SEARCH

SEARCH BY CITATION

Summary

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

The human pathogen Helicobacter pylori colonizes the mucous layer of the stomach. During parasitic infection, freely swimming bacteria adhere to the gastric epithelial cells and trigger intracellular signalling pathways. This process requires the translocation of the effector protein CagA into the host cell through a specialized type IV secretion system encoded in the cag pathogenicity island. Following transfer, CagA is phosphorylated on tyrosine re-sidues by a host cell kinase. Here, we describe how the tyrosine phosphorylation of CagA is restricted to a previously identified repeated sequence called D1. This sequence is located in the C-terminal half of the protein and contains the five-amino-acid motif EPIYA, which is amplified by duplications in a large fraction of clinical isolates. Tyrosine phosphorylation of CagA is essential for the activation process that leads to dramatic changes in the morphology of cells growing in culture. In addition, we observed that two members of the src kinases family, c-Src and Lyn, account for most of the CagA-specific kinase activity in host cell lysates. Thus, CagA translocation followed by tyrosine phosphorylation at the EPIYA motifs promotes a growth factor-like response with intense cytoskeletal rearrangements, cell elongation effects and increased cellular motility.


Introduction

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

Helicobacter pylori colonizes the antrum and the corpus of the gastric mucosa and its presence is associated with severe pathologies such as peptic ulcer disease (PUD), mucosa-associated lymphoid tissues (MALT) lymphoma and antral adenocarcinoma. We have suggested the circulation of two major groups of H. pylori in the human population: the highly attenuated commensal-like strains (type II), which are associated with asymptomatic infections (chronic non-active gastritis and superficial gastritis), and virulent strains, which possess a 40 kbp pathogenicity island (PAI) integrated in the chromosome at the glutamate racemase locus (type I) (Censini et al., 1996). Encoded in the cag PAI are the immunodominant CagA antigen and a type IV secretion system (Covacci et al., 1993; Censini et al., 1996). Several groups have independently shown that this secretion system is responsible for translocation of CagA into the host cell (Segal et al., 1999a; Asahi et al., 2000; Backert et al., 2000; Odenbreit et al., 2000; Stein et al., 2000). Mutants in most of the cag genes are defective for CagA translocation and for induction of interleukin 8 (IL-8) secretion (Tummuru et al., 1995; Censini et al., 1996; Glocker et al., 1998; Sharma et al., 1998). Once CagA has been injected it is then phosphorylated on tyrosines and is found to be associated with the membrane and with the insoluble fractions (Stein et al., 2000). Although the nature of the kinase remained unknown it was reported that (i) host cell lysates, (ii) purified epidermal growth factor receptor kinase (EGFR-kinase), and (iii) purified c-Src kinase are able to tyrosine phosphorylate CagA in vitro (Asahi et al., 2000).

Herein we provide experimental evidence that the tyrosine phosphorylation sites are located within the EPIYA motif, which is present in two copies in the carboxy-terminal half of CagA and as motif D1 within a 102 bp repeated region (Covacci et al., 1993). The number of copies of the repeated region is strain-specific: size variability of CagA ranges from 128 kDa (absence of 102 bp repeat) to 144 kDa (four 102 bp repeats in tandem). We also demonstrate that CagA molecules lacking the EPIYA motifs are translocated, but not phosphorylated. Unlike the parental strain the mutants failed to induce signalling events that govern cellular reshaping and suggest that tyrosine phosphorylation is critical for CagA activation. In order to identify the kinases respon-sible for this phosphorylation we used small-molecule tyrosine kinase inhibitors in combination with co-immunoprecipitation methodology. We provide evidence that the tyrosine kinases c-Src and Lyn are the major CagA-phosphorylating kinases that are present in host cell lysates.

Results

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

In vitro tyrosine phosphorylation of CagA occurs within the EPIYA motif

To determine which tyrosine residues on CagA are phosphorylated, we generated fusion proteins of different CagA domains from strains CCUG17874 and G27 with glutathione-S-transferase (GST) and histidine (His) tags (Fig. 1). After expression in Escherichia coli BL21 and purification by affinity chromatography, the CagA fragments were assayed for their ability to be substrates for tyrosine kinases. An in vitro kinase assay (tyrosine kinase phosphorylation assay, TKPA) was carried out in which purified CagA molecules were incubated with purified c-Src kinase for 10 min at 30°C in a phosphorylation buffer.

image

Figure 1. In vitro tyrosine-phosphorylation assay with CagA fusion proteins and purified c-Src kinase. In vitro TPKA using c-Src kinase: as substrates we added full-length CagA and fusion proteins containing the EPIYA motifs (CagA, CagA-2 to CagA-5); CagA-1 and CagA-6 were the only ones detected as not phosphorylated. Y indicates the distribution of non-phosphorylated tyrosine residues of CagA. The repeat region is boxed and shaded in dark grey, the EPIYA motifs are visualized as black bars. Sequences of strains CCUG17874, Ba185 and 342 are shown to visualize the structural variability in the repeat region between different isolates. The His (CagA-1) or GST (CagA-2 to CagA-6) tags are sketched as a coiled line. Construct CagA-5 was obtained by fusing amino acids (aa) 846–978 from CCUG17874CagA. All the other constructs are fusions with G27CagA (CagA-1, aa 1–852; CagA-2, aa 846–1216; CagA-3, aa 921–1216; CagA-4, aa 846–1049; and CagA-6, aa 1041–1216).

