SEARCH

SEARCH BY CITATION

Summary

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

The inhA and kasA genes of Mycobacterium tuberculosis have each been proposed to encode the primary target of the antibiotic isoniazid (INH). Previous studies investigating whether overexpressed inhA or kasA could confer resistance to INH yielded disparate results. In this work, multicopy plasmids expressing either inhA or kasA genes were transformed into M. smegmatis, M. bovis BCG and three different M. tuberculosis strains. The resulting transformants, as well as previously published M. tuberculosis strains with multicopy inhA or kasAB plasmids, were tested for their resistance to INH, ethionamide (ETH) or thiolactomycin (TLM). Mycobacteria containing inhA plasmids uniformly exhibited 20-fold or greater increased resistance to INH and 10-fold or greater increased resistance to ETH. In contrast, the kasA plasmid conferred no increased resistance to INH or ETH in any of the five strains, but it did confer resistance to thiolactomycin, a known KasA inhibitor. INH is known to increase the expression of kasA in INH-susceptible M. tuberculosis strains. Using molecular beacons, quantified inhA and kasA mRNA levels showed that increased inhA mRNA levels corre­-lated with INH resistance, whereas kasA mRNA levels did not. In summary, analysis of strains harbouring inhA or kasA plasmids yielded the same conclusion: overexpressed inhA, but not kasA, confers INH and ETH resistance to M. smegmatis, M. bovis BCG and M. tuberculosis. Therefore, InhA is the primary target of action of INH and ETH in all three species.


Introduction

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

In 1952, isoniazid (INH) was discovered to have significant bactericidal activity against Mycobacterium tuberculosis, the causative agent of tuberculosis (Bernstein et al., 1952; Fox, 1952). INH was quickly adopted as a front-line antibiotic in the treatment of tuberculosis; however, the mechanism of its bactericidal activity remained unclear. Twenty years later, Winder and Collins (1970) were the first to demonstrate that INH inhibited mycolic acid biosynthesis. Takayama et al. (1972) went on to show that the bactericidal activity of INH correlated with the inhibition of mycolic acid biosynthesis. These authors also observed that INH treatment of M. tuberculosis resulted in the accumulation of a saturated C26 fatty acid, prompting them to propose that the target of INH was (i) involved in mycolic acid elongation; (ii) a desaturase; or (iii) a cyclopropanase (Takayama et al., 1975).

A drug target can be defined as a substrate, often an enzyme, to which a drug binds and causes inhibition, which inhibition leads to the death of the cell. Drug targets can be identified genetically by isolation of drug-resistant mutants of two different classes. One class of mutations, usually an amino acid substitution, maps to the protein target and reduces drug binding, thus conferring drug resistance. The second class of mutations is typically in transcription/translation control elements that stimulate the overexpression of the target protein and cause drug resistance by titration of the drug. Both types of mutations have long been known for the genes encoding the targets of sulphonamides and trimethoprim; these targets have been identified as dihydropteroate synthase (Wise and Abou-Donia, 1975; Skold, 1976; Nagate et al., 1978; Swedberg et al., 1979) and dihydrofolate reductase (Schimke et al., 1978; Davies and Gronenborn, 1982; Smith et al., 1982; Leszczynska et al., 1995) respectively. Drug targets can also be characterized by biochemical studies and X-ray crystallographic studies; such studies have confirmed the binding of sulphonamides and trimethoprim to their targets (Hampele et al., 1997; Baca et al., 2000; Li et al., 2000).

