SEARCH

SEARCH BY CITATION

Summary

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

To determine the contribution of the previously identified internalins, InlA, InlB, InlC, InlE, InlG, and InlH, to internalization of Listeria monocytogenes by non-professional phagocytic mammalian cells, we constructed mutants with various combinations of deletions in the respective inl genes. Internalization of these mutants into the epithelial-like Caco-2 and the microvascular endothelial HBMEC cell lines were studied. Deletion of the inlGHE gene cluster, or of the single genes, led to a two to fourfold increased internalization by HBMEC and other non-phagocytic mammalian cells. Invasion into HBMEC was totally blocked in the absence of InlB, and InlB-dependent internalization did not require the presence of any of the other internalins. Internalization by Caco-2 cells was reduced to a level of about 1% in the absence of InlA and InlB, and was most efficient in the presence of InlA, InlB and InlC and in the absence of InlG, InlH and InlE. InlB and InlA, in each case in the absence of the other internalins, led (compared with the wild-type strain) to reduced internalization of about 20% and less than 10% respectively. InlA-dependent internalization (in the absence of InlB) required the additional function of InlC and InlGHE. The deletion of inlGHE enhanced the expression of InlA and InlB. The increased amount of InlA led to an increase in early association of L. monocytogenes with Caco-2 cells without enhancing its uptake in the absence of the other internalins, whereas the larger amount of InlB did not enhance early association of L. monocytogenes with HBMEC but led to an increase in internalization of L. monocytogenes. The results suggest that InlB is able to induce phagocytosis in HBMEC and (at a lower efficiency) in Caco-2 cells by itself, but InlA needs the supportive functions of the other internalins to trigger phagocytosis. None of these internalins seems to be required for cell-to-cell spread by L. monocytogenes, as shown by microinjection of Caco-2 cells with appropriate inl mutants.


Introduction

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

A number of facultative intracellular bacteria, including Listeria monocytogenes, can penetrate mammalian cells that are normally non-phagocytic. These bacteria are apparently able to trigger the phagocytic process by inducing the assembly of a phagocytosis machinery, which is present in these non-phagocytic cells in an inactive or unassembled state, to promote their own internalization by these host cells. For this ‘invasion’ step, the bacteria need specific surface components that appear to interact with host cell receptors (Finlay and Cossart, 1997). This interaction initiates a series of signal transduction events, still incompletely understood in most cases, that finally result in the phagocytosis of the bacteria by the host cell.

In L. monocytogenes, a Gram-positive bacterium responsible for severe food-borne infections in humans and animals (reviewed in Vazquez-Boland et al., 2001), induction of phagocytosis by a large number of non-phagocytic cell types is mediated by two surface proteins, InlA and InlB (Gaillard et al., 1991; Dramsi et al., 1995). These internalins belong to a large protein family which, in addition to InlA and InlB, comprises at least seven more internalins, termed InlC, InlC2, InlD, InlE, InlF, InlG and InlH (Engelbrecht et al., 1996; Dramsi et al., 1997; Raffelsbauer et al., 1998). In contrast to InlA and InlB, none of the other internalins seems to be able to induce phagocytosis by non-phagocytic mammalian cells (Engelbrecht et al., 1996; Dramsi et al., 1997) and their function is unknown.

All proteins of the internalin family share as common sequence motif the leucine-rich-repeat (LRR) domain, a structural feature identified in many other eukaryotic and prokaryotic proteins that defines the large family of LRR proteins (Kobe and Deisenhofer, 1994, 1995). The LRR regions of the internalins consist of tandemly arranged repeat units, almost all of which contain 22 amino acids. The number of these LRRs varies from six in InlG to 16 in InlA (Marino et al., 2000). The LRR regions form specific structures (Marino et al., 1999) that are assumed to be essential for the interaction of the internalins with other proteins including specific receptors (Marino et al., 2000). The 213-amino-acid LRR region of InlB (consisting of eight LRRs) has been shown to be sufficient for entry into mammalian cells (Braun et al., 1999), suggesting that all steps required for induced phagocytosis including recognition of the specific receptor and signal transduction are triggered by this LRR region. In the case of InlA, in addition to the LRRs, the inter-repeat region is also critical for the recognition of the receptor (Lecuit et al., 1997).

With the exception of InlB and InlC, the internalins carry, at the C-terminal part, another conserved region with a LPXTG motif, which can anchor these proteins to the peptidoglycan of the bacterial cell surface (Gaillard et al., 1991; Dramsi et al., 1997; Raffelsbauer et al., 1998). InlB is anchored via the GW repeat domain to the lipoteichoic acid of the bacterial cell wall (Braun et al., 1997; Jonquieres et al., 1999) and InlC is a small secreted protein without any anchor sequences (Engelbrecht et al., 1996).

The genes inlA and inlB form an operon that is controlled by a complex regulatory region located upstream of inlA containing several promoters and a binding site for the general transcriptional activator of most L. monocytogenes virulence genes, PrfA. PrfA-dependent and -independent expression of the inlAB operon has been shown in vitro (Dramsi et al., 1993; Lingnau et al., 1995; Sheehan et al., 1995; Bohne et al., 1996). Expression of the single inlC gene is strictly dependent on PrfA and seems to occur under extracellular and intracellular conditions (Engelbrecht et al., 1996).

A cluster of inl genes comprising three genes in the order inlG, inlH and inlE, has been identified recently in L. monocytogenes EGD. Expression of these three genes is independent of PrfA and seems to occur predominantly under extracellular conditions (Raffelsbauer et al., 1998). Interestingly, Dramsi and colleagues (1997), using a different L. monocytogenes isolate, identified a different gene cluster, consisting of the genes inlC2, inlD and inlE. This gene cluster is located at the same position on the listerial chromosome as the inlGHE cluster in L. monocytogenes EGD. Sequence analysis revealed that inlH represents a recombination product of inlC2 and inlD, whereas the inlG gene was not localized in the inlC2DE cluster, and inlE is almost identical in both inl gene clusters (Raffelsbauer et al., 1998). InlF has been identified as separate gene in both strains (Dramsi et al., 1997) and our own unpublished results).

Deletion of inlF or the inlC2DE cluster did not reveal an effect on virulence (Dramsi et al., 1997). Deletion of inlC leads to a reduction of L. monocytogenes virulence in the mouse model as it results in an increase in the LD50 after intravenous infection in mice (Engelbrecht et al., 1996). A L. monocytogenes mutant with a deletion in the inlGHE cluster shows a significantly decreased bacterial load in the livers and spleens of orally infected mice (Raffelsbauer et al., 1998). These results provide evidence that InlC, and at least one of the three internalins determined by the inlGHE cluster, act as a virulence factor in a L. monocytogenes infection.

To further study the molecular functions of InlC, InlG, InlH and InlE, we analysed mutants carrying various combinations of in-frame deletions in these internalin genes, in addition to deletions in inlA or inlB, for their ability to adhere to, invade into and spread in the non-phagocytic human endothelial cell line, HBMEC, (Stins et al., 1997) and the enterocyte-like Caco-2 cell line (Bacher et al., 1992). These mammalian cells were used in this study as internalization of L. monocytogenes by HBMECs was previously shown to be dependent on InlB but not on InlA (Greiffenberg et al., 1998), whereas internalization by Caco-2 cells has been reported to be dependent mainly on InlA (Gaillard et al., 1991); however, InlB-induced internalization of L. monocytogenes into Caco-2 cells has been also reported (Lingnau et al., 1995).

The results obtained demonstrate that InlB-induced internalization of L. monocytogenes does not require any of the other internalins, whereas InlA by itself triggers invasion poorly and needs the support of other internalins for efficient internalization of L. monocytogenes by Caco-2 cells. Furthermore, cell-to-cell spread in Caco-2 cell layers is independent of all tested internalins.