Download figure to PowerPoint

In most of the clinical isolates, CagA contains from two to six copies of a short amino acid sequence, EPIYA, located in the carboxy-terminal half of the protein. The EPIYA motif is present in two copies in a strain without repeats (CCUG17874), in three copies in a strain with one repeat (Ba185 and 342) and in four copies in a strain with two repeats (G27) (Figs 1 and 2). As shown in Fig. 1 the tyrosine-phosphorylated region of G27CagA was located between amino acids 846 and 1049, which contained all four EPIYA motifs (Fig. 1, CagA-4). The homologous region in strain CCUG17874 containing only two EPIYA motifs was also tyrosine phosphorylated (Fig. 1, CagA-5). In both CagA fusions no further tyrosine residues were present. A fusion protein containing the repeat region of G27CagA together with the carboxy-terminal part of the protein (Fig. 1, CagA-3) was also phosphorylated, suggesting that the two EPIYA motifs are recognized by the c-Src kinase. Identical tyrosine-phosphorylation signals for the different fusion proteins were also obtained, when the NP-40 soluble fraction from AGS cells was used in the TKPA instead of c-Src kinase (data not shown). This indicated that the EPIYA motif of CagA is possibly the only sequence motif that can be recognized by host tyrosine kinases.

image

Figure 2. Distribution of EPIYA motifs and repeated regions within CagA across clinical isolates. Multiple alignment of the activation domain in different clinical isolates. EPIYA 1 and 2 are common to all clinical isolates classified as type I and are considered to be an integral part of the CagA protein. Starting at nucleotide 3406 of the cagA gene (GenBank accession no. AF282853), the duplicated region of strains Ba185 and 342 contains one 102 bp repeat (composed by the D1 = EPIYA, D2 and D3 amino acid sequences) originated from a duplication event and a second 102 bp repeat in strains G27 and G39. EPIYA 3 and 4 belong to the repeated region. An additional duplication is in bold and underlined and a deletion is also indicated (strain Ba185).

Download figure to PowerPoint

Mass spectrometry demonstrates tyrosine phosphorylation of at least three of the four EPIYA motifs in G27CagA

To verify that the EPIYA motifs are the only proteic sequences of CagA fusions phosphorylated on tyrosine residues we used MALDI-TOF (matrix-assisted laser desorption/ionization-time of flight) mass spectrometry. The mass spectrometry profiles of the CagA–GST fusion protein containing four EPIYA motifs (Fig. 1, CagA-4) were analysed before and after TKPA. Samples were separated by SDS–PAGE: bands were excised, digested with trypsin and individually applied to the mass spectrometer. Comparison of the two samples revealed the presence of three additional peaks in the fusion incubated with the c-Src kinase. These additional peaks originated from one distinct phosphorylation event in each of the three peptides. Based on their molecular mass, the predicted amino acid sequences for the peptides were N–AGQAASPEEPIYAQVAKKVNAKI–C, N–VGQSVSPEPIYATIDDLGGPFPLKR–C and N–VGLSVSPEPIYATIDDLGGPFPK–C, which correspond to the EPIYA modules two, three and four (Fig. 2). The peptide containing the first EPIYA module was not detected and consequently tyrosine phosphorylation could not be demonstrated. None of the other identified peptides showed modifications on tyrosine residues.

Tyrosine phosphorylation of EPIYA in co-cultivation experiments

To ascertain whether the tyrosine phosphorylation sites on CagA determined in vitro were relevant in vivo, we undertook a systematic approach of site-directed mutagenesis. As a recipient strain we used a G27 mutant harbouring a total cagA deletion. Then, three cagA mutants were generated by allelic exchange. (a) A first mutant in which the wild-type cagA gene was reintroduced to assess whether the original phenotype could be restored (cagA*). (b) In the second mutant the repeat region was removed to reduce the number of the EPIYA sites (cagAΔrep). AGS cells were then infected and the buffer-soluble fraction lysis was tested for the presence of tyrosine-phosphorylated CagA. Phosphoproteins from identical fractions were also analysed following immunoprecipitation using anti-phosphotyrosine antibodies. While the CagA protein in the strain cagA* was phosphorylated at levels similar to those found in the wild-type strain, in cagAΔrep the level of phosphorylation was lower because of the absence of two phosphorylation sites (Fig. 3A). (c) Point mutations were introduced in strain cagAΔrep at positions 2684 (tat [RIGHTWARDS ARROW] tct) and 2741 (tac [RIGHTWARDS ARROW] tcc) to convert the tyrosine residues into serines (cagAEPISA) at the two remaining EPIYA sites. During infection experiments, CagA was not detected as being tyrosine phosphorylated (Fig. 3A).

image

Figure 3. CagA lacking the EPIYA motifs is translocated but not phosphorylated on tyrosine in tissue culture assay.

A. AGS cells were infected for 3 h with G27 wild type and with the isogenic mutants ΔcagA, cagA*, cagAΔrep (no repeat region) and cagAEPISA (no repeat, EPIYA motifs converted into EPISA). Cells were harvested and solubilized with RIPA buffer. The soluble fraction was analysed with CagA (α-CagA) and phosphotyrosine (α-PY) antibodies by Western blotting. As an alternative, the phosphoproteins were immunoprecipitated using anti-phosphotyrosine antibodies that were then subjected to further analysis.

