the export system for flagellum assembly are highly homologous to conserved proteins of type III secretion systems (Macnab, 1996). In the early stages of flagellum assembly, a subclass of proteins is exported, followed by a second set of proteins after passing a particular checkpoint (Minamino et al., 1999). The fact that HrpB2 is required for secretion via the Hrp pathway suggests that it is part of the secretion apparatus. The protein might be localized on the surface of the bacterium, e.g. as part of an appendage such as the Hrp pilus of P. s. pv. tomato and R. solanacearum (Roine et al., 1997; Van Gijsegem et al., 2000). In these bacteria, the subunit of the pilus is secreted via the Hrp pathway and is necessary for the secretion of other proteins (Van Gijsegem et al., 2000; Wei et al., 2000). Pili have also been observed on the surface of X. c. pv. vesicatoria grown in hrp-inducing conditions and were mainly composed of the HrpE1 protein (T. Ojanen-Reuhs, T. Korhonen and U. Bonas, unpublished). Future work is needed to test whether HrpB2 is associated with these structures and whether the low amounts of HrpB2 detected in the supernatants reflect its occasional release into the culture medium.

In addition to HrpB2, we have demonstrated secretion of another Hrp protein, HrpF, of X. c. pv. vesicatoria. HrpF is 67% similar to NolX of the symbiont Rhizobium fredii (Huguet and Bonas, 1997), which was recently shown to be secreted (Viprey et al., 1998). The role of NolX in nodulation and secretion in Rhizobium is not known. Although HrpF in X. c. pv. vesicatoria is essential for the bacterial interaction with the plant, i.e. for causing disease on susceptible plants and inducing the HR on resistant plants, HrpF is not required for Hrp-dependent secretion of AvrBs3 and YopE in vitro, as shown here. Whether hrpF mutants inoculated into the host tissue still secrete proteins is not known. However, we believe that HrpF plays a crucial role at a step after protein secretion across the bacterial envelope, i.e. translocation into the host cell. Indirect support for this hypothesis is provided by the fact that recognition of AvrBs3 by resistant plants occurs inside the plant cell and does not require an additional bacterial factor (Van den Ackerveken et al., 1996). Thus, although AvrBs3 is secreted by hrpF mutants, there may not be translocation into the plant cell in the absence of a ‘translocator’ responsible for the transfer of effector proteins across the plant plasma membrane. In Yersinia spp., translocation but not secretion of the effector proteins YopE and YopH has been shown to depend on the secreted proteins LcrV, YopB and YopD (Rosqvist et al., 1991; Håkansson et al., 1996; Pettersson et al., 1999). YopB exhibits membrane-disruptive activity and is required for the formation of a pore in macrophage membranes (Håkansson et al., 1996; Neyt and Cornelis, 1999). Additionally, in vitro studies with lipid bilayers showed that YopB and YopD proteins form a channel, which is YopB but not YopD dependent (Tardy et al., 1999). Whether HrpF forms a pore in the plant cell membrane or serves as an anchor for effector proteins is under investigation. Interestingly, HrpF and NolX contain two putative transmembrane domains in their C-terminal domain (Huguet and Bonas, 1997), a feature that is common to YopB and the putative translocators SipB of Salmonella, IpaB of Shigella and EspD of enteropathogenic Escherichia coli (Hueck, 1998; Wachter et al., 1999).

Integrating current knowledge and predictions based on sequence analysis of the X. c. pv. vesicatoria Hrp system, we propose a new working model (Fig. 7). Hrc proteins are core components of the secretion machinery, most of which are presumably localized in the inner membrane (e.g. HrcV). The HrcN protein, a putative ATPase, probably energizes the system (Fenselau et al., 1992). HrcJ, a putative lipoprotein, is localized to both the inner and the outer membrane (Deng and Huang, 1999; this study). HrcC, the secretin, was previously localized in the bacterial outer membrane (Wengelnik et al., 1996b) and may form ring-shaped multimeric complexes as shown for the Yersinia YscC and Salmonella InvG proteins (Koster et al., 1997; Crago and Koronakis, 1998). Interestingly, homologues of HrcJ and HrcC are part of a needle-like structure spanning both membranes of S. typhimurium (Kubori et al., 1998), indicating that proteins required for protein secretion are assembled in a supramolecular structure. Immunocytology and protein interaction studies will help to understand this complex secretion machinery better.