Results

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

Construction of deletion mutants carrying combinations of in-frame deletions in the genes encoding InlA, InlB, InlC, InlE, InlG and InlH of L. monocytogenes EGD

We described recently the construction of the ΔinlA, ΔinlB, ΔinlAB and ΔinlB/C mutants (Greiffenberg et al., 1997), the ΔinlC mutant (Engelbrecht et al., 1996) and the ΔinlGHE mutant (Raffelsbauer et al., 1998). To determine the contribution of the previously identified internalins InlA, InlB, InlC, InlG, InlH and InlE to internalization of L. monocytogenes by non-professional phagocytic mammalian cells, we now constructed mutants with in-frame deletions of these inl genes in various combinations, as described in detail in Experimental procedures. In addition, the ΔinlG, ΔinlH and ΔinlE mutants were restored to the wild type by reintroducing the respective inl genes into the chromosome of the mutants. The in-frame deletions, as well as the reversions, were introduced into the chromosome of L. monocytogenes EGD by double crossover using pLSV1-based knock-out or knock-in plasmids as described in Experimental procedures. The correct in-frame deletions and reversions were confirmed by nucleotide sequence analysis. An overview of the mutants indicating the introduced deletions is given in Fig. 1 and Table 1. These mutants were analysed in the following with respect to their internalization by the human microvascular endothelial cell line (HBMEC) and by the human epithelial-like Caco-2 cells.

image

Figure 1. Overview of the deletions that were introduced into the different inl genes on the chromosome of L. monocytogenes EGD. Genes are depicted as arrows and are to scale. Deletions are represented by dashed lines. Mutants with combinations of such deletions were also constructed (see also Table 1 for details).

Download figure to PowerPoint

Table 1. L. monocytogenes strains used in this study.
StrainGenotypeCharacteristicsSource or reference
Sv1/2a EGD wild typeS.H.E. Kaufmann
A76ΔinlAin-frame deletion in inlA Greiffenberg et al. (1997)
WL-111ΔinlBin-frame deletion in inlB Greiffenberg et al. (1997)
ΔinlCΔinlCin-frame deletion in inlC Engelbrecht et al. (1996)
WL-112ΔinlABin-frame deletion in inlAB Greiffenberg et al. (1997)
WL-113ΔinlB/Cin-frame deletion in inlB/C Greiffenberg et al. (1997)
S71ΔinlA/Cin-frame deletion in inlA/CThis study
ΔinlGHE (S14)ΔinlGHEin-frame deletion in inlGHE Raffelsbauer et al. (1998)
S57ΔinlGHEin-frame deletion in inlGHEThis study
S24ΔinlA/GHEin-frame deletion in inlA/GHEThis study
S67Δin B/GHEin-frame deletion in inlB/GHEThis study
S25ΔinlC/GHEin-frame deletion in inlC/GHEThis study
S31ΔinlAB/GHEin-frame deletion in inlAB/GHEThis study
S33ΔinlB/C/GHEin-frame deletion in inlB/C/GHEThis study
S75ΔinlA/C/GHEin-frame deletion in inlA/C/GHEThis study
S54ΔinlGin-frame deletion in inlGThis study
S41ΔinlHin-frame deletion in inlHThis study
S40ΔinlEin-frame deletion in inlEThis study
S62 inlG + in-frame deletion in inlG complemented in cis with inlGThis study
S80 inlH + in-frame deletion in inlH complemented in cis with inlHThis study
S70 inlE + in-frame deletion in inlE complemented in cis with inlEThis study
G10pactA::gfpwild-type strain which expresses gfp intracellularly Bubert et al. (1999)
WL-115ΔinlA/C/GHEin-frame deletion in inlA/C/GHEThis study
 pactA::gfpexpresses gfp intracellularly
WL-116ΔinlB/C/GHEin-frame deletion in inlB/C/GHEThis study
 pactA::gfpexpresses gfp intracellularly
WL-117ΔinlGHEin-frame deletion in inlGHE Raffelsbauer et al. (1998)
 pactA::gfpexpresses gfp intracellularly
WL-118ΔactAin-frame deletion in actA Goetz et al. (2001)
 pactA::gfpexpresses gfp intracellularly

Deletion of the inlGHE gene cluster leads to increased invasiveness of L. monocytogenes in non-phagocytic mammalian cells

To examine whether the recently identified gene cluster consisting of the three internalin genes inlG, inlH, and inlE contributes to internalization of L. monocytogenes by non-phagocytic mammalian cells, we tested early association with and invasion of the ΔinlGHE mutant (Raffelsbauer et al., 1998) derived from the wild-type strain EGD. Adherence of the ΔinlGHE mutant to HBMEC cells was not altered compared with the wild-type strain, but the internalization of this mutant by the endothelial host cells was about threefold higher than that of the wild-type strain (Fig. 2A). Association of the ΔinlGHE strain with Caco-2 cells was significantly enhanced and invasion into these host cells was again increased by a factor of three (Fig. 2B). A similar increase in internalization of the ΔinlGHE mutant was observed in the human hepatocytic cell line HepG-2 and the murine hepatocytic TIB73 cells, whereas phagocytosis of the mutant into J774 macrophages occurred at a similar level as that of the wild-type strain (Fig. 2C).

image

Figure 2. Early association with and invasion into HBMEC (panel A), Caco-2 (panel B) and invasion into J774, TIB73, and HepG2 cells (panel C) of different L. monocytogenes mutants with deletions in the inlGHE cluster alone, or, in combination with deletions in inlA, inlB or inlC. The mean and standard deviation of one representative experiment performed in triplicate is shown. Invasion efficiencies are always compared with the wild-type strain (WT, black column), which is set to 100% invasion. The values for the mutants are presented relative to this strain. White columns are used when the differences from the WT strain are statistically significant (P≤ 0.05); otherwise the columns are grey.

Download figure to PowerPoint

To rule out that this increased invasiveness of the inlGHE mutant may be caused by an additional mutation, we constructed a second ΔinlGHE mutant (designated S57) carrying an identical in-frame deletion of the inlGHE gene cluster and tested again the uptake of this mutant by HBMEC. The results obtained were the same as those obtained with the first inlGHE deletion mutant (data not shown), suggesting that internalization of L. monocytogenes into non-phagocytic cells decreased in the presence of InlG, InlH and InlE (called InlGHE in the following) than in the absence of these internalins.

To examine whether this enhancement in internalization is caused by one of these internalins or by the combination of all three, we tested the internalization of in-frame deletion mutants lacking either inlG, inlH or inlE in HBMEC. As shown in Fig. 3, each single mutant showed a similar increased invasiveness as that of the triple mutant. All three single mutations were subsequently restored with the respective inl gene by homologous recombination. Invasiveness of the two revertant inlH+- and inlE+-strains was decreased to the level of the wild-type strain when tested in HBMEC. The inlG+ revertant strain still showed a somewhat increased invasion that we can not explain at the moment (Fig. 3). These data show that the loss of a single gene of the inlGHE gene cluster affects the invasiveness of L. monocytogenes to a similar extent as the loss of the entire gene cluster, suggesting that the three internalins, InlG, InlH and InlE may either form a functional complex or act in a sequential manner.

image

Figure 3. Invasion of HBMEC by different L. monocytogenes mutants with deletions in the inlGHE cluster (ΔGHE), or in inlG (ΔG), or inlH (ΔH), or inlE (ΔE), together with the respective revertants of the latter three strains inlG+, inlH+ and inlE+ (ΔG + G, ΔH + H and ΔE + E respectively).

Download figure to PowerPoint

Deletion of the inlGHE gene cluster enhances expression of inlA and inlB but not of inlC

One possible reason for the enhanced invasiveness of the inlGHE mutant could be the induced expression of the inlAB operon. Therefore, we tested expression of inlA, inlB and, additionally, inlC, on the transcriptional and translational levels, measuring the amount of the transcripts by semiquantitative RT-PCR and the levels of secreted and cell-bound InlA, InlB and InlC proteins by immunoblotting with the respective polyclonal antisera. As shown in Figs 4 and 5, the level of the inlA and inlB transcripts is enhanced and the amount of InlA and InlB proteins is also increased similarly in the ΔinlGHE mutant when compared with the wild-type strain, whereas expression of inlC on the transcriptional and the translational levels in the inlGHE mutant is similar to that of the wild-type strain.

image

Figure 4. RT-PCR analysis of the transcription of the inlA, inlB and inlC genes in L. monocytogenes mutants with deletions in either the inlGHE cluster or the single inlG, inlH or inlE genes as outlined on the top of the figure. Expression of the superoxide dismutase gene, sod, was used as an internal control. C, chromosomal control amplification; WT, L. monocytogenes EGD wild-type; G+, inlG+ revertant strain; M, marker.