B. Following infection with different strains, AGS cells were fractionated by mechanical lysis; membrane and insoluble fractions were collected. Fractions were separated by SDS–PAGE and the proteins transferred to nitrocellulose membranes. The membrane fraction was probed with α-PY or with α-CagA antibodies, the insoluble fraction was probed only with α-CagA antibody.

Download figure to PowerPoint

This demonstrates that in G27CagA the EPIYA motifs are the only tyrosine-phosphorylation sites present in the protein. To verify whether the CagA molecule from strain cagAEPISA was still translocated, AGS cells were infected with (i) the strain G27, (ii) the isogenic mutant in cagA, (iii) the virB10 knock out and (iv) the strain cagAEPISA. The virB10 mutant was used as a negative control because it did not possess a functional type IV secretion system and because it expressed but did not translocate CagA. The host cells were fractionated and the membrane fractions analysed for CagA translocation and phosphorylation.

The strain cagAEPISA was competent for translocation but the CagA protein was not phosphorylated (Fig. 3B). Wild-type CagA was translocated and phosphorylated. The CagA of the virB10 mutant was neither translocated nor phosphorylated, as shown previously (Stein et al., 2000).

Src kinase inhibitor PP1 inhibits CagA tyrosine phosphorylation in vitro and in tissue culture conditions

To identify the host cell tyrosine kinase responsible for CagA phosphorylation, we fractionized infected AGS cells into cytosol and membrane fractions and tested the ability of these compartments to phosphorylate CagA–GST by TKPA.

Tyrosine kinase activity was almost exclusively associated with host cell membranes, with minimal activity in the cytosolic fraction (Fig. 4A). This finding was not unexpected since most tyrosine kinases are associated with the plasma membrane. This is true for receptor tyrosine kinases and for the non-receptor tyrosine kinases, including the Src family kinases, which are myristilated (Fig. 4B and C). We also observed that CagA-phosphorylating activity was present in the cell lysate of many cell lines, including primary human breast epithelial cells, human colon and prostatic carcinoma and Drosophila cells, indicating that the kinase was rather ubiquitous (data not shown).

image

Figure 4. CagA kinases are associated with host cell membranes. Infected AGS cells were fractionated into cytosol, membrane and insoluble fractions by mechanical lysis. The insoluble fraction was extracted with 1% NP-40 buffer. The cytosol, the membrane fraction and the NP-40 extract were incubated with the CagA-4 fusion (see Fig. 1) in a phosphorylation buffer for 10 min at 30°C. Reactions were arrested with loading buffer, subjected to separation on SDS–PAGE and the proteins were transferred onto nitrocellulose membranes. Nitrocellulose membranes were either probed with α-PY (A), α-c-Src (B) or α-EGFR antibodies (C).

Download figure to PowerPoint

We then tested a panel of kinase-specific inhibitors with specificity against some of the major membrane-associated tyrosine kinases, including Src, epidermal growth factor receptor (EGFR) and platelet-derived growth factor receptor (PDGFR), for their effect on CagA phosphorylation in the TKPA. The Src kinase family inhibitor PP1 dramatically reduced CagA-phosphorylating activity in cell lysates at very low concentrations (180 nM), but not the inhibitors AG 17 (selective for PGFR) and AG 1478 (specific for EGFR) (Fig. 5A).

image

Figure 5. Effect of different tyrosine kinase inhibitors on CagA phosphorylation.

A. Inhibition of CagA phosphorylation. NP-40-soluble cell lysates were obtained from AGS cells, which were infected with strain G27 for 3 h. Then, the lysate was used in an in vitro kinase assay to test the effects of different tyrosine kinase inhibitors on CagA-4 phosphorylation. Phosphorylation of CagA-4 was detected using α-PY antibody following analysis by SDS–PAGE and transfer of the proteins to a nitrocellulose membrane. PP1 is an inhibitor for Src family kinases (IC50 for c-Src 170 nM), AG1478 is an inhibitor for EGFR receptor (IC50 3 nM), AG 17 is an inhibitor for PDGF receptor (IC50 500 nM). The inhibitor concentrations used are indicated in the figure.

B. AGS cells were treated with different concentrations of PP1 and AG1478 as indicated and then infected for 2 h with wild-type strain G27. The cells were scraped, extracted with RIPA buffer and the samples analysed with α-CagA or α-PY antibodies following SDS–PAGE and transfer of the proteins to nitrocellulose membrane.

Download figure to PowerPoint

Next, we assessed the role of Src and EGFR kinases using tissue culture conditions. The inhibitors were added in increasing concentrations to the medium of AGS cells, which were then infected for 2 h. None of the inhibitors affected the bacterial viability. Cell proteins were extracted with lysis buffer and the extent of CagA phosphorylation was investigated by Western blotting.