image

Figure 7. Model for the role of X. c. pv. vesicatoria Hrp proteins in type III secretion and interaction with the plant. Owing to the lack of specific antibodies, the localization of many components in the secretion apparatus is hypothetical. The core components of the secretion apparatus are most probably the predicted inner membrane proteins HrcR, HrcS, HrcT, HrcU and HrcV, the putative lipoprotein HrcJ and the outer membrane protein HrcC. The ATPase HrcN may energize the system. Localization of HrpB1, HrpB4 and HrcJ have been determined in this study. HrcQ, HrpB5, HrpD5 and HrpD6 are predicted to be soluble. HrpB2, HrpF and Avr proteins are substrates of the secretion machinery. As HrpB2 is required for the secretion of other proteins, it may be an extracellular component of the secretion apparatus. In contrast, HrpF is dispensable for Hrp-dependent secretion, but required for AvrBs3 recognition in planta. We propose that HrpF functions as a translocator of effector proteins into the host cell. See also the text.

Download figure to PowerPoint

Particularly challenging is the question of how plant pathogenic bacteria actually make contact with their host cells that are surrounded by a cell wall. Do surface appendages provide a tunnel or a sledge for the transport of effector proteins? HrpB2 and HrpF are essential for secretion and translocation, respectively, of effector proteins. The discovery that they are themselves secreted provides an important clue for a better understanding of the physical connection between the bacterial and the plant cell.

Experimental procedures

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

Bacterial strains, growth conditions and plasmids

Bacterial strains used in this study were E. coli strains DH5α (Bethesda Research Laboratories), DH5αλpir (Ménard et al., 1993), E. coli BL21 (DE3) (Studier and Moffatt, 1986) and HB101 (Boyer and Roulland-Dussoix, 1969) and X. campestris pv. vesicatoria strains 85-10, 82-8 (Bonas et al., 1989; Minsavage et al., 1990) and 85EDAD (Wengelnik et al., 1996b). Strains 82* and 85* are derivatives of 82-8 and 85-10, respectively, that express a mutated, constitutively active version of hrpG (Wengelnik et al., 1999). E. coli cells were cultivated at 37°C in Luria–Bertani medium and Xanthomonas strains at 30°C in NYG broth (Daniels et al., 1984) or in minimal media A (Ausubel et al., 1996) supplemented with sucrose (10 mM) and casamino acids (0.3%). Antibiotics were added to the media at the following final concentrations: ampicillin, 100 µg ml−1; kanamycin, 25 µg ml−1; tetracycline, 10 µg ml−1; rifampicin, 100 µg ml−1; spectinomycin, 100 µg ml−1. Plasmids were introduced into E. coli by electroporation and into Xanthomonas by conjugation using pRK2013 as a helper plasmid in triparental matings as described previously (Huguet et al., 1998).

Construction of non-polar mutants

HrpB1.  A 2 kb EcoRV–SmaI fragment, containing part of hrcV, hrcU and the start of hrpB1, was subcloned into pBluescript. The plasmid was digested with SmaI–NotI and ligated with a 2.1 kb EcoRI (Klenow-treated)–NotI fragment containing the end of hrpB1, hrpB2hrpB4 and part of hrpB5 to obtain pBB1D. The 4.1 kb EcoRV–SalI fragment carrying a 411 bp in frame deletion in hrpB1 (amino acids 8–144) was subcloned in the suicide plasmid pOK (Huguet et al., 1998), digested with SalI–SmaI, to obtain pOB1D.

HrpB2.  A 3 kb EcoRV–XhoI fragment, containing part of hrcV, hrcU, hrpB1 and hrpB2, was subcloned into pBluescript to obtain pBB2.2. A 2.5 kb fragment was amplified from pBB2.2 using Pfu polymerase (Stratagene) and primers T7 and B2del (GGAATTCATGACATACTCCTATGGGGTC, binds downstream of hrpB1). The PCR product was digested with BamHI (in the hrpB promoter) and RcaI (underlined in the primer sequence), giving a 560 bp fragment. In parallel, pBB2.2 was digested with BamHI (in the hrpB promoter) and NcoI (in hrpB2, compatible with RcaI). The resulting 3.5 kb fragment was ligated to the digested polymerase chain reaction (PCR) fragment to obtain pBB2D, the insert of which was sequenced. A 4.5 kb EcoRV–SalI fragment, containing part of hrcV, hrcU and hrpB1hrpB4, was cloned into pOK (SalI–SmaI) to obtain pOB2. A 1.1 kb BamHI–XhoI fragment was removed from pOB2 and replaced by a 0.8 kb fragment from pBB2D. The resulting pOB2D clone has an in frame deletion of 309 bp removing amino acids 2–103 of HrpB2.