Download figure to PowerPoint

image

Figure 5. Immunoblot analysis of the expression of InlA (panels A and B), InlB (panels C and D) and InlC (panel E) in L. monocytogenes mutants with deletions in the inlGHE cluster and other inl genes. P, total cellular proteins; S, supernatant proteins. The open arrowheads in A and B point to the larger secreted form of InlA, and the filled arrowheads point to the smaller and largely surface-bound form of InlA. All the other smaller bands represent degradation products of InlA as they are all absent in the ΔinlA strain. In C and D, the filled arrowheads mark the position of the InlB protein; the open arrowheads point to an unknown cell wall-associated crossreactive protein that is present in equal amounts in all preparations and hence serves as an internal control.

Download figure to PowerPoint

As previously reported, deletion of inlB also leads to increased expression of InlA (Lingnau et al., 1995). To compare the increase in inlA and inlB expression under the condition of deleted inl genes, we tested the amount of InlA, InlB and InlC proteins under these conditions as well. As shown in Fig. 5 deletion of inlGHE enhances the expression of InlA and InlB to a larger extent than a deletion of either inlA or inlB. Interestingly, no signifi-cant increase in the amount of inlA or inlB transcripts or the amount of InlA and InlB proteins were observed in the single inlG, inlH and inlE mutants (Figs 4 and 5), although internalization of these mutants by HBMEC is clearly enhanced. No effect on expression of the other inl genes was observed in the inlC deletion mutant (Fig. 5).

InlB-triggered internalization of HBMEC is independent of InlA, InlC, InlG, InlH and InlE

To test whether the higher levels of InlA and InlB are solely responsible for the enhanced internalization of the inlGHE mutant by HBMEC and Caco-2 cells, we introduced into the ΔinlA, ΔinlB and ΔinlC mutants additional deletions in inlGHE and tested these mutants again for invasiveness in the two cell types. Deleting the inlGHE locus in the ΔinlA/C mutant resulted in a strain still showing an enhanced internalization by HBMEC cells, indicating that InlB-triggered internalization by HBMEC cells is solely dependent on InlB and does not require the functions of InlA, InlC or InlGHE. The enhanced expression of inlB transcripts observed in the ΔinlGHE mutant may be responsible for the enhanced invasiveness of this mutant. Mutants carrying an intact inlB gene and retaining also the intact inlA or inlC or inlGHE genes or combinations of inlA and inlGHE or inlC and inlGHE are all less efficiently internalized by HBMEC than the mutant which carries inlB but is deleted in the other five internalin genes; the internalization of all of the five former mutants is similar to that of the wild-type strain (Fig. 6A).

image

Figure 6. /b>. Invasion of HBMEC by different L. monocytogenes inl deletion mutants. In panel A, different deletion mutants are shown, which still harbour the inlB gene and are all invasive. In panel B, all mutants lack the inlB gene and are all non-invasive.

Download figure to PowerPoint

Deletion of inlB in any combination with the other inl genes abolishes internalization into HBMEC completely (Fig. 6B). In contrast, early association with these host cells is unaffected by the inlB deletion as described earlier (Greiffenberg et al., 2000) and even the inlAB/GHE mutant adheres to HBMEC cells similarly to the wild-type strain (Fig. 2A), suggesting that early association of L. monocytogenes with these endothelial cells is not significantly affected by any of the tested internalins.

InlA poorly triggers internalization by Caco-2 cells in the absence of InlB, InlC and InlGHE

Internalization of L. monocytogenes by Caco-2 cells has been shown previously to depend mainly on InlA and, to some extent, on InlB (Lingnau et al., 1995). Our data confirm these results as the internalization of deletion mutants lacking inlA and inlB are reduced to less than 1% in comparison to that of the wild-type strain (Fig. 7B). As shown in Fig. 7A, deletion of inlGHE enhances internalization of L. monocytogenes into Caco-2 cells. Additional deletion of inlA and inlC, i.e. presence of InlB in the absence of the other internalins, leads to reduced internalization of about 20% of that of the wild-type strain (Fig. 7A). This residual InlB-triggered internalization into Caco-2 cells is further reduced in the presence of functional InlGHE (Fig. 7A), showing again the negative influence of these internalins on InlB-induced endocytosis. This effect is not caused by a reduction in the amount of InlB as all of these mutants produce similar amounts of inlB transcripts that are higher than the inlB transcripts of the wild-type strain (data not shown).

image

Figure 7. Invasion of Caco-2 by different L. monocytogenes inl deletion mutants. In panel A, different deletion mutants are shown which demonstrate the contribution of InlB to Caco-2 invasion. In panel B, the supportive effect of either InlC alone, or InlC plus InlGHE, or of InlB on the InlA-mediated invasion of Caco-2 cells is shown.

Download figure to PowerPoint

Surprisingly internalization of L. monocytogenes in the presence of InlA, but in the absence of InlB, InlC and InlGHE, is very low (L. monocytogenesΔinlB/C/GHE) (Fig. 7B) although the amount of InlA produced by this inlB/C/GHE mutant is similar to that of the wild-type strain (Fig. 5). When InlG, InlH and InlE are present, together with InlA (ΔinlB/C), internalization is not enhanced, whereas the level of InlA-triggered internalization is clearly higher when InlC is present together with InlA (ΔinlB/GHE); the internalization is further increased in the presence of both InlC and InlGHE (ΔinlB) (Fig. 7). In all these mutants, the amount of InlA is at least as high as that of the wild-type strain (Fig. 5), suggesting that in the absence of InlB, the amount of InlA is not decisive for the level of InlA-induced endocytosis but rather the presence of InlC and InlGHE. Interestingly, InlB together with InlA (in the absence of InlC, InlGHE) yields an invasion level that is considerably higher than the expected sum of the individual InlA- and InlB-mediated internalization levels, suggesting that InlB stimulates InlA-triggered internalization. The internalization is highest in the presence of InlA, InlB and InlC in the absence of InlGHE as already noticed above. Although this mutant (ΔinlGHE) produces enhanced levels of InlA and InlB (Fig. 5), it is more likely that InlB stimulates again InlA-mediated internalization than that the increased level of InlA is responsible for the enhanced internalization.

Taken together, the results suggest that InlA-induced phagocytosis needs the help of InlC, or InlC and InlGHE, or of InlB and the InlB support is further improved by InlC (in the absence of InlGHE).

Whereas the InlA-triggered internalization does not seem to correlate with the amount of InlA produced by the various mutants, the early association with Caco-2 cells correlates with the amount of InlA, i.e. early association is enhanced, as compared with the wild-type strain, with all mutants producing larger amounts of InlA (like the ΔinlGHE mutant) than the wild-type strain and early association is clearly reduced in the absence of InlA (ΔinlA/C/GHE), whereas it is rather independent of the presence of InlB (Fig. 2B).

Cell-to-cell spread within a Caco-2 cell layer is independent of all tested internalins

Listeria monocytogenes can very efficiently spread from one infected host cell into neighbouring cells of the same or of a heterologous cell type (Greiffenberg et al., 1998). It is presently unknown whether listerial components other than ActA (involved in the actin polymerization and actin tail formation, essential for migration of the listeriae into the neighbouring cells (Domann et al., 1992; Kocks et al., 1992) and LLO and PlcB (involved in lysis of the secondary phagosome) (Vazquez-Boland et al., 1992; Gedde et al., 2000) are involved in this step. Possible candidates are the internalins. To test their involvement, we microinjected appropriate mutants that carried deletions in the above mentioned inl genes (L. monocytogenesΔinlGHE, ΔinlA/C/GHE and ΔinlB/C/GHE) into single Caco-2 cells, and monitored the replication and cell-to-cell spread of the mutant bacteria for 20 h. With the previously developed microinjection technique (Goetz et al., 2001), the bacteria were placed directly into the cytosol of mammalian host cells, thus circumventing the inability of some of the mutants to invade Caco-2 cells efficiently. The mutants were labelled with a plasmid carrying the gfp cDNA under the control of the actA promoter, which allows efficient synthesis of the green fluorescent protein (GFP) by the bacteria only in the host cell cytosol (Dietrich et al., 1998). As shown in Fig. 8, cell-to-cell spread of the mutants within the Caco-2 cell layer is as efficient as that observed by the wild-type strain, ruling out the involvement of these six internalins in cell-to-cell spread. In contrast, an actA mutant was unable to spread into neighbouring cells and grew as microcolonies in the initially injected Caco-2 cells (Fig. 8).

image

Figure 8. Cell-to-cell spread of gfp-expressing L. monocytogenes WT, actA and inl mutants upon injection into Caco-2 cells. Cells were microinjected with the following gfp-expressing L. monocytogenes strains: WT, ΔactA, ΔinlGHE, ΔinlA/C/GHE and ΔinlB/C/GHE. Corresponding phase contrast and fluorescence pictures were taken about 20 h post injection and superimposed pictures are shown.