In agreement with the results obtained using the in vitro assays, PP1 reduced CagA tyrosine phosphorylation whereas the inhibitor against EGFR had no effect, supporting a role of Src kinase as the enzyme responsible for CagA tyrosine phosphorylation in living cells (Fig. 5B).

c-Src and Lyn from AGS cell lysates phosphorylate CagA

Inhibitor studies suggested that translocated CagA was phosphorylated by members of the Src kinase family. To narrow down the number of candidates that phosphorylate CagA, we tested eight members of the Src kinase family, including c-Src, Fyn, Lck, c-Yes, Lyn, Hck, c-Fgr and Blk. As an additional control, we used the EGFR kinase, which is able to phosphorylate CagA in vitro. From the nine tyrosine kinases, only c-Src, Lyn, c-Fgr and EGFR kinase were expressed by the AGS cells in amounts detectable by Western blotting (data not shown).

All of these expressed kinases were immunoprecipitated from AGS lysate and tested for phosphorylation of the CagA fusion using TKPA. Precipitated c-Src and Lyn strongly phosphorylated the fusion, whereas immunoprecipitated c-Fgr and EGFR were unable to use CagA as a substrate (Fig. 6). The specificity of c-Src and Lyn towards phosphorylation of CagA was further established by using AGS lysate that had been immunodepleted using c-Scr and Lyn antibodies. The data in Fig. 6 show that both crude cell lysate and a Src/Lyn immunoprecipitate phosphorylated CagA, whereas phosphorylation of CagA by immunodepleted lysate was attenuated. In conclusion, within the Src family kinases, c-Src and Lyn represent the major CagA-phosphorylating activity present in AGS cells.

image

Figure 6. CagA-phosphorylating activity of different members of the Src kinase family. AGS cells were infected with strain G27 for 3 h. Then, the cells were lysed and fractions of the lysate were used for immunoprecipitation using α-c-Src, α-Lyn, α-c-Src and α-Lyn, α-EGFR or α-c-Fgr antibodies. The lysate, the immunoprecipitates (IP) and the supernatants from the precipitations (SN) were then tested in an in vitro kinase assay.

A. Different protein samples were analysed by SDS–PAGE, transferred to nitrocellulose membrane and the membrane probed with α-PY antibody.

B. The same samples probed with the different kinase antibodies to demonstrate the extent of the immunoprecipitation.

Download figure to PowerPoint

Tyrosine phosphorylation of CagA is required to induce host cell signalling events

Infection of gastric cell lines by type I strains of H. pylori induces a growth factor-like response, which is characterized by lamellipodia and filopodia with spreading and elongated growth of the cell. This phenotype, described as ‘hummingbird phenotype’ (Segal et al., 1999), was observed during infection with the wild-type strain, but not during infection with mutants of the cagA or of the type IV secretion system (TFSS). During the course of the experi-ments it became more and more evident that, the cell elongation phenotype is the result of many different effects, including increased cell motility and massive actin polymerization.

We further investigated whether CagA translocation and tyrosine phosphorylation were required for induction of the cell elongations. AGS cells were infected with the wild-type strain G27 and the isogenic mutants previously described. As shown in Fig. 7, the strains G27 and cagA* induced cytoskeletal rearrangements with major changes in the host cell morphology, whereas the ΔcagA mutant, the ΔvirB10 mutant and cagAEPISA did not have any effect.

image

Figure 7. Tyrosine phosphorylation of CagA is required to induce host cell signalling events. Light microscopy assay for detection of CagA biological activity: infected and non-infected AGS cells were tested in the presence and absence of the tyrosine kinase inhibitor PP1. AGS cells were exposed to the isogenic G27 mutants for cagA, virB10, cagA*, cagAΔrep and cagAEPISA, as indicated. The strain Ba185 was also used in co-cultivation experiments as a representative of the Helicobacter strains possessing a single repeat. After 4 h, the morphology of the cells was investigated by Nomarsky differential interference microscopy (magnification 40×).

Download figure to PowerPoint

Infection of AGS cells with the strain cagAΔrep did not induce an elongation phenotype that was similar to wild-type levels, but in contrast to infections with the cagAEPISA or the ΔcagA strains where elongation is virtually absent, the cells showed a tendency to elongate. This result was in agreement with the lower level of CagA tyrosine phosphorylation that was induced by the cagAΔrep strain in the infection experiments (Fig. 2). To provide further evidence that the elongation phenotype is linked to phosphotyrosine signalling we infected AGS cells with the wild-type strain under the presence of the Src kinase inhibitor PP1. The inhibitor also strongly reduced the elongation phenotype. To show that in conjunction with EPIYA 1 and 2 a 102 bp repeat enhances the induction of host cell elongation, we infected AGS cells with two strains – Ba185 (Fig. 7) and 342 (not shown) – that contain only one repeat. Both strains were able to induce the elongation phenotype, although to a lesser extent than strain G27. Thus, CagA translocation and an additive tyrosine phosphorylation of the EPIYA motifs are required to induce a cell response that has increasing visibility.