HrpB4.  Clone B10g (Fenselau and Bonas, 1995) containing a 7.3 kb BamHI fragment, encoding hrpB1 to hrpB7, was digested with MluI then religated, thus removing a 330 bp fragment (amino acids 20–129 of HrpB4). The resulting pBB4D clone was digested with BamHI–EcoRV, and a 4.2 kb fragment was ligated into pOK (BamHI–SmaI) to obtain pOB4D.

HrpB5.  A 4.5 kb BamHI–EcoRV fragment, containing hrpB1hrcN, was cloned in the suicide vector pOK (BamHI–SmaI) to obtain pOB5. A 0.2 kb internal NotI fragment was removed from pOB5 by digestion and religation. The resulting clone pOB5D carries an in frame deletion of 195 bp in the central part of hrpB5, thereby removing amino acids 108–172 of HrpB5.

The non-polar deletion mutant 85*ΔhrcV was generated in 85* using the suicide plasmid pROΔhrcV, which carries a 562 bp deletion in hrcV (Rossier et al., 1999). Mutant 85*ΔhrcV was complemented with plasmid pSCOB (Rossier et al., 1999), which contains the hrpC operon with an insertion in the last gene, hrpC3.

The generation of non-polar mutants 82*ΔhrcQ, 82*ΔhrcR, 82*ΔhrcS, 82*ΔhpaA, 82*ΔhrpD5 and 82*ΔhrpD6 and complementation analyses were performed using the constructs described previously (Huguet et al., 1998).

Generation of 85*::B5014, 85*::B5077, 85*::F314 and 85*::F440

Owing to low conjugation frequency, it was not possible to introduce plasmids containing transposon insertions into strain 82*. Generation of 85* mutants in hrcT (85*::B5014 and 85*::B5077) and hrpF (85*::F314 and 85*::F440) was done by marker exchange mutagenesis as described previously (Bonas et al., 1991), using plasmids pXV9::B5014, pXV9::B5077 (Fenselau and Bonas, 1995), pXV2::F314 (Schulte and Bonas, 1992) and pXV2::F440 (Bonas et al., 1991). Mutants in hrcT were complemented using plasmid pDB8, which contains hrcT on a PstI–EcoRI fragment cloned into pDSK600 (Murillo et al., 1994). The hrpF mutants were complemented with pLFF, which contains hrpF under the control of its own promoter (Huguet and Bonas, 1997).

Plant material and plant inoculations

Inoculation of leaves of near-isogenic pepper cultivars Early Cal Wonder (ECW), ECW-10R and ECW-30R was performed as described previously (Bonas et al., 1989). The concentration of the inoculum was approximately 108 cfu ml−1 in 1 mM MgCl2. Reactions were scored over a period of up to 7 days.

Secretion experiments

Bacteria were cultivated in minimal medium A (MA) at 30°C overnight and resuspended to an optical density (OD) at 600 nm of 0.1 in secretion medium [MA at pH 5.4 (acidified by the addition of HCl) containing BSA (100 µg ml−1; New England Biolabs)]. After 4–5 h, 0.5 ml of the total culture was precipitated for 30 min on ice with 10% trichloroacetic acid (TCA). After centrifugation, protein pellets were washed with ethanol and resuspended in Laemmli buffer (1/10th volume) (Laemmli, 1970). The remaining culture was filtered with a low-protein-binding filter (HT Tuffryn, 0.45 µm; Gelman Sciences). Supernatants were precipitated with TCA and resuspended in Laemmli buffer (1/100th volume, unless otherwise stated). Secretion experiments shown in this study were performed at least three times. Relative amounts of secreted proteins were quantified either by serial dilutions or by densitometric analysis (IS-1000 Digital Imaging System; Alpha Innotech).

Protein analysis

Proteins HrpB1, HrpB2, HrpB4 and HrcN were overexpressed in E. coli using different pET-derived plasmids (Fenselau and Bonas, 1995). After SDS–PAGE, proteins were visualized by shaking the gel in cold 0.25 M KCl, whereupon they were excised and dialysed against 50 mM Tris-HCl, pH 7.5, before storage at −20°C. New Zealand White rabbits were immunized with the powderized protein in polyacrylamide. The serum taken after the third booster injection was depleted against total protein extracts from induced E. coli BL21 (DE3) (pET3a) and from the X. c. pv. vesicatoria hrp deletion strain 85EDAD grown in NYG.