Genetic characterization of possible targets of INH in M. tuberculosis became possible after the development of transformation systems for mycobacteria (Snapper et al., 1988; 1990). The first M. tuberculosis gene, identified as katG, was shown to transfer INH susceptibility to INH-resistant mutants of Mycobacterium smegmatis (Zhang et al., 1992). Later, katG was shown to transfer INH susceptibility to INH-resistant strains of M. tuberculosis (Zhang et al., 1993). The restoration of INH susceptibility to INH-resistant mutants suggested that katG encoded an activator of INH. The second gene found in M. tuberculosis, the transfer of which was associated with INH resistance was identified as inhA and was shown to confer INH resistance through both classes of drug target mutations (structural gene and overexpression) discussed earlier (Banerjee et al., 1994). The wild-type inhA gene of M. tuberculosis or M. smegmatis was shown to confer INH resistance and ethionamide (ETH) resistance to M. smegmatis and to Mycobacterium bovis BCG when transferred on a multicopy plasmid (Banerjee et al., 1994). Moreover, a point mutation (causing the amino acid substitution S94A) within the inhA genes of an INH-resistant M. smegmatis and an INH-resistant M. bovis mutant was shown to be sufficient to transfer INH and ETH resistance to M. smegmatis when transferred by allelic exchange within M. smegmatis (Banerjee et al., 1994). The S94A allele of M. bovis was also shown to confer increased resistance to INH when transferred to M. bovis (Wilson et al., 1995). That dual resistance to INH and ETH was mediated by overexpression or by a mutation within the inhA structural gene led to the conclusion that inhA encoded the target of INH and ETH in M. tuberculosis, M. bovis and M. smegmatis (Banerjee et al., 1994). Numerous groups have identified mutations from INH-resistant clinical isolates of M. tuberculosis within the promoter of inhA and the inhA protein product that are consistent with the premise that inhA encodes the target of INH and ETH in M. tuberculosis (Heym et al., 1994; Ristow et al., 1995; Rouse et al., 1995; O’Brien et al., 1996; Telenti et al., 1997; Basso et al., 1998; Kiepiela et al., 2000; Lee et al., 2001).

After genetic identification of inhA, studies were done to demonstrate both the binding of drug to the drug target and the subsequent inhibition of the drug target. The inhA gene was predicted to encode an enoyl-ACP reductase of the fatty acid synthase II (FASII) system of mycobacteria. In an in vitro mycolic acid synthesis assay, KatG-activated INH inhibited the activity of purified InhA protein (Johnsson and Schultz, 1994). Biochemical (Quemard et al., 1995) and X-ray crystallographic studies (Dessen et al., 1995) confirmed that InhA was an NADH-specific enoyl-ACP reductase, and further analysis established that activated INH covalently attaches to NAD to form an adduct that binds to InhA (Rozwarski et al., 1998). Structural studies also revealed that the NADH binding site in INH was a hot-spot for INH-resistant mutations. Based on the structure of the INH–NAD adduct bound to the InhA protein, it has been postulated that activated ETH also covalently binds to NAD to form an adduct that inhibits InhA (Rozwarski et al., 1998). InhA enzymes prepared from INH-resistant strains of M. tuberculosis were resistant to inhibition by KatG-activated INH (Quemard et al., 1996; Basso et al., 1998). Thus, InhA proteins that bind NADH less avidly are protected from inactivation or bind the INH–NAD adduct less effectively and are resistant to INH (Rozwarski et al., 1998). These biochemical and X-ray crystallographic data support the hypothesis that activated INH or ETH binds and inhibits InhA, fulfilling two criteria of our definition of a drug target.

A biochemical approach was used to identify another gene involved in INH resistance, kasA, which encodes a β-ketoacyl-ACP synthase (Mdluli et al., 1998). This protein was reported to be covalently associated with INH and ACP. Using radioactive INH, Mdluli et al. (1998) proposed that activated INH binds ACP in M. tuberculosis cells, but it remains unclear what the chemical nature of this binding is and whether it is relevant to INH action. Furthermore, there are no studies yet to demonstrate INH inhibition of purified KasA enzyme. Genetic characterization of kasA in INH resistance has been limited, compared with that of inhA. In addition to one gene transfer experiment to demonstrate co-transfer of INH resistance with the kasA gene (Slayden et al., 2000), four independent mutations in kasA were found in INH-resistant mutants of M. tuberculosis (Mdluli et al., 1998). However, three of these mutations have now been identified in INH-sensitive M. tuberculosis strains (Lee et al., 1999; 2001; Piatek et al., 2000).