Discussion

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

Subversion of host cell signalling pathways is a mechanism used by many pathogenic bacteria to cause infection and to replicate and survive inside their hosts. The interaction of microbes encoding type III secretion systems (TTSS), such as Yersinia, Shigella, Salmonella, pathogenic Escherichia coli and many plant pathogens, with the host cell have been extensively studied. Type III secretion systems translocate virulence proteins directly from the bacterium into the host cell by a dedicated injection machinery. Effector molecules target basic cellular functions by acting as cytotoxins (YopE) (Rosqvist et al., 1991; Von Pawel-Rammingen et al., 2000), kinases (YpkA) (Galyov et al., 1993; Juris et al., 2000), phosphatases (YopH) (Black and Bliska, 1997; Persson et al., 1997), proteases (YopJ) (Orth et al., 2000) or even as bacterial receptors (Tir) (Kenny et al., 1997). A secretion system of different phylogenetic origin, the type IV secretion system, has been recently demonstrated as being endowed of a similar function. The CagA protein of H. pylori was the first proteic molecule involved in virulence to be identified as a substrate for TFSS. Translocated effectors are under intense study in microorganisms that bear a TFSS, such as Legionella pneumophila (Segal et al., 1999), Rickettsia prowazekii, Bartonella henselae and Brucella suis (O’Callaghan et al., 1999), and that exhibit intracellular growth and macrophage killing.

We used the in vitro kinase assay to identify the tyrosine-phosphorylation site of CagA, which mapped within the repetitive sequence motif EPIYA. We then demonstrated that phosphorylation on EPIYA has a central role in inducing changes in the host cell morphology. This phenotype, which is characterized by dramatic host cell elongations, is a consequence of a progressive phosphorylation of all EPIYA motifs within CagA. Moreover, we found that the EPIYA motifs in the repeat region (Tyr-968 and Tyr-1002 in G27) that forms very hydrophilic loops that are well exposed at the surface are essential to superactivate CagA.

Recent work by Püls et al. (1902, this issue) suggests that additional sites can activate CagA in a manner similar to that described in our work. The translocated intimin receptor (Tir) of enteropathogenic E. coli (EPEC) is also phosphorylated on tyrosine residues by a host cell kinase (Kenny et al., 1997). This molecule displays multiple functions that include binding of α-actinin, talin and vinculin (Freeman et al., 2000; Goosney et al., 2000) and a receptor-like interaction with intimin, a bacterial outer membrane protein. Tir tyrosine phosphorylation induces a cascade of events that involve N-WASP and Arp2/3 complexes for cortical actin polymerization underneath the attaching bacteria (Kalman et al., 1999). It is tempting to speculate that CagA tyrosine phosphorylation is crucial to initiate host cell signalling events via interaction with a SH2 or SH3 domain. This would lead to induction of a signalling cascade that mimics growth factor-like responses and rearrangements of the actin cytoskeleton. In addition, we provided evidence that inhibitors specific for the Src kinase family abolish CagA tyrosine phosphorylation in vitro and in tissue culture infection experiments and that two members of the Src kinase family, c-Src and Lyn, are the major CagA kinases in AGS cell lysates. Src family kinases are strongly implicated in the development, growth, progression and metastasis of a number of human cancers. They belong to the family of non-receptor kinases and are post-translationally modified through covalent attachment of a 14-carbon fatty acid moiety, myristate (Buss and Sefton, 1985; Schultz et al., 1985). Together with six basic amino acid residues the myristylation acts as the amino-terminal signal for membrane anchorage of the Src kinases (Sigal et al., 1994). The main target is the plasma membrane, but perinuclear and endosomal membranes are also targeted (Willingham et al., 1979; Courtneidge et al., 1980; Resh and Erikson, 1985; David-Pfeuty and Nouvian-Dooghe, 1990). In the plasma membrane, Src kinases are found associated with focal adhesions (Henderson and Rohrschneider, 1987; Schaller et al., 1994), the actin cytoskeleton and adherens junctions. Src responses include mitogenic signalling through association with growth factor receptors, cell adhesion and spreading, cell migration and regulation of cell–cell contact formation. Our experiments suggest that c-Src and Lyn phosphorylate CagA in vivo, and that CagA might recruit additional c-Src and Lyn to the plasma membrane or, alternatively, lead to an increase in kinase activity. Thus, pathways activated through Src kinase activation at the plasma membrane through continuous injection of CagA contribute to the elongated phenotype in infected AGS cells, and may eventually represent a risk factor for peptic ulcer disease and gastric cancer.