Other antibodies used were polyclonal anti-AvrBs3 antibody (Knoop et al., 1991), anti-Flag M2 monoclonal antibody (IBI/Kodak), rabbit polyclonal anti-PopA antiserum (provided by C. Boucher) and specific anti-YopE and anti-YerA antisera (provided by H. Wolf-Watz). For immunoblotting analysis, equal amounts of proteins were separated by SDS–PAGE and transferred to nitrocellulose as described previously (Wengelnik et al., 1996b). Horseradish peroxidase-labelled goat anti-mouse or goat anti-rabbit antibodies were used as secondary antibodies. Reactions were visualized by enhanced chemiluminescence (Amersham Pharmacia Biotech).

Subcellular fractionation was carried out using cells from exponentially growing X. c. pv. vesicatoria cultures in minimal medium A, as described previously (Wengelnik et al., 1996b).

Acknowledgements

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

We thank A. Landgraf for excellent technical assistance. We are grateful to C. Boucher and H. Wolf-Watz for kindly providing antisera used in this study, and to E. Marois, R. Koebnik and M. Robey for helpful comments on the manuscript and the figures. This work was funded in part by an EC grant (BIO4-CT97-2244) and the Deutsche Forschungsgemeinschaft (SFB 363) to U.B. O.R. was supported by a grant from the Ministère de l'Education Nationale et de la Recherche and an exchange fellowship from the Deutscher Akademischer Austauschdienst.