The transfer of inhA or kasA genes into mycobacteria has led to conflicting results. First, with M. smegmatis used as a surrogate host, the inhA genes from M. smegmatis, M. bovis, M. avium or M. tuberculosis were the only genes found to confer resistance to both INH and ETH when cloned on multicopy plasmids. Although these results are undisputed, the relevance of M. smegmatis as a suitable surrogate host for the study of INH resistance in M. tuberculosis has been questioned, under the rationale that M. smegmatis is naturally 100-fold more resistant to INH than M. tuberculosis (Mdluli et al., 1996). Transfer of inhA to M. bovis or M. tuberculosis has yielded varied results. Although the M. smegmatis inhA gene was shown to confer INH resistance to BCG (Banerjee et al., 1994), Mdluli et al. (1996; 1998) reported that the M. tuberculosis inhA gene conferred no increased resistance, or only twofold increased resistance, to INH in M. tuberculosis (Slayden et al., 2000). The initial attempt to express the kasA gene was reported as unsuccessful (Mdluli et al., 1998) but, more recently, kasA was successfully cloned on multicopy plasmids (Kremer et al., 2000; Slayden et al., 2000). In one study, expression of kasA driven by an hsp60 promoter conferred no resistance to INH in BCG (Kremer et al., 2000), whereas another study reported that kasA expressed from a highly active promoter (a hybrid promoter from the mycobacterial hsp60 promoter and the Eschericia coli tac promoter) was shown to confer fivefold increased resistance to INH in M. tuberculosis (Slayden et al., 2000).

The transfer of resistance to INH or ETH with the inhA or kasA genes into M. tuberculosis is an important result as it provides genetic evidence of drug binding to the target. As the increased concentration of the target is able to overcome the concentration of drug, this points to which gene actually encodes the primary target of INH and ETH. The identification of the primary target is necessary to establish the mechanisms of action of these drugs. Moreover, the result is also important to test the relevance of M. smegmatis as a surrogate model system for the analysis of INH and ETH action on M. tuberculosis. In the light of this importance and the discrepant results published in the literature, we have re-examined the ability of overexpressed inhA or kasA genes to confer resistance to INH and ETH in M. smegmatis, M. bovis BCG and M. tuberculosis.

Results

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

Determination of INH and ETH susceptibilities of M. smegmatis, M. bovis BCG or M. tuberculosis H37Rv transformed with pMV261::inhA or pMV261::kasA

As both inhA and kasA have been hypothesized to be the primary targets of action for INH in M. tuberculosis, the goal of this study was to determine whether either gene, when overexpressed, conferred resistance to INH or ETH. Failure to observe overexpression when a gene is cloned on a multicopy plasmid could result from a tightly regulated promoter. This appears to be the case for inhA, as cosmids containing inhA fail to confer INH resistance on M. tuberculosis (E. Dubnau and W. R. Jacobs, unpublished results). However, when inhA is expressed from an hsp60 promoter, the inhA gene does confer resistance to INH (Dubnau et al., 2002). This observation readily explains one set of contradictory published data. First, it confirms the observation reported by Mdluli and co-workers that plasmids containing the M. tuberculosis inhA gene fail to confer resistance to INH as the native promoter was also used. In addition, it explains the finding that, when the M. smegmatis inhA gene was introduced into M. bovis BCG, INH resistance was readily transferred (Banerjee et al., 1994) as the promoter configurations for inhA differ significantly between M. smegmatis and M. tuberculosis. The M. smegmatis inhA gene has a promoter immediately upstream of its inhA gene, whereas the M. tuberculosis inhA gene is in an operon with mabA (Banerjee et al., 1994; 1998).

To ensure significant levels of expression of the M. tuberculosis inhA gene, as well as comparable levels of the kasA and kasB genes, all three genes were cloned independently downstream of the strong hsp60 promoter in the multicopy plasmid pMV261 (Stover et al., 1991). The resulting plasmids (Table 1) were transformed into M. smegmatis mc2155, M. bovis BCG and the M. tuberculosis H37Rv strain, selecting for kanamycin (KM) resistance. Transformants were grown in broth containing KM before growth on media with INH or ETH.