Experimental procedures

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

Plasmids and strains

Helicobacter pylori strains G27, 342, Ba185 (Xiang et al., 1995) and CCUG17874 (GenBank accession no. AF282853) have been described previously. Recombinant cloning was performed in strain DH10B and protein expression in strain BL21. The fusion proteins were constructed as follows: different fragments of cagA were amplified from chromosomal DNA (strains G27 or CCUG17874) using the primer pairs TyrA+ (TTAGGATCCGGAACCCTAGTCGGTAATGG)/pET27A– (TATGCTAGCCCCATTACCGACTAGGGTTCC) (Fig. 1, CagA-2), CagArepeat (AAAGGATCCGTAAATGCAAAAATTGACCGACTC)/pET27A– (CagA-3), CagAY+ (AAAGGATCCCTCAATCAAGCGGTATCAGAAG)/pET27A– (CagA-6) and TyrA+/CagAY– (AAACTCGAGTTAAGCTTCTGATACCGCTTGATTG) (CagA-4 and CagA-5). The PCR products were digested with the restriction endonucleases BamHI and XhoI and cloned into the vector pGEX-6P-1 (Amersham Pharmacia). This step resulted in the plasmids expressing CagA-2 to CagA-6. The cagA 5′ region was amplified using the primer pairs pET27A+ (TATGGATCCAATGACTAACGAAACCATTGACC)/TyrA– (AAAGCTAGCCCCATTACCGACTAGGGTTCC) (CagA-1), the PCR fragment was digested with the restriction endonucleases NheI and XhoI and the resulting fragment was cloned into the vector pET27b (Novagen). The G27 cagA deleted mutant was generated as described previously by Copass et al. (1997). Briefly, short regions of the cagA gene were amplified with appropriate restriction sites by PCR and cloned after digestion into the pBluescript SK+ vector. A cassette containing a kanamycin resistance gene and the sacB gene was then introduced between the two fragments. Following transformation into strain G27 the ΔcagA mutants were selected for kanamycin resistance and the corresponding DNA region was sequenced to confirm recombination. The cagA gene, including part of the upstream and downstream regions, was amplified with the oligos Fab1 (ATAGTCGACCTCAAGTCGTTGTAGAATTGTAG) and Fab2 (ATAGCGGCCGCCTCAAGTCGTTGTAGAATTGTAG) and cloned into SalI–NotI sites within the polylinker region of the vector pBluescript SK+ (strain cagA*). Using overlapping extensions we deleted the repeat region using the combination of oligos Fab1/Rep– (TTTCAAAGGGAAGCCCACTGCTTGCCCTACAAC) and Rep+ (CAAGCAGTGGGCTTCCCTTTGAAAAGGCATGAT)/Fab2 (strain cagAΔrep).

A second round of overlapping extension was used to create the point mutations to change the tyrosines of the EPIYA motif into serine residues. The A of basepair 2684 was replaced by a C using the oligos S1+ (ACAGAACCCATTCTGCTAAAGTTAAT)/S1– (ATTAACTTTAGCAGAAATGGGTTCTGT). The A of basepair 2741 was replaced by a C using the oligos S2+ (GAAGAACCCATTTACGCTCAAGTTGCT)/S2– (AGCAACTTGAGCGTAAATGGG CTTC) (strain cagAEPISA).

The different constructs were used to transform the ΔcagA mutant and transformants were selected by growth on plates containing sucrose and kanamycin.

MALDI-TOF mass spectrometry

The protocol used for tryptic in gel digestion is described in Wilm et al. (1996). Following the in gel digestion, the peptides were desalted and concentrated using C18 ZIP-TIP (Millipore). The peptides were eluted from the ZIP-TIP with a saturated solution of α-cyano-4-hydroxycinnamic acid in 50% acetonitrile/0.1% trifluoroacetic acid and directly loaded onto the mass spectrometry target.

Spectra were acquired on a Biflex II MALDI-TOF (Bruker Daltonic) equipped with the Scout 381 multiprobe ion source in a positive ion reflector mode. The acceleration voltage was set to 19 kV and the reflector voltage was set to 20 kV. Peptides were selected in the mass range of 700–3000 Da.

Spectra were externally calibrated using a combination of angiotensin II (1046.54 Da) and substance P (1347.74 Da), bombensin (1619.82 Da) and ACTH18-39 (2465.20 Da) located in spots adjacent to the samples.

In vitro phosphorylation assay and cell line

The in vitro phosphorylation assay using src kinase and AGS cell lysates were performed as described by Asahi et al. (2000). Two microlitres of src kinase or 5–10 μl of the cell lysates were used in a total reaction volume of 40 μl containing 4 μl of a 10× phosphorylation buffer (250 mM Tris/Cl, pH 7.4; 400 μM ATP; 62.5 mM MnCl2; 312.5 mM MgCl2, 5 mM EGTA, 1 mM sodium-o-vanadate). Src (p60 c-Src) kinase was obtained from Upstate Biotechnology. Phosphorylation was carried out at 30°C for 10 min. AGS cells (ECACC 89090402) were grown at 37°C, 5% CO2/95% air in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% (v/v) fetal bovine serum.

Infection and fractionation of AGS cells

The infection and fractionation of AGS cells into a RIPA-soluble fraction or a cytosolic fraction and membrane fraction was performed as described by Stein et al. (2000).

Antibodies and immunoprecipitation

Immunoprecipitation was carried out following the protocols provided by the suppliers of the antibodies. Antibodies against c-Src, Lyn, lck, hck, c-Fgr, fyn, blk, c-yes, antiphosphotyrosine (PY99) and EGFR were obtained from Santa Cruz Biotechnology. Anti-phosphotyrosine antibody (RC20H) was obtained from Transduction Laboratories. Secondary antibodies were obtained from Gibco BRL.

Inhibitor studies

The tyrosine kinase inhibitors were obtained from Calbiochem. IC50 values for these inhibitors are 170 nM for PP1 (c-Src), 3 nM for AG 1478 (EGFR) and 500 nM for AG 17 (PDGFR). For the inhibitor study, one 10 cm dish of confluent AGS cells was infected with H. pylori for 3 h. Cells were washed and solubilized in 1 ml lysis buffer [20 mM Tris/Cl, 1% NP-40, protease inhibitors (complete mini-EDTA-free; Roche), 1 mM sodium-o-vanadate]. Lysate (10 μl) was then mixed with 6 μl (100 ng) of CagA–GST fusion protein, 20 μl dH2O and 4 μl of 10× phosphorylation buffer (see above) and was incubated for 10 min at 30°C. Inhibitor concentrations used during the infection experiments were 1 μM, 5 μM and 20 μM for PP1 and 100 nM, 1 μM and 10 μM for AG 1478.