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References
  • Alfano, J.R. & Collmer, A. (1997) The type III (Hrp) secretion pathway of plant pathogenic bacteria: trafficking harpins, Avr proteins, and death. J Bacteriol 179: 56555662.
  • Arlat, M., Van Gijsegem, F., Huet, J.C., Pernollet, J.C. & Boucher, C.A. (1994) PopA1, a protein which induces a hypersensitivity-like response on specific Petunia genotypes, is secreted via the Hrp pathway of Pseudomonas solanacearum. EMBO J 13: 543553.
  • Ausubel, F.M., Brent, R., Kingston, R.E., Moore, D.D., Seidman, J.G., Smith, J.A. & Struhl, K. (eds) (1996) Current Protocols in Molecular Biology. New York: Wiley.
  • Bogdanove, A.J., Beer, S.V., Bonas, U., Boucher, C.A., Collmer, A. & Coplin, D.L., et al. (1996a) Unified nomenclature for broadly conserved hrp genes of phytopathogenic bacteria. Mol Microbiol 20: 681683.
  • Bogdanove, A.J., Wei, Z.M., Zhao, L. & Beer, S.V. (1996b) Erwinia amylovora secretes harpin via a type III pathway and contains a homolog of yopN of Yersinia spp. J Bacteriol 178: 17201730.
  • Bogdanove, A.J., Bauer, D.W. & Beer, S.V. (1998) Erwinia amylovora secretes DspE, a pathogenicity factor and functional AvrE homolog, through the Hrp (type III secretion) pathway. J Bacteriol 180: 22442247.
  • Bonas, U. (1994) hrp genes of phytopathogenic bacteria. Curr Topics Microbiol Immunol 192: 7998.
  • Bonas, U., Stall, R.E. & Staskawicz, B. (1989) Genetic and structural characterization of the avirulence gene avrBs3 from Xanthomonas campestris pv. vesicatoria. Mol Gen Genet 218: 127136.
  • Bonas, U., Schulte, R., Fenselau, S., Minsavage, G.V. & Staskawicz, B.J. (1991) Isolation of a gene cluster from Xanthomonas campestris pv. vesicatoria that determines pathogenicity and the hypersensitive response on pepper and tomato. Mol Plant–Microbe Interact 4: 8188.
  • Boyer, H.W. & Roulland-Dussoix, D. (1969) A complementation analysis of the restriction and modification of DNA in Escherichia coli. J Mol Biol 41: 459472.
  • Charkowski, A.O., Alfano, J.R., Preston, G., Yuan, J., He, S.Y. & Collmer, A. (1998) The Pseudomonas syringae pv. tomato HrpW protein has domains similar to harpins and pectate lyases and can elicit the plant hypersensitive response and bind to pectate. J Bacteriol 180: 52115217.
  • Collazo, C.M. & Galan, J.E. (1996) Requirement for exported proteins in secretion through the invasion-associated type III system of Salmonella typhimurium. Infect Immun 64: 35243531.
  • Crago, A.M. & Koronakis, V. (1998) Salmonella InvG forms a ring-like multimer that requires the InvH lipoprotein for outer membrane localization. Mol Microbiol 30: 4756.DOI: 10.1046/j.1365-2958.1998.01036.x
  • Daniels, M.J., Barber, C.E., Turner, P.C., Sawczyc, M.K., Byrde, R.J.W. & Fielding, A.H. (1984) Cloning of genes involved in pathogenicity of Xanthomonas campestris pv. campestris using the broad host range cosmid pLAFR1. EMBO J 3: 33233328.
  • Day, J.B. & Plano, G.V. (2000) The Yersinia pestis YscY protein directly binds YscX, a secreted component of the type III secretion machinery. J Bacteriol 182: 18341843.
  • Deng, W.L. & Huang, H.C. (1999) Cellular locations of Pseudomonas syringae pv. syringae HrcC and HrcJ proteins, required for harpin secretion via the type III pathway. J Bacteriol 181: 22982301.
  • Van Dijk, K., Fouts, D.E., Rehm, A.H., Hill, A.R., Collmer, A. & Alfano, J.R. (1999) The Avr (effector) proteins HrmA (HopPsyA) and AvrPto are secreted in culture from Pseudomonas syringae pathovars via the Hrp (type III) protein secretion system in a temperature- and pH-sensitive manner. J Bacteriol 181: 47904797.
  • Fenselau, S. & Bonas, U. (1995) Sequence and expression analysis of the hrpB pathogenicity operon of Xanthomonas campestris pv. vesicatoria which encodes eight proteins with similarity to components of the Hrp, Ysc, Spa, and Fli secretion systems. Mol Plant–Microbe Interact 8: 845854.
  • Fenselau, S., Balbo, I. & Bonas, U. (1992) Determinants of pathogenicity in Xanthomonas campestris pv. vesicatoria are related to proteins involved in secretion in bacterial pathogens of animals. Mol Plant–Microbe Interact 5: 390396.
  • Gaudriault, S., Malandrin, L., Paulin, J.P. & Barny, M.A. (1997) DspA, an essential pathogenicity factor of Erwinia amylovora showing homology with AvrE of Pseudomonas syringae, is secreted via the Hrp secretion pathway in a DspB-dependent way. Mol Microbiol 26: 10571069.