Table 1. .  Plasmids.
PlasmidDescriptionMarker(s)Source or reference
  • a

    . Kanamycin.

pMV261 E. coli –mycobacteria shuttle plasmid vector with hsp 60 promoter KMa Stover et al. (1991 )
pMD31::SinhApYUB291, pMD31 derivative with inhA coding region from  M. smegmatis with hsp60 promoterKM Donnelly-Wu et al. (1993) ;  Banerjee et al. (1998)
pMV261::inhApYUB1028, pMV261 derivative with inhA coding region from  M. tuberculosis with hsp60 promoterKMThis study
pMV261::kasA kasA coding region from M. tuberculosis with hsp60 promoter KM Kremer et al. (2000 )
pMV261::kasAB kasAB coding region from M. tuberculosis with hsp60 promoter KM Kremer et al. (2000 )
pMV261::kasB kasB coding region from M. tuberculosis with hsp60 promoter KM Kremer et al. (2000 )
pMH29::inhA inhA coding region from M. tuberculosis with hsp70-ptac promoter KM Slayden et al. (2000 )
pMH29::kasAB kasAB coding region from M. tuberculosis with hsp70-ptac promoter KM Slayden et al. (2000 )

Resistance to INH or ETH was first determined by streaking transformants on Middlebrook 7H10 agar with various concentrations of INH or ETH. Transformants containing pMV261::inhA displayed a>20-fold increased resistance to INH and a>10-fold increased resistance to ETH in M. smegmatis, M. bovis BCG or M. tuberculosis (Fig. 1). In contrast, none of the transformants containing the pMV261::kasA, pMV261::kasB or pMV261::kasAB plasmids displayed increased resistance to INH or ETH in all three mycobacterial strains. M. tuberculosis H37Rv containing the pMV261::inhA plasmid grew on plates with INH concentrations up to and including 1 µg ml−1. Partial growth was observed for this strain on 2.0 µg ml−1 plates (data not shown), but no growth was observed on 4.0 µg ml−1 plates. Therefore, the minimal inhibitory concentration (MIC) for M. tuberculosis overexpressing inhA was slightly over 1.0 µg ml−1, a resistance increased 20-fold compared with wild-type H37Rv (MIC = 0.06 µg ml−1). There was no detectable growth of the M. tuberculosis strains transformed with pMV261::kasA, pMV261::kasB or pMV261::kasAB on plates containing as little as 0.1 µg ml−1 INH (which is twice the MIC of H37Rv).

image

Figure 1. A. Growth of M. smegmatis transformed with pMV261, pMV261:: inhA , pMV261:: kasA , pMV261:: kasB and pMV261:: kasAB on KM (20 µg ml −1 ), INH (25 µg ml −1 ) and ETH (25 µg ml −1 ) plates.

B. Growth of M. bovis BCG transformed with pMV261, pMV261::inhA, pMV261::kasA, pMV261::kasB and pMV261::kasAB on KM (20 µg ml−1), INH (0.1 µg ml−1), INH (2 µg ml−1) or ETH (25 µg ml−1).

C. Growth of M. tuberculosis H37Rv transformed with pMV261, pMV261::inhA, pMV261::kasA, pMV261::kasB and pMV261::kasAB on KM (20 µg ml−1), INH (4 µg ml−1), INH (1 µg ml−1), INH (0.5 µg ml−1) or INH (0.1 µg ml−1).

Download figure to PowerPoint

The MICs of INH were determined for the M. tuberculosis transformants harbouring each plasmid by agar plate dilution analysis over a range of drug concentrations: from 0.025 to 2.0 µg ml−1 INH (Table 2) (Heifets, 1991). The MIC99 is designated when a 99.9% reduction in colony-forming units (cfu) compared with control is observed at a specific INH concentration. By this method, the MIC99 for INH for the pMV261::inhA strain was 2.0 µg ml, 20-fold above the MIC99 for the INH-susceptible parent strain. Interestingly, the expression of the M. smegmatis inhA gene from its own promoter (pMD31::SinhA) conferred a 40-fold increase in INH resistance to M. tuberculosis, with a MIC99>2.0 µg ml−1. In contrast, the kasA, kasB and kasAB plasmids failed to confer any increase in resistance to INH or ETH.

Table 2. .  Broth MIC and agar proportion method MIC analysis of M. tuberculosis strains.
MethodBroth MICAgar proportiona
M. tuberculosis strain Antibiotic CDC1551 INHb µg ml−1Erdman INH µg ml−1H37Rv INH µg ml−1H37Rv INH 0.025 µg ml−1H37Rv INH 0.05 µg ml−1H37Rv INH 0.1 µg ml−1H37Rv INH 1.0 µg ml−1H37Rv INH 2.0 µg ml−1H37Rv KMc 5.0 µg ml−1
  • a

    . The number of cfu on the drug-containing agar was counted and reported as a percentage of that counted on the agar with no drug.