Acknowledgements

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

We would like to thank S. Censini for discussions and reagents, A. B. Jefferson and C. Reinhard for the precious help with antisense RNA. We gratefully acknowledge S. Guidotti for sequence analysis, A. Muzzi for oligo synthesis and N. Norais and G. Grandi for MALDI-TOF mass spectrometry. Finally, we are deeply grateful to C. Mallia for editorial assistance, G. Corsi for the artwork and P. Ruggiero for microscopy. M. Stein is supported by a Marie Curie fellowship of the European Commission.

References

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References
  • Asahi, M., Awuma, T., Ito, S., Ito, Y., Suto, H., Nagai, Y., et al. (2000) Helicobacter pylori CagA protein can be tyrosine phosphorylated in the gastric epithelial cells. J Exp Med 191: 593602.
  • Backert, S., Ziska, E., Brinkmann, V., Zimny-Arndt, U., Fauconnier, A., Jungblut, P.R., et al. (2000) Translocation of the Helicobacter pylori CagA protein in gastric epithelial cells by a type IV secretion apparatus. Cell Microbiol 2: 155164.
  • Black, D.S., and Bliska, J.B. (1997) Identification of p130Cas as a substrate of Yersinia YopH (Yop51), a bacterial protein tyrosine phosphatase that translocates into mammalian cells and targets focal adhesions. EMBO J 16: 27302744.
  • Buss, J.E., and Sefton, B.M. (1985) Myristic acid, a rare fatty acid, is the lipid attached to the transforming protein of Rous sarcoma virus and its cellular homolog. J Virol 53: 712.
  • Censini, S., Lange, C., Xiang, Z., Crabtree, J.E., Ghiara, P., Borodovsky, M., et al. (1996) cag, a pathogenicity island of Helicobacter pylori, encodes type I-specific and disease-associated virulence factors. Proc Natl Acad Sci USA 93: 1464814653.
  • Copass, M., Grandi, G., and Rappuoli, R. (1997) Introduction of unmarked mutations in the Helicobacter pylori vacA gene with a sucrose sensitivity marker. Infect Immun 65: 19491952.
  • Courtneidge, S.A., Levinson, A.D., and Bishop, J.M. (1980) The protein encoded by the transforming gene of avian sarcoma virus (pp. 60src) and a homologous protein in normal cells (pp. 60proto-src) are associated with the plasma membrane. Proc Natl Acad Sci USA, 77: 37833787.
  • Covacci, A., Censini, S., Bugnoli, M., Petracca, R., Burroni, D., Macchia, G., et al. (1993) Molecular characterization of the 128-kDa immunodominant antigen of Helicobacter pylori associated with cytotoxicity and duodenal ulcer. Proc Natl Acad Sci USA 90: 57915795.
  • David-Pfeuty, T., and Nouvian-Dooghe, Y. (1990) Immunolocalization of the cellular src protein in interphase and mitotic NIH c-Src overexpresser cells. J Cell Biol 111: 30973116.
  • Freeman, N.L., Zurawski, D.V., Chowrashi, P., Ayoob, J.C., Huang, L., Mittal, B., et al. (2000) Interaction of the enteropathogenic Escherichia coli protein, translocated intimin receptor (Tir), with focal adhesion proteins. Cell Motil Cytoskeleton 47: 307318.
  • Galyov, E.E., Hakansson, S., Forsberg, A., and Wolf-Watz, H. (1993) A secreted protein kinase of Yersinia pseudo-tuberculosis is an indispensable virulence determinant. Nature 361: 730732.
  • Glocker, E., Lange, C., Covacci, A., Bereswill, S., Kist, M., and Pahl, H.L. (1998) Proteins encoded by the cag pathogenicity island of Helicobacter pylori are required for NF-kappaB activation. Infect Immun 66: 23462348.
  • Goosney, D.L., DeVinney, R., Pfuetzner, R.A., Frey, E.A., Strynadka, N.C., and Finlay, B.B. (2000) Enteropathogenic E. coli translocated intimin receptor, Tir, interacts directly with alpha-actinin. Curr Biol 10: 735738.
  • Henderson, D., and Rohrschneider, L. (1987) Cytoskeletal association of pp. 60src. The transforming protein of the Rous sarcoma virus. Exp Cell Res, 168: 411421.
  • Juris, S.J., Rudolph, A.E., Huddler, D., Orth, K., and Dixon, J.E. (2000) A distinctive role for the Yersinia protein kinase: actin binding, kinase activation and cytoskeleton disruption. Proc Natl Acad Sci USA 97: 94319436.
  • Kalman, D., Weiner, O.D., Goosney, D.L., Sedat, J.W., Finlay, B.B., Abo, A., and Bishop, J.M. (1999) Enteropathogenic E. coli acts through WASP and Arp2/3 complex to form actin pedestals. Nature Cell Biol 1: 389391.
  • Kenny, B., DeVinney, R., Stein, M., Reinscheid, D.J., Frey, E.A., and Finlay, B.B. (1997) Enteropathogenic E. coli (EPEC) transfers its receptor for intimate adherence into mammalian cells. Cell 91: 511520.