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

In this report, we present evidence that internalization of L. monocytogenes, triggered by the two major invasion proteins InlA and InlB, is more complex than anticipated up to now (Cossart and Lecuit, 1998; Kuhn and Goebel, 2000; Vazquez-Boland et al., 2001). Previous studies using beads coated with purified InlA or InlB proteins (Lecuit et al., 1997; Braun et al., 1998) or non-invasive bacteria expressing these internalins (Gaillard et al., 1991; Lecuit et al., 1997; Braun et al., 1998; Parida et al., 1998) indicated that each of these proteins is sufficient to induce phagocytosis in normally non-phagocytic mammalian cells. This assumption is, clearly, in accord with our observation that deletion of the genes inlA and inlB reduces the ability of L. monocytogenes to penetrate the non-phagocytic mammalian cells, which we tested to a very low background, suggesting that none of the other internalins identified in L. monocytogenes (Engelbrecht et al., 1996; Dramsi et al., 1997; Raffelsbauer et al., 1998) is an invasin by itself.

The present study, which analyses the invasiveness of L. monocytogenes EGD mutants carrying various combinations of deletions in the internalin genes identified in this strain (i.e. inlA, inlB, inlC, inlE, inlG and inlH), demonstrates that InlA- and InlB-mediated internalization is strongly affected by the other internalins. In this study, we used in-frame deletions that removed most of the open reading frames (ORFs) of the various inl genes, but fully retained the 5′-upstream and the 3′-downstream regions of the genes to avoid as much interference as possible with the expression of the undeleted inl genes. Nevertheless, we observed that deletion of inlA leads to a higher expression of inlB and vice versa, as already shown by others (Lingnau et al., 1995). More unexpectedly, expression of inlA and inlB, but not of inlC, is also significantly enhanced upon deletion of the inlGHE gene cluster. What causes the increased expression of inlA and inlB in the absence of inlGHE, which is observed at both the transcriptional and the translational levels, is so far unknown. However, the enhanced internalization of the inlGHE mutant observed by all tested non-phagocytic mammalian cells is not (or at least not exclusively) the result of the enhanced levels of InlA and InlB produced by this mutant, as deletions in either inlG, inlH or inlE result in a similar enhanced internalization to the deletion of the entire gene cluster, yet do not increase the production of InlA and InlB. A further analysis of L. monocytogenes internalization by human microvascular endothelial cells (HBMEC), which is strictly dependent on InlB and independent of InlA (Greiffenberg et al., 1998), revealed that InlGHE suppresses the InlB-mediated internalization. A mutant that retains inlB, but carries deletions in inlA, inlC and inlGHE, still shows a similar enhanced invasiveness as the ΔinlGHE mutant, whereas that of a mutant retaining, in addition to inlB, also inlGHE (carrying deletions in inlA and inlC) is again down to the wild-type level. Both of these mutants (ΔinlA/C/GHE and ΔinlA/C) produce similar enhanced amounts of inlB-specific mRNA (data not shown), showing again that the enhanced invasiveness is not solely the result of the increased amount of InlB. The results rather suggest that InlG, InlH, and InlE may compete with InlB for the same host cell receptor(s), acting either as a complex or in a serial manner. In recent publications, it was shown that InlB can bind to two different molecules, namely gC1qR, the ubiquitous receptor of the complement component C1q (Braun et al., 2000), and Met, a receptor tyrosine kinase whose only known ligand was the hepatocyte growth factor HGF (Shen et al., 2000). Whereas binding of InlB to the latter receptor triggers internalization, the role of the interaction of InlB with C1qR is unknown.

The reported results show that internalization of L. monocytogenes by the enterocyte-like Caco-2 cells, in contrast to endothelial cells, is mediated by both InlA and InlB, as suggested before (Lingnau et al., 1995). Deletion of the inlB gene results in a reduced internalization of about 35% of that of the wild-type strain, whereas the decrease in invasiveness of the inlA deletion mutant is even more pronounced. In the absence of InlA, the residual InlB-mediated internalization is again enhanced by the removal of inlGHE, and even further by the removal of inlGHE and inlC. The opposite effect is observed for InlA-mediated internalization. In the absence of InlB, additional removal of the inlC and inlGHE, or even of inlC alone, leads to a dramatic decrease of invasiveness, although the amount of InlA in the ΔinlB/C/GHE and the ΔinlB/C mutants is as high as in the wild-type strain. These data suggest that InlA alone is inefficient in triggering phagocytosis of Caco-2 cells and needs the support of InlB, or InlC, or InlC plus InlGHE, whereas InlB-mediated phagocytosis is independent of InlC and InlGHE, and seems to be suppressed even by the presence of the latter internalins. Interestingly, in the presence of InlA and InlB, internalization is even higher than in the presence of InlA, InlC and InlGHE, and also higher than expected as a result of the additive invasion increments of InlA and InlB. This co-operative effect of InlA and InlB is further increased by InlC. It is, therefore, intriguing to hypothesize that InlA interacts with InlC to trigger phagocytosis and InlA/InlC-mediated phagocytosis needs, in addition the signals induced in the host cell by either InlB or InlGHE. InlB and InlGHE may compete for the same receptor as discussed above and may trigger similar signals essential for InlA-mediated phagocytosis. Our results would suggest that signalling by InlGHE is less efficient than by InlB.

The reported data further show that not only the amount of InlA and InlB fails to correlate with the efficiency of InlA- and InlB-triggered internalization into HBMEC and Caco-2 cells, but also the InlA- and InlB-mediated early association with these cells. Whereas internalization of L. monocytogenes by HBMEC seems to be strictly dependent on InlB, early association with these cells occurs in the absence of InlB to a similar extent, as in the presence of elevated amounts of InlB, suggesting that early association is mediated by a component other than InlB as shown earlier (Greiffenberg et al., 2000). Previous studies have shown that InlB is not easily accessible on the bacterial surface, a property crucial for a bacterial adhesin; besides InlB is found to a considerable extent in secreted form (Jonquieres et al., 1999). It is, therefore, likely that other bacterial surface structures shown to enhance binding of L. monocytogenes to mammalian cells, such as Ami (Milohanic et al., 2001), p60 (Kuhn and Goebel, 1989), ActA (Alvarez-Dominguez et al., 1997) and p104 (Pandiripally et al., 1999), are required for the interaction of L. monocytogenes with the host cells followed by the specific contact with a phagocytosis-triggering receptor.

In contrast to InlB, increased amounts of InlA lead to increased early association of L. monocytogenes with Caco-2 cells, even in the absence of InlB or of InlC and InlGHE, whereas internalization is at a very low level under these conditions. Likewise, early association with Caco-2 cells decreases in the absence of InlA as also shown before (Milohanic et al., 2001) whereas there is still significant internalization of the inlA deletion mutant by Caco-2 cells via the InlB-mediated pathway. Thus, InlA can act as adhesin but not as invasin without the support of the other internalins. The recent demonstration of the role of InlA in crossing the intestinal barrier (Lecuit et al., 2001) clearly shows the importance of InlA in in vivo epithelial cell invasion. It will be interesting to see whether InlA-dependent crossing of the intestinal barrier is also supported by the other internalins.

None of the studied internalins is required for cell-to-cell spread, indicating that the entry of L. monocytogenes from the primarily infected host cell into the neighbouring cells may be independent of induced phagocytosis triggered by the internalins. Of course, our data do not rule out the involvement of other listerial factors besides ActA, PlcB and LLO in cell-to-cell spread.