  • Håkansson, S., Schesser, K., Persson, C., Galyov, E.E., Rosqvist, R., Homble, F. & Wolf-Watz, H. (1996) The YopB protein of Yersinia pseudotuberculosis is essential for the translocation of Yop effector proteins across the target cell plasma membrane and displays a contact-dependent membrane disrupting activity. EMBO J 15: 58125823.
  • He, S.Y., Huang, H.C. & Collmer, A. (1993) Pseudomonas syringae pv. syringae harpinPss: a protein that is secreted via the Hrp pathway and elicits the hypersensitive response in plants. Cell 73: 12551266.
  • Huang, H.C., Lin, R.H., Chang, C.J., Collmer, A. & Deng, W.L. (1995) The complete hrp gene cluster of Pseudomonas syringae pv. syringae 61 includes two blocks of genes required for harpinPss secretion that are arranged colinearly with Yersinia ysc homologs. Mol Plant–Microbe Interact 8: 733746.
  • Hueck, C.J. (1998) Type III protein secretion systems in bacterial pathogens of animals and plants. Microbiol Mol Biol Rev 62: 379433.
  • Huguet, E. & Bonas, U. (1997) hrpF of Xanthomonas campestris pv. vesicatoria encodes an 87-kDa protein with homology to NoIX of Rhizobium fredii. Mol Plant–Microbe Interact 10: 488498.
  • Huguet, E., Hahn, K., Wengelnik, K. & Bonas, U. (1998) hpaA mutants of Xanthomonas campestris pv. vesicatoria are affected in pathogenicity but retain the ability to induce host-specific hypersensitive reaction. Mol Microbiol 29: 13791390.
  • Kim, J.F. & Beer, S.V. (1998) HrpW of Erwinia amylovora, a new harpin that contains a domain homologous to pectate lyases of a distinct class. J Bacteriol 180: 52035210.
  • Knoop, V., Staskawicz, B. & Bonas, U. (1991) Expression of the avirulence gene avrBs3 from Xanthomonas campestris pv. vesicatoria is not under the control of hrp genes and is independent of plant factors. J Bacteriol 173: 71427150.
  • Koster, M., Bitter, W., De Cock, H., Allaoui, A., Cornelis, G.R. & Tommassen, J. (1997) The outer membrane component, YscC, of the Yop secretion machinery of Yersinia enterocolitica forms a ring-shaped multimeric complex. Mol Microbiol 26: 789797.
  • Kubori, T., Matsushima, Y., Nakamura, D., Uralil, J., Lara-Tejero, M. & Sukhan, A., et al. (1998) Supramolecular structure of the Salmonella typhimurium type III protein secretion system. Science 280: 602605.DOI: 10.1126/science.280.5363.602
  • Laemmli, U.K. (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227: 680685.
  • Leach, J.E. & White, F.F. (1996) Bacterial avirulence genes. Annu Rev Phytopathol 34: 153179.
  • Macnab, R.B. (1996) Flagella and motility. In Escherichia coli and Salmonella. Neidhardt, F.C. (ed. ). Washington, DC: American Society for Microbiology Press, pp. 123145.
  • Ménard, R., Sansonetti, P.J. & Parsot, C. (1993) Nonpolar mutagenesis of the ipa genes defines IpaB, IpaC, and IpaD as effectors of Shigella flexneri entry into epithelial cells. J Bacteriol 175: 58995906.
  • Michiels, T., Vanooteghem, J.C., Lambert de Rouvroit, C., China, B., Gustin, A., Boudry, P. & Cornelis, G.R. (1991) Analysis of virC, an operon involved in the secretion of Yop proteins by Yersinia enterocolitica. J Bacteriol 173: 49945009.
  • Minamino, T., Doi, H. & Kutsukake, K. (1999) Substrate specificity switching of the flagellum-specific export apparatus during flagellar morphogenesis in Salmonella typhimurium. Biosci Biotechnol Biochem 63: 13011303.
  • Minsavage, G.V., Dahlbeck, D., Whalen, M.C., Kearney, B., Bonas, U., Staskawicz, B.J. & Stall, R.E. (1990) Gene-for-gene relationships specifying disease resistance in Xanthomonas campestris pv. vesicatoria–pepper interactions. Mol Plant–Microbe Interact 3: 4147.
  • Mudgett, M.B. & Staskawicz, B.J. (1999) Characterization of the Pseudomonas syringae pv. tomato AvrRpt2 protein: demonstration of secretion and processing during bacterial pathogenesis. Mol Microbiol 32: 927941.
  • Murillo, J., Shen, H., Gerhold, D., Sharma, A., Cooksey, D.A. & Keen, N.T. (1994) Characterization of pPT23B, the plasmid involved in syringolide production by Pseudomonas syringae pv. tomato PT23. Plasmid 31: 275287.DOI: 10.1006/plas.1994.1029
  • Neyt, C. & Cornelis, G.R. (1999) Insertion of a Yop translocation pore into the macrophage plasma membrane by Yersinia enterocolitica: requirement for translocators YopB and YopD, but not LcrG. Mol Microbiol 33: 971981.
  • Payne, P.L. & Straley, S.C. (1998) YscO of Yersinia pestis is a mobile core component of the Yop secretion system. J Bacteriol 180: 38823890.