  • b

    . Isoniazid.

  • c

    . Kanamycin.

No plasmid 0.06 0.06 0.06      
pMV261 0.06 0.06 0.06100 39100  0  0100
pMD31::SinhA>2.0>2.0>2.0100100100100100100
pMV261::inhA 2.0 2.0 2.0100100100100  0100
pMV261::kasA 0.06 0.06 0.06      
pMV261::kasB 0.06 0.06 0.06      
pMV261::kasAB 0.06 0.06 0.06100 49100  0  0100
pMH29::inhA   100100100100100100
pMH29::kasAB   100 72100  0  0100

In these experiments, DNA was isolated from the strains described above, and the inhA and kasA coding regions from the plasmids were sequenced and found to contain the expected wild-type DNA sequences. In addition, ≈50 independent transformants for each plasmid were pooled and streaked on plates containing 1 µg ml−1 INH. Just as observed in the single-transformant experiment, the pooled pMV261::inhA transformants grew on all the INH plates up to and including 2.0 µg ml−1, whereas none of the pooled pMV261::kasA, pMV261::kasB or pMV261::kasAB transformants grew on plates containing 0.1 µg ml−1 INH (data not shown). Moreover, the inhA plasmid conferred ETH resistance in M. tuberculosis, whereas the kasA or kasAB plasmids did not (data not shown). These results suggest that the increased resistance to INH and ETH was mediated by the overexpression of the M. tuberculosis inhA gene, and was not a result of other genetic events such as a spontaneous mutation.

Levels of resistance to INH were also determined using broth MIC analysis. As detailed in the Experimental procedures, cultures of M. tuberculosis H37Rv transformants were grown to saturation in media containing kanamycin to ensure maintenance of the plasmid. Cultures were diluted, and 1000–10 000 cells were inoculated into broth containing twofold serial dilutions of INH or ETH. As shown in Table 2, the MIC for the M. tuberculosis H37Rv (pMV261::inhA) strain was 2.0 µg ml−1. Neither the M. tuberculosis H37Rv (pMV261::kasA) strain nor the M. tuberculosis H37Rv (pMV261::kasAB) strain showed any increased level of INH resistance over the parent strain. Determination of broth MICs was also performed for the sets of M. bovis BCG and M. smegmatis transformants and confirmed our agar analyses (data not shown).

Thus, these results clearly demonstrate that the M. tuberculosis inhA gene expressed from a heterologous promoter on a multicopy plasmid confers a>20-fold increased resistance to INH and a>10-fold increased resistance to ETH to M. smegmatis, M. bovis BCG or M. tuberculosis H37Rv. In addition, these results show that the M. tuberculosis kasA gene expressed from the same promoter on the same plasmid confers no increased resistance to either INH or ETH in the same three mycobacterial species.

Determination of INH and ETH susceptibilities of two additional strains of M. tuberculosis, Erdman and CDC1551, transformed with pMV261::inhA or pMV261::kasA

To ensure that these results were general for M. tuberculosis strains, rather than a strain-specific phenomenon for M. tuberculosis H37Rv, the inhA and kasA plasmids were transformed into the Erdman and CDC1551 strains of M. tuberculosis. Broth dilution MIC analysis was performed as described above for the M. tuberculosis H37Rv strains, and the results were identical for the three M. tuberculosis strains (Table 2). Specifically, all three M. tuberculosis strains harbouring pMV261::inhA were resistant to 1.0 µg ml−1 INH. In contrast, none of the M. tuberculosis strains containing the kasA or kasB plasmids displayed even twofold increased resistance to INH. From this analysis, we concluded that the pMV261::inhA plasmid conferred >20-fold resistance to INH in three different M. tuberculosis strains, whereas the pMV261::kasA and pMV261::kasB plasmids conferred no increased resistance to INH when transformed into three different M. tuberculosis strains.