In conclusion, the data presented here indicate that the observed modulations in InlA- and InlB-mediated internalization by InlC and InlGHE may be caused by direct interactions of these internalins, and not by increased amounts of InlA and InlB or enhanced early association with the mammalian host cells. According to these results, InlA alone only poorly triggers internalization into Caco-2 cells and needs the support of InlB, or (with a lower efficiency) of InlC and InlGHE. As neither InlC nor InlGHE causes internalization of L. monocytogenes into Caco-2 cells, the latter internalins may either interact directly with InlA to enhance InlA-mediated phagocytosis or may trigger signals essential for InlA-mediated phagocytosis.

InlB-mediated internalization is independent of the other internalins studied and is even inhibited by InlGHE, suggesting competition of these individual internalins, (or of a putative complex formed by these internalins) with InlB for a common receptor. We are currently investigating possible interactions of InlC and InlGHE with the InlA- and InlB-mediated internalization pathways.

Experimental procedures

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

Bacterial strains, media, plasmids and growth conditions

Bacterial strains used in this study are listed in Table 1. Deletion and reversion mutant strains were constructed as described here or in the given references. Listeria monocytogenes strains were grown aerobically in brain–heart infusion broth (BHI; Difco Laboratories) at 37°C, except strains containing pLSV1 (Wuenscher et al., 1991) vector derivatives, which were grown at either 30°C or 42°C in the presence of 5 μg ml–1 of erythromycin. For the growth of L. monocytogenes strains containing pLSV16-PactA-gfp (Raffelsbauer et al., 1998; Bubert et al., 1999), tetracycline was added to liquid media, to a final concentration of 4 μg ml–1. To prepare bacteria aliquots for infection assays and to isolate RNA and proteins, overnight cultures of L. monocytogenes strains were diluted 1:25 in BHI and grown to the desired optical densities. Escherichia coli strains containing pUC18 (Amersham Pharmacia Biotech) or pLSV1 vector derivatives were grown in 2× YT broth (Gibco) at 37°C in the presence of 100 μg ml–1 of ampicillin or 400 μg ml–1 of erythromycin respectively. The pLSV1-based mutagenic vectors, pLSVΔinlGHE, pLSVΔinlC, pLSVΔinlG, pLSVΔinlH, pLSVΔinlE, pLSVinlG, pLSVinlH and pLSVinlE, were constructed in this study as described below.

Polymerase chain reaction, cloning and nucleotide sequencing

Chromosomal and plasmid DNA of L. monocytogenes was amplified by polymerase chain reaction (PCR) according to standard procedures using Taq DNA polymerase (Q-Biogene), the Expand High Fidelity PCR system enzyme mix (Roche Diagnostics) or Deep Vent DNA polymerase (New England Biolabs). Oligonucleotides used in this study are listed in Table 2 and were purchased from MWG-Biotech (Ebersberg) or ARK Scientific GmbH (Germany). For cloning purposes, restriction sites were inserted in some primers. Molecular cloning was performed as described in standard protocols (Sambrook et al., 1989) or as recommended by the manufacturers of the commercial kits used. PCR products were purified using the QIAquick PCR purification kit (Qiagen), the GFX PCR DNA and gel band purification kit (Amersham Pharmacia Biotech) or the NucleoTrap extraction kit (Macherey–Nagel). After purification, the obtained PCR products were digested with appropriate restriction enzymes and then ligated into pUC18 or pLSV1 with T4 DNA ligase (Life Technologies). Escherichia coli DH5α was used as the cloning host for construction, analysis and amplification of all vectors used in this work. Plasmids were introduced into E. coli by transformation after MgSO4 treatment. For PCR screening, cell lysates from E. coli were prepared by incubating bacteria in 50 μl of dH2O for 10 min at 110°C. For restriction and nucleotide sequence analysis, E. coli plasmid DNA was isolated by using the commercial kits QIAprep spin plasmid kit (Qiagen), the Quantum Prep Plasmid Miniprep kit (Bio-Rad Laboratories) or the NucleoBond PC 100 kit (Macherey-Nagel). Plasmids were introduced into L. monocytogenes strains by electroporation as previously described (Alexander et al., 1990). The nucleotide sequence of obtained PCR products was verified by sequencing either the purified products directly, or after cloning into pUC18 or pLSV1 using the ABI PRISM dRhodamine terminator cycle sequencing ready reaction kit (Perkin Elmer).

Table 2. Oligonucleotides used in this study.
NameSequence (5′[RIGHTWARDS ARROW]3′)
delxy-3AACTAATTCCCGGGATAGCTGTCAC
delxy-4CGGAATTGGCCCGGGTTTATTCCGC
delxy-6bCGTTACTGGATCCAATTTCGCTTAC
InlC-1bAAACATCTCGGATCCTTGCTAACATATAAG
InlC-2bTTTGTCAAGAATTCATTAAGACTTAC
lisminv-1CCACACCTTGGATCCTCGTTACATATAGG
mutrevG-1TTTACGCGAATTCCCACAAGAAACC
delG-1GCTTTTCATCCCGGGTGCAATACTAATC
delH-1TCATCGGAGGATCCATACTAATCTTACG
delH-2CCTCCACACCCGGGCTTGTCGTTAC
delH-3GATTTTTATCCCGGGTTTCTTGCTAGG
delH-4AGTGACTAGGATCCTTAATGCTGTTTTG
delE-1TAGGAACAGGGATCCTAATTCTCCGC
delE-2TTAATAGGGCCCGGGTGTTCAATCACC
lism51–14TCTCTATAAAGGCAAACTCC
RTA2downCTAGTTAAACCTGAAAGCGC
RTB2downAGTTAAACGTGAAAGAACCG
RTC2downTTACCATGCAAATCTAATAC
SOD-CGTTCCCAAACATCTAAGCC
RTA1upATATTAGTATTTGGCAGCGG
RTB1upTGTTTAATCTCAGGTTTAGC
RTC1upTGTTAATTGTAGGTCTGTGC
SOD-NCTTATGATGCTTTGGAGCCG

Isolation of L. monocytogenes chromosomal and plasmid DNA

Chromosomal DNA was isolated from L. monocytogenes strains basically as described previously (Engelbrecht et al., 1996) or by using 0.5 ml of DNAzol Reagent (Life Technologies) as recommended by the manufacturer after treatment of bacteria from 3 ml of overnight culture with 1 mg of lysozyme (Merck) for 30 min at 37°C. For screening of L. monocytogenes strains by PCR, cell lysates were prepared as follows: bacteria were suspended in 50 μl of polymerase buffer (Q-Biogene). Approximately 0.2 mg of lysozyme was added and bacterial suspensions were incubated 15 min at 37°C. After addition of 15 μg of proteinase K (Merck), samples were incubated for a further 10–20 min at 55°C, and then for 10 min at 105°C. Cell debris was pelleted by centrifugation.

Construction of L. monocytogenes mutant strains

The mutant strains listed in Table 1, carrying an in-frame deletion in the inlGHE gene locus, were constructed from the parental strains L. monocytogenes EGD wild type, ΔinlA, ΔinlB, ΔinlC, ΔinlAB and ΔinlB/C by double crossover, using the temperature-sensitive shuttle vector pLSVΔinlGHE as described essentially in Raffelsbauer et al. (1998) for the L. monocytogenes wild-type strain. Integration of the vector into the chromosome by homologous recombination was induced by incubating bacteria at 42°C in the presence of erythromycin. Obtained clones were screened by PCR. The second crossover leading to the excision of the vector and wild-type sequence from the chromosome was accomplished by subculturing a selected single crossover mutant in BHI at 30°C in the absence of erythromycin. Appropriate sensitive clones were analysed by PCR screening for the deletion of inlGHE.

The remaining mutant strains were obtained by using the same strategy applied for the construction of the ΔinlGHE deletion mutants (Raffelsbauer et al., 1998). The mutant strains L. monocytogenesΔinlA/C and L. monocytogenesΔinlA/C/GHE were constructed by deleting the inlC gene from the L. monocytogenes mutants ΔinlA and ΔinlA/GHE respectively. A 243-bp-long truncated inlC gene carried by the strain L. monocytogenesΔinlC (Engelbrecht et al., 1996) was amplified by PCR using the primer pairs InlC-1b/InlC-2b, and cloned into pLSV1 via the restriction sites BamHI and EcoRI, which were inserted in the primers. Selection of positive clones after electroporation, vector integration into the chromosome and deletion of the inlC gene were performed by PCR screening using appropriate primers.