  • O’Callaghan, D., Cazevieille, C., Allardet-Servent, A., Boschiroli, M.L., Bourg, G., Foulongne, V., et al. (1999) A homologue of the Agrobacterium tumefaciens VirB and Bordetella pertussis Ptl type IV secretion systems is essential for intracellular survival of Brucella suis. Mol Microbiol 33: 12101220.
  • Odenbreit, S., Puls, J., Sedlmaier, B., Gerland, E., Fischer, W., and Haas, R. (2000) Translocation of Helicobacter pylori CagA into gastric epithelial cells by type IV secretion. Science 287: 14971500.
  • Orth, K., Xu, Z., Mudgett, M.B., Bao, Z.Q., Palmer, L.E., Bliska, J.B., et al. (2000) Disruption of signaling by Yersinia effector YopJ, a ubiquitin-like protein protease. Science 290: 15941597.
  • Persson, C., Carballeira, N., Wolf-Watz, H., and Fallman, M. (1997) The PTPase YopH inhibits uptake of Yersinia, tyrosine-phosphorylation of p130Cas and FAK and the associated accumulation of these proteins in peripheral focal adhesions. EMBO J 16: 23072318.
  • Püls, J., Fischer, W., and Haas, R. (1902) Activation of Helicobacter pylori CagA by tyrosine phosphorylation is essential for dephosphorylation of host cell proteins in gastric epithelial cells. Mol Microbiol 43: 961969.
  • Resh, M.D., and Erikson, R.L. (1985) Highly specific antibody to Rous sarcoma virus src gene product recognizes a novel population of pp. 60v–src and pp. 60c–Src molecules. J Cell Biol, 100: 409417.
  • Rosqvist, R., Forsberg, A., and Wolf-Watz, H. (1991) Intracellular targeting of the Yersinia YopE cytotoxin in mammalian cells induces actin microfilament disruption. Infect Immun 59: 45624569.
  • Schaller, M., Hildebrand, J.D., Shannon, J.D., Fox, J.W., Vine, R.R., and Parsons, J.T. (1994) Autophosphorylation of the focal adhesion kinase, pp. 125FAK, directs SH2-dependent binding of pp. 60src. Mol Cell Biol, 14: 16801688.
  • Schultz, A.M., Henderson, L.E., Oroszlan, S., Garber, E.A., and Hanafusa, H. (1985) Amino terminal myristylation of the protein kinase p60src, a retroviral transforming protein. Science 227: 427429.
  • Segal, E.D., Cha, J., Lo, J., Falkow, S., and Tompkins, L.S. (1999a) Altered states: involvement of phosphorylated CagA in the induction of host cellular growth changes by Helicobacter pylori. Proc Natl Acad Sci USA 96: 1455914564.
  • Segal, G., Russo, J.J., and Shuman, H.A. (1999b) Relationships between a new type IV secretion system and the icm/dot virulence system of Legionella pneumophila. Mol Microbiol 34: 799809.
  • Sharma, S.A., Tummuru, M.K., Blaser, M.J., and Kerr, L.D. (1998) Activation of IL-8 gene expression by Helicobacter pylori is regulated by transcription factor nuclear factor-kappa B in gastric epithelial cells. J Immunol 160: 24012407.
  • Sigal, C.T., Zhou, W., Buser, C.A., McLaughlin, S., and Resh, M.D. (1994) Amino-terminal basic residues of Src mediate membrane binding through electrostatic interaction with acidic phospholipids. Proc Natl Acad Sci USA 91: 1225312257.
  • Stein, M., Rappuoli, R., and Covacci, A. (2000) Tyrosine-phosphorylation of the Helicobacter pylori CagA antigen after cag-driven host cell translocation. Proc Natl Acad Sci USA 97: 12631268.
  • Tummuru, M., Sharma, S.A., and Blaser, M.J. (1995) Helicobacter pylori picB, a homologue of the Bordetella pertussis toxin secretion protein, is required for induction of IL-8 in gastric epithelial cells. Mol Microbiol 18: 867876.
  • Von Pawel-Rammingen, U., Telepnev, M.V., Schmidt, G., Aktories, K., Wolf-Watz, H., and Rosqvist, R. (2000) GAP activity of the Yersinia YopE cytotoxin specifically targets the Rho pathway: a mechanism for disruption of actin microfilament structure. Mol Microbiol 36: 737748.
  • Willingham, M.C., Jay, G., and Pastan, I. (1979) Localization of the ASV src gene product to the plasma membrane of transformed cells by electron microscopic immunocytochemistry. Cell 18: 125134.
  • Wilm, M., Shevchenko, A., Houthaeve, T., Breit, S., Schweigerer, L., Fotsis, T., and Mann, M. (1996) Femtomole sequencing of proteins from polyacrylamide gels by nano-electrospray mass spectrometry. Nature 379: 466469.
  • Xiang, Z., Censini, S., Bayeli, R.B., Telford, J.L., Figura, N., Rappuoli, R., and Covacci, A. (1995) Analysis of expression of CagA and VacA virulence factors in 43 strains of Helicobacter pylori reveals that clinical isolates can be divided into two major types and that CagA is not necessary for expression of the vacuolating cytotoxin. Infect Immun 63: 9498.