  • Payne, P.L. & Straley, S.C. (1999) YscP of Yersinia pestis is a secreted component of the Yop secretion system. J Bacteriol 181: 28522862.
  • Pettersson, J., Holmstrom, A., Hill, J., Leary, S., Frithz-Lindsten, E. & Von Euler-Matell, A., et al. (1999) The V-antigen of Yersinia is surface exposed before target cell contact and involved in virulence protein translocation. Mol Microbiol 32: 961976.
  • Roine, E., Wei, W., Yuan, J., Nurmiaho-Lassila, E.L., Kalkkinen, N., Romantschuk, M. & He, S.Y. (1997) Hrp pilus: an hrp-dependent bacterial surface appendage produced by Pseudomonas syringae pv. tomato DC3000. Proc Natl Acad Sci USA 94: 34593464.DOI: 10.1073/pnas.94.7.3459
  • Rosqvist, R., Forsberg, A. & Wolf-Watz, H. (1991) Intracellular targeting of the Yersinia YopE cytotoxin in mammalian cells induces actin microfilament disruption. Infect Immun 59: 45624569.
  • Rossier, O., Wengelnik, K., Hahn, K. & Bonas, U. (1999) The Xanthomonas Hrp type III system secretes proteins from plant and mammalian bacterial pathogens. Proc Natl Acad Sci USA 96: 93689373.DOI: 10.1073/pnas.96.16.9368
  • Schulte, R. & Bonas, U. (1992) Expression of the Xanthomonas campestris pv. vesicatoria hrp gene cluster, which determines pathogenicity and hypersensitivity on pepper and tomato, is plant inducible. J Bacteriol 174: 815823.
  • Studier, F.W. & Moffatt, B.A. (1986) Use of bacteriophage T7 RNA polymerase to direct selective high-level expression of cloned genes. J Mol Biol 189: 113130.
  • Tardy, F., Homble, F., Neyt, C., Wattiez, R., Cornelis, G.R., Ruysschaert, J.M. & Cabiaux, V. (1999) Yersinia enterocolitica type III secretion-translocation system: channel formation by secreted Yops. EMBO J 18: 67936799.DOI: 10.1093/emboj/18.23.6793
  • Van den Ackerveken, G., Marois, E. & Bonas, U. (1996) Recognition of the bacterial avirulence protein AvrBs3 occurs inside the host plant cell. Cell 87: 13071316.
  • Van Gijsegem, F., Vasse, J., Camus, J.C., Marenda, M. & Boucher, C. (2000) Ralstonia solanacearum produces hrp-dependent pili that are required for PopA secretion but not for attachment of bacteria to plant cells. Mol Microbiol 36: 249260.DOI: 10.1046/j.1365-2958.2000.01851.x
  • Viprey, V., Del Greco, A., Golinowski, W., Broughton, W.J. & Perret, X. (1998) Symbiotic implications of type III protein secretion machinery in Rhizobium. Mol Microbiol 28: 13811389.
  • Wachter, C., Beinke, C., Mattes, M. & Schmidt, M.A. (1999) Insertion of EspD into epithelial target cell membranes by infecting enteropathogenic Escherichia coli. Mol Microbiol 31: 16951707.
  • Wei, W., Plovanich-Jones, A., Deng, W.L., Jin, Q.L., Collmer, A., Huang, H.C. & He, S.Y. (2000) The gene coding for the Hrp pilus structural protein is required for type III secretion of Hrp and Avr proteins in Pseudomonas syringae pv. tomato. Proc Natl Acad Sci USA 97: 22472252.DOI: 10.1073/pnas.040570097
  • Wei, Z.M. & Beer, S.V. (1993) HrpI of Erwinia amylovora functions in secretion of harpin and is a member of a new protein family. J Bacteriol 175: 79587967.
  • Wengelnik, K. & Bonas, U. (1996) HrpXv, an AraC-type regulator, activates expression of five of the six loci in the hrp cluster of Xanthomonas campestris pv. vesicatoria. J Bacteriol 178: 34623469.
  • Wengelnik, K., Van den Ackerveken, G. & Bonas, U. (1996a) HrpG, a key hrp regulatory protein of Xanthomonas campestris pv. vesicatoria is homologous to two-component response regulators. Mol Plant–Microbe Interact 9: 704712 .
  • Wengelnik, K., Marie, C., Russel, M. & Bonas, U. (1996b) Expression and localization of HrpA1, a protein of Xanthomonas campestris pv. vesicatoria essential for pathogenicity and induction of the hypersensitive reaction. J Bacteriol 178: 10611069.
  • Wengelnik, K., Rossier, O. & Bonas, U. (1999) Mutations in the regulatory gene hrpG of Xanthomonas campestris pv. vesicatoria result in constitutive expression of all hrp genes. J Bacteriol 181: 68286831.
  • Whalen, M.C., Stall, R.E. & Staskawicz, B.J. (1988) Characterization of a gene from a tomato pathogen determining hypersensitive resistance in non-host species and genetic analysis of this resistance in bean. Proc Natl Acad Sci USA 85: 67436747.
Footnotes
  1. Present addresses: Northwestern University, Department of Microbiology and Immunology, Chicago, IL 60611, USA.

  2. University of Utrecht, Department of Molecular Cell Biology, 3508 TB Utrecht, The Netherlands.