The single deletion mutants L. monocytogenesΔinlG, ΔinlH and ΔinlE were constructed by deleting the corresponding genes from the strain L. monocytogenes EGD wild type. To generate homology fragments for deletion of inlG (GA and GB), inlH (HA and HB) and inlE (EA and EB), the following primer pairs were used: GA (mutrevG-1/delxy-3), GB (delG-1 lisminv-1), HA (delH-1/delH-2), HB (delH-3/delH-4), EA (delE-1/delE-2) and EB (delxy-4/delxy-6b). These fragments were cut with PspA1 and ligated to yield the fragments GAGB, HAHB and EAEB, respectively, which were amplified in subsequent PCRs using the corresponding external primers. The obtained fragments were cloned into pLSV1 via EcoRI (GAGB) or BamHI (HAHB and EAEB) restriction sites, resulting in the knock-out plasmids pLSVΔinlG, pLSVΔinlH and pLSVΔinlE respectively. To construct pLSV1-based knock-in vectors to complement the single mutants L. monocytogenesΔinlG, ΔinlH and ΔinlE with a copy of the corresponding gene integrated into the chromosome, and thus revert these mutants to the wild-type genotype, the genes inlG, inlH and inlE were amplified from L. monocytogenes wild-type chromosomal DNA using the same external primers used for the construction of the deletion strains, i.e. mutrevG-1 lisminv-1 for inlG, delH-1/delH-4 for inlH and delE-1/delxy-6b for inlE. The obtained products were cloned into pLSV1 via EcoRI (inlG) or BamHI (inlH and inlE) restriction sites, yielding the knock-in plasmids pLSVinlG, pLSVinlH and pLSVinlE. Selection of positive clones after electroporation, chromosomal integration of the vector and allelic exchange on the chromosome was performed using erythromycin as selection marker and by PCR screening with appropriate primers. The correct in-frame deletions and reversions of all recombinant strains were confirmed by nucleotide sequence analysis of the obtained PCR products.

Cell culture, cellular association, invasion and intracellular growth assays

All cells used in this study were cultivated at 37°C in a humid atmosphere of 5% CO2, according to standard methods. Cells of the cell lines Caco-2, J774 and TIB73 were cultured in RPMI 1640 medium (Life Technologies) supplemented with 10% heat-inactivated fetal calf serum (FCS; Life Technologies). For the culture of HepG-2 cells, a complete HepG-2 medium (MEM supplemented with 10% FCS, 1% non-essential amino acids and 1% sodium pyrovate) was used. Human brain microvascular endothelial cells (HBMEC) were cultured in complete HBMEC medium on gelatine-coated plates as described previously (Stins et al., 1997; Greiffenberg et al., 1998). Bacteria used for infection were grown to the mid-log phase (180 Klett units), harvested by centrifugation, washed twice with PBS and then stored in aliquots in PBS with 20% glycerol (v/v) at –80°C. For cellular invasion assays, cells were seeded 24 h before infection into 24-well tissue culture plates or 60 mm diameter plates. The cell densities immediately before the assays were 4–105 cells per well (HBMEC), 3 × 105 (HepG-2 and Caco-2) and 1 × 106 (TIB73) or 6 × 106 (J774). To reach the desired multiplicity of infection (MOI), appropriate volumes of the bacteria were diluted in RPMI 1640 medium (for infection of HBMEC, Caco-2, TIB73 and J774) or in MEM (HepG-2) and the bacterial suspensions (2 ml per plate or 0.5 ml per well) were added to each monolayer. Cells were infected for either 45 min (J774), or 60 min (Caco-2, HBMEC, TIB73, and HepG2) at variable MOIs of 2–5 (for J774), 10–20 (Caco-2), 20 (HBMEC and HepG-2) or 30 (TIB73) bacteria per cell. After infection, the monolayers were washed twice with PBS and overlaid with complete media containing gentamicin (100 μg ml–1) to kill extracellular bacteria. After 1 h of incubation, monolayers were again washed twice with PBS and cells were lysed by addition of ice-cold distilled water and sonicated three times, for 1 s, with a Branson sonifier. The number of intracellular bacteria was determined by plating appropriate serial dilutions of the cell lysates on BHI plates. For early association assays, HBMEC or Caco-2 cells were infected as described above for 35 min and then the monolayers were washed five times with PBS before being lysed, and associated bacteria (mostly adherent ones and also those already internalized) were counted as described above. All cellular association and invasion assays were performed in triplicate and repeated at least three times. For statistical analysis, the two-tailed, unpaired Student’s t-test was applied and P-values of ≤ 0.05 were considered as statistically significant. Invasion and early association efficiencies are always compared with the wild-type strain (WT, black column) that is set to 100% invasion or association. The values for the mutants are presented relative to the EGD strain. White columns are used when the differences to the WT strain are statistically significant; otherwise the columns are grey. The absolute number of invading bacteria of the L. monocytogenes EGD wild-type strain was between 0.5 and 2.0% of the inoculum for Caco-2 cells and HBMEC.

Isolation of L. monocytogenes RNA and semiquantitative RT-PCRs

To study transcription of the genes inlA, inlB and inlC, L. monocytogenes cells were lysed using a fast method recently described by Dietrich et al. (2000) and RNA was isolated using the EZNA Bacterial RNA Kit (PEQLAB Biotechnologie) according to the instructions of the supplier, with the following modifications: L. monocytogenes strains were grown to an optical density of 1.0 at 600 nm; 3 ml of each culture was centrifuged and bacteria were stored at –80°C for 2 h. Bacterial pellets were resuspended in 200 μl of BRL buffer (PEQLAB), then 1 ml of lysis buffer TRK (PEQLAB) containing 2%β-mercaptoethanol was added. Cell suspensions were transferred to FastRNA BLUE Tubes (BIO 101) and processed for 2 × 45 s at speed 6.5 in a FastPrep FP120 Shaker (BIO 101-Savant Instruments). The tubes were centrifuged for 1 min at 8.000 g and 4°C. Supernatants were transferred to Eppendorf tubes, 0.8 vol. of ethanol was added and solutions were applied to a HiBind column (PEQLAB). The RNA was then bound to the column, washed, dried and eluted in 2× 100 μl RNase-free H2O as recommended by the manufacturer. RNA aliquots were stored at –80°C. To remove remaining DNA, RNA aliquots were treated with RNase-free DNase (Amersham Pharmacia Biotech) and the complete DNA digestion was confirmed by PCR using samples of the RNA aliquots before the reverse transcription as template. Reverse transcription (RT) was performed with the ProSTAR First-Strand RT-PCR Kit (Stratagene) according to the instructions of the supplier using the Moloney Murine Leukaemia Virus reverse transcriptase and 5 μg total RNA as template. For synthesis of 1st-strand cDNA, we used the oligonucleotides RTA2down (inlA), RTB2down (inlB), RTC2down (inlC) and SOD-C (sod) (for sequences see Table 2). For subsequent amplification of the cDNA by PCR, we used RTA1up (inlA), RTB1up (inlB), RTC1up (inlC) and SOD-N (sod), together with the aforementioned primers. Oligonucleotides specific for the inlA, inlB, inlC, and sod genes were designed after nucleotide sequence analysis using programmes of the HUSAR resource (German Cancer Research Center). The specificity of the designed primers was verified in control PCRs using chromosomal DNA as a template.