KasA and kasB plasmids confer resistance to thiolactomycin in M. smegmatis, M. bovis BCG and M. tuberculosis

Several laboratories have demonstrated that thiolactomycin (TLM) is an inhibitor of the FASII condensing enzyme β-ketoacyl-ACP synthase (Slayden et al., 1996). This activity of TLM makes it a useful reagent for assaying overexpression of the kasA, kasB or kasAB genes, which encode the two M. tuberculosis FasII β-ketoacyl-ACP synthases. For our purposes, TLM was used to verify that the mycobacterial strains containing the pMV261::kasA or pMV261::kasAB plasmids were indeed expressing active Kas proteins.Figure 2 shows that the M. smegmatis mc2155 strain, when transformed with pMV261::inhA, grew on INH media, but not on TLM-containing media. Conversely, M. smegmatis mc2155 transformed with pMV261::kasA grew on TLM-containing media but not on INH media. M. tuberculosis H37Rv transformants containing the inhA, kasA or kasAB plasmids were streaked on plates containing KM, INH, ETH or TLM. As shown in Fig. 3, the pMV261::kasA and pMV261::kasAB plasmids conferred resistance to TLM at 25 µg ml−1 (Fig. 3, quadrants 3 and 4), thus establishing overexpression of kasA and kasB. As expected based on the fact that TLM does not target InhA, pMV261 alone or pMV261::inhA in M. tuberculosis failed to confer any resistance to TLM (Fig. 3, quadrants 1 and 2). When the same strains were tested on plates containing INH or ETH, it was observed that only the strain containing pMV261::inhA conferred resistance to INH and ETH (Fig. 3). From these results, we conclude that overexpressed inhA confers at least 20-fold resistance to INH and 20-fold resistance to ETH in M. tuberculosis. In contrast, overexpressed kasA confers resistance to TLM, but no resistance to INH or ETH in M. tuberculosis.

image

Figure 2. Growth of M. smegmatis transformed with pMV261:: inhA or pMV261:: kasA on INH (25 µg ml −1 ) or TLM (25 µg ml −1 ).

Download figure to PowerPoint

image

Figure 3. Growth of M. tuberculosis transformed with pMV261, pMV261:: inhA , pMV261:: kasA , pMV261:: kasAB , pMH29:: inhA and pMH29:: kasAB on KM (20 µg ml −1 ), TLM (25 µg ml −1 ), INH (0.5 µg ml −1 ), INH (1 µg ml −1 ) or ETH (10 µg ml −1 ).

Download figure to PowerPoint

Slayden et al. (2000 ) obtained results that were op-posite to those presented above. They reported that M. tuberculosis H37Rv transformed with pMH29:: inhA showed only a twofold increase in resistance to INH, and that M. tuberculosis H37Rv transformed with pMH29:: kasAB yielded a fivefold increased resistance to INH. Their overexpression plasmids differed from our plasmids with respect to the promoters used for expression of inhA , kasA , kasB or kasAB . Therefore, we obtained the strains used by Slayden et al. (2000 ) and tested them under the same conditions as described above. The results are shown in Fig. 3 . M. tuberculosis H37Rv containing the pMH29:: kasAB plasmid clearly displayed resistance to 25 µg ml −1 TLM, demonstrating that the kasAB genes are overexpressed ( Fig. 3 , quadrant 6). However, the M. tuberculosis H37Rv strain containing pMH29:: kasAB failed to grow on INH or ETH plates, even at 0.1 µg ml −1 . In contrast, pMH29:: inhA transformants grew readily on INH and ETH plates, at 1.0 µg ml −1 and 10 µg ml −1 respectively ( Fig. 3 , Table 2 ). These results are not consistent with the published results of Slayden et al. (2000 ). We sequenced the promoter and coding regions of the pMH29:: inhA and pMH29: kasAB plasmids to confirm a wild-type pMH29 promoter in addition to wild-type M. tuberculosis inhA or kasAB genes (data not shown).

MIC determination by two independent clinical laboratories

Confirmation of these antibiotic susceptibility profiles was made by two independent clinical microbiology laboratories (Wadsworth Center, New York State Department of Health, Albany, NY, and the National Jewish Center, Denver, CO) on M. tuberculosis H37