Protein isolation and Western blot analysis

For isolation of supernatant and cell surface proteins, L. monocytogenes strains were grown to the log phase to optical densities of 220 Klett units. Bacterial cells were pelleted, the supernatants were centrifuged once again and precipitated with ice-cold 10% trichloracetic acid (TCA) overnight. Precipitated supernatant proteins were then harvested by centrifugation, washed once with acetone, dried on ice and resuspended in Laemmli sample buffer (Laemmli, 1970). For analysis of total cellular proteins, bacterial pellets were washed once with PBS and resuspended in Laemmli sample buffer. All proteins were incubated for 20 min at 100°C before separation by SDS-polyacrylamide gel electrophoresis (SDS–PAGE). For immunoblot analysis, proteins were transferred to nitrocellulose membranes, the membranes blocked with skimmed milk (5%) in PBS and incubated with specific polyclonal antibodies raised against either InlA, InlB (Parrida et al., 1998) or InlC (F. Engelbrecht, J. Daniels, S. Hom and W. Goebel, unpublished results) and used at dilutions of 1:1000 (anti-InlC) or 1:2000 (anti-InlA and anti-InlB) in PBS. The membranes were washed with PBS and incubated with a horseradish-peroxidase-coupled secondary antibody (Dianova) and developed using the ECL Kit (Amersham Pharmacia Biotech) as recommended.

Construction of gfp-expressing L. monocytogenes mutants and microinjection into Caco-2 cells

The L. monocytogenes WT strain and the ΔinlGHE strain expressing the gfp-cDNA under the control of the actA promoter were described recently (Raffelsbauer et al., 1998). For construction of the ΔinlA/C/GHE, ΔinlB/C/GHE and ΔactA strains expressing gfp, the respective in-frame deletion mutants were transformed with the gfp-expression plasmid pLSV16-PactA-gfp (Raffelsbauer et al., 1998; Bubert et al., 1999). The microinjection procedure applied to inject gfp-expressing L. monocytogenes strains into Caco-2 cells was described recently (Goetz et al., 2001). In brief, Caco-2 cells, grown to subconfluency and kept in the presence of 10 μg ml–1 of gentamicin, were injected with single bacteria in PBS with an Eppendorf microinjection device (Eppendorf). After injecting about 50 individual cells, the monolayers were washed, incubated in medium containing 50 μg ml–1 of gentamicin for 30 min and then incubated further in the presence of 15 μg ml–1 of gentamicin. The gfp-expressing intracellular bacteria were visualized 24 h later with a fluorescence equipped inverted microscope (Leica Microsystems) and pictures were taken with an electronic camera (Princeton Instruments). Digital images were processed using the software packages METAMORPH (Universal Imaging Corporation) and PHOTOSHOP (Adobe Systems).

Enzymes and molecular weight standards

DNA modifying enzymes were purchased from Amersham Pharmacia Biotech (Freiburg, Germany), Life Technologies (Karlsruhe, Germany), New England Biolabs (Schwalbach, Germany), Roche Diagnostics (Mannheim, Germany) and Stratagene (La Jolla, CA, USA). AMV reverse transcriptase was obtained from Stratagene. Enzymes were used as recommended by the manufacturers or as described in standard protocols (Sambrook et al., 1989).

Computer sequence analysis

For computational analyses of nucleotide and peptide sequence data, we used the program package CLONEMANAGER (Scientific and Educational Software), the program package of the Genetics Computer Group (GCG) of the University of Wisconsin, USA, or the HUSAR resource provided by the German Cancer Research Center, Heidelberg, Germany.

Acknowledgements

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

We thank K.-S. Kim for the microvascular endothelial cells, J. Wehland for the anti-InlA and anti-InlB antisera, F. Engelbrecht and J. Daniels for the anti-InlC antiserum, S. Altrock for help with the RT-PCR method, and A. Spory, L. Greiffenberg and I. Karunasagar for the communication of preliminary results of invasion assays with some of the L. Monocytogenes mutants described here.

This work was supported by the Deutsche Forschungsgemeinschaft by grants SFB 479-B1 (WG), GO168/24 (WG and MK) and by the Fonds der Chemischen Industrie (WG).

References

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References
  • Alexander , J.E. , Andrew , P.W. , Jones , D. , and Roberts , I.S. ( 1990 ) Development of an optimized system for electro-poration of Listeria species. Lett Appl Microbiol 10 : 179 181 .
  • Alvarez-Dominguez , C. , Vazquez-Boland , J.A. , Carrasco-Marin , E. , Lopez-Mato , P. , and Leyva-Cobian , F. ( 1997 ) Host cell heparan sulfate proteoglycans mediate attachment and entry of Listeria monocytogenes, and the listerial surface protein ActA is involved in heparan sulfate receptor recognition. Infect Immun 65 : 7888 .
  • Bacher , A. , Griebl , K. , Mackamul , S. , Mitreiter , R. , Muckter , H. , and Ben-Shaul , Y. ( 1992 ) Protease inhibitors suppress the formation of tight junctions in gastrointestinal cell lines. Exp Cell Res 200 : 97104 .
  • Bohne , J. , Kestler , H. , Uebele , C. , Sokolovic , Z. , and Goebel , W. ( 1996 ) Differential regulation of the virulence genes of Listeria monocytogenes by the transcriptional activator PrfA. Mol Microbiol 20 : 11891198 .
  • Braun , L. , Dramsi , S. , Dehoux , P. , Bierne , H. , Lindahl , G. , and Cossart , P. ( 1997 ) InlB: an invasion protein of Listeria monocytogenes with a novel type of surface association. Mol Microbiol 25 : 285294 .
  • Braun , L. , Ghebrehiwet , B. , and Cossart , P. ( 2000 ) gC1q-R/p32, a C1q-binding protein, is a receptor for the InlB invasion protein of Listeria monocytogenes. EMBO J 19 : 14581466 .
  • Braun , L. , Nato , F. , Payrastre , B. , Mazie , J.C. , and Cossart , P. ( 1999 ) The 213-amino-acid leucine-rich repeat region of the Listeria monocytogenes InlB protein is sufficient for entry into mammalian cells, stimulation of PI 3-kinase and membrane ruffling. Mol Microbiol 34 : 1023 .
  • Braun , L. , Ohayon , H. , and Cossart , P. ( 1998 ) The InIB protein of Listeria monocytogenes is sufficient to promote entry into mammalian cells. Mol Microbiol 27 : 1077 1087 .
  • Bubert , A. , Sokolovic , Z. , Chun , S.-K. , Papatheodorou , L. , Simm , A. , and Goebel , W. ( 1999 ) Differential expression of Listeria monocytogenes virulence genes in mammalian host cells. Mol Gen Genet 261 : 323336 .
  • Cossart , P. , and Lecuit , M. ( 1998 ) Interactions of Listeria monocytogenes with mammalian cells during entry and actin-based movement: bacterial factors, cellular ligands and signaling. EMBO J 17 : 37973806 .
  • Dietrich , G. , Bubert , A. , Gentschev , I. , Sokolovic , Z. , Simm , A. , Catic , A., et al. ( 1998 ) Delivery of antigen-encoding plasmid DNA into the cytosol of macrophages by attenuated suicid Listeria monocytogenes. Nat Biotechnol 16 : 181185 .
  • Dietrich , G. , Schaible , U.E. , Diehl , K.D. , Mollenkopf , H. , Wiek , S. , Hess , J., et al. ( 2000 ) Isolation of RNA from mycobacteria grown under in vitro and in vivo conditions. FEMS Microbiol Lett 186 : 177180 .
  • Domann , E. , Wehland , J. , Rohde , M. , Pistor , S. , Hartl , M. , Goebel , W., et al. ( 1992 ) A novel bacterial virulence gene in Listeria monocytogenes required for host cell interaction with homology to the proline-rich region of vinculin. EMBO J 11 : 19811990 .
  • Dramsi , S. , Biswas , I. , Maguin , E. , Braun , L. , Mastroeni , P. , and Cossart , P. ( 1995 ) Entry of Listeria monocytogenes into hepatocytes requires expression of InIB, a surface protein of the internalin multigene family. Mol Microbiol 16 : 251261 .
  • Dramsi , S. , Dehoux , P. , Lebrun , M. , Goossens , P.L. , and Cossart , P. ( 1997 ) Identification of four new members of the internalin multigene family of Listeria monocytogenes EGD. Infect Immun 65 : 16151625 .
  • Dramsi , S. , Kocks , C. , Forestier , C. , and Cossart , P. ( 1993 ) Internalin-mediated invasion of epithelial cells by Listeria monocytogenes is regulated by the growth state, temperature and the pleiotropic activator PrfA. Mol Microbiol 9 : 931941 .
  • Engelbrecht , F. , Chun , S.-K. , Ochs , C. , Hess , J. , Lottspeich , F. , Goebel , W. , and Sokolovic , Z. ( 1996 ) A new PrfA-regulated gene of Listeria monocytogenes encoding a small, secreted protein which belongs to the family of internalins. Mol Microbiol 21 : 823837 .
  • Finlay , B.B. , and Cossart , P. ( 1997 ) Exploitation of mammalian host cell functions by bacterial pathogens. Science 276 : 718725 .
  • Gaillard , J.L. , Berche , P. , Frehel , C. , Gouin , E. , and Cossart , P. ( 1991 ) Entry of L. monocytogenes into cells is mediated by internalin, a repeat protein reminiscent of surface antigens from Gram-positive cocci. Cell 65 : 11271141 .
  • Gedde , M.M. , Higgins , D.E. , Tilney , L.G. , and Portnoy , D.A. ( 2000 ) Role of listeriolysin O in cell-to-cell spread of Listeria monocytogenes . Infect Immun 68 : 9991003 .
  • Goetz , M. , Bubert , A. , Wang , G. , Chico-Calero , I. , Vazquez-Boland , J.-A. , Beck , M., et al. ( 2001 ) Microinjection and growth of bacteria in the cytosol of mammalain host cells. Proc Natl Acad Sci USA 98 : 1222112226 .
  • Greiffenberg , L. , Goebel , W. , Kim , K.-S. , Daniels , J. , and Kuhn , M. ( 2000 ) Interaction of Listeria monocytogenes with human brain microvascular endothelial cells: an electron microscopic study. Infect Immun 68 : 32753279 .
  • Greiffenberg , L. , Goebel , W. , Kim , K.-S. , Weiglein , I. , Bubert , A. , Engelbrecht , F., et al. ( 1998 ) Interaction of Listeria monocytogenes with human brain microvascular endothelial cells: InlB-dependent invasion, long-term intracellular growth, and spread from macrophages to endothelial cells. Infect Immun 66 : 52605267 .
  • Greiffenberg , L. , Sokolovic , Z. , Schnittler , H.J. , Spory , A. , Böckmann , R. , Goebel , W. , and Kuhn , M. ( 1997 ) Listeria monocytogenes-infected human umbilical vein endothelial cells: internalin-independent invasion, intracellular growth, movement and host cell responses. FEMS Microbiol Lett 157 : 163170 .
  • Jonquieres , R. , Bierne , H. , Fiedler , F. , Gounon , P. , and Cossart , P. ( 1999 ) Interaction between the protein InlB of Listeria monocytogenes and lipoteichoic acid: a novel mechanism of protein association at the surface of Gram-positive bacteria. Mol Microbiol 34 : 902914 .
  • Kobe , B. , and Deisenhofer , J. ( 1994 ) The leucine-rich repeat: a versatile binding motif. Trends Biochem Sci 19 : 415421 .
  • Kobe , B. , and Deisenhofer , J. ( 1995 ) Proteins with leucine-rich repeats. Curr Opin Struct Biol 5 : 409416 .
  • Kocks , C. , Gouin , E. , Tabouret , M. , Berche , P. , Ohayon , H. , and Cossart , P. ( 1992 ) L. monocytogenes-induced actin assembly requires the actA gene product, a surface protein. Cell 68 : 521531 .
  • Kuhn , M. , and Goebel , W. ( 1989 ) Identification of an extracellular protein of Listeria monocytogenes possibly involved in intracellular uptake by mammalian cells. Infect Immun 57 : 5561 .
  • Kuhn , M. , and Goebel , W. ( 2000 ) Internalization of Listeria monocytogenes by nonprofessional and professional phagocytes. Subcell Biochem 33 : 411436 .
  • Laemmli , U.K. ( 1970 ) Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227 : 680685 .
  • Lecuit , M. , Ohayon , H. , Braun , L. , Mengaud , J. , and Cossart , P. ( 1997 ) Internalin of Listeria monocytogenes with an intact leucine-rich repeat region is sufficient to promote internalization. Infect Immun 65 : 53095319 .
  • Lecuit , M. , Vandormael-Pournin , S. , Lefort , J. , Huerre , M. , Gounon , P. , Dupuy , C., et al. ( 2001 ) Transgenic model for listeriosis: role of internalin in crossing the intestinal barrier. Science 292 : 17221725 .
  • Lingnau , A. , Domann , E. , Hudel , M. , Bock , M. , Nichterlein , T. , Wehland , J. , and Chakraborty , T. ( 1995 ) Expression of the Listeria monocytogenes EGD inlA and inlB genes, whose products mediate bacterial entry into tissue culture cell lines, by PrfA-dependent and -independent mechanisms.Infect Immun 63 : 38963903 .
  • Marino , M. , Braun , L. , Cossart , P. , and Ghosh , P. ( 1999 ) Structure of the lnlB leucine-rich repeats, a domain that triggers host cell invasion by the bacterial pathogen L. monocytogenes. Mol Cell 4 : 10631072 .
  • Marino , M. , Braun , L. , Cossart , P. , and Ghosh , P. ( 2000 ) A framework for interpreting the leucine-rich repeats of the Listeria internalins. Proc Natl Acad Sci USA 97 : 87848788 .
  • Milohanic , E. , Jonquieres , R. , Cossart , P. , Berche , P. , and Gaillard , J.L. ( 2001 ) The autolysin Ami contributes to the adhesion of Listeria monocytogenes to eukaryotic cells via its cell wall anchor. Mol Microbiol 39 : 12121224 . DOI: 10.1046/j.1365-2958.2001.02208.x
  • Pandiripally , V.K. , Westbrook , D.G. , Sunki , G.R. , and Bhunia , A.K. ( 1999 ) Surface protein p104 is involved in adhesion of Listeria monocytogenes to human intestinal cell line, Caco-2. J Med Microbiol 48 : 117124 .
  • Parida , S.K. , Domann , E. , Rohde , M. , Müller , S. , Darji , A. , Hain, T et al. ( 1998 ) Internalin B is essential for adhesion and mediates the invasion of Listeria monocytogenes into human endothelial cells. Mol Microbiol 28 : 8193 .
  • Raffelsbauer , D. , Bubert , A. , Engelbrecht , F. , Scheinpflug , J. , Simm , A. , Hess , J., et al. ( 1998 ) The gene cluster inlC2DE of Listeria monocytogenes contains additional new internalin genes and is important for virulence in mice. Mol Gen Genet 260 : 144158 .
  • Sambrook , J. , Frisch , E.F. , and Maniatis , T. ( 1989 ) Molecular Cloning: a Laboratory Manual , 2nd Edn. Cold Spring Harbor, New York : Cold Spring Harbor Laboratory Press .
  • Sheehan , B. , Klarsfeld , A. , Msadek , T. , and Cossart , P. ( 1995 ) Differential activation of virulence gene expression by PrfA, the Listeria monocytogenes virulence regulator. J Bacteriol 177 : 64696476 .
  • Shen , Y. , Naujokas , M. , Park , M. , and Ireton , K. ( 2000 ) InIB-dependent internalization of Listeria is mediated by the Met receptor tyrosine kinase. Cell 103 : 501510 .
  • Stins , M.F. , Gilles , F. , and Kim , K.-S. ( 1997 ) Selective expression of adhesion molecules on human brain microvascular endothelial cells. J Neuroimmunol 76 : 8190 .
  • Vazquez-Boland , J.-A. , Kocks , C. , Dramsi , S. , Ohayon , H. , Geoffroy , C. , Mengaud , J. , and Cossart , P. ( 1992 ) Nucleotide sequence of the lecithinase operon of Listeria monocytogenes and possible role of lecithinase in cell-to-cell spread. Infect Immun 60 : 219230 .
  • Vazquez-Boland , J.-A. , Kuhn , M. , Berche , P. , Chakraborty , C. , Dominguez-Bernal , G. , Goebel , W., et al. ( 2001 ) Listeria pathogenesis and molecular virulence determinants. Clin Microbiol Rev 14 : 584640 .
  • Wuenscher , M.D. , Köhler , S. , Goebel , W. , and Chakraborty , T. ( 1991 ) Gene disruption by plasmid integration in Listeria monocytogenes: insertional inactivation of the listeriolysin determinant lisA . Mol Gen Genet 228 : 177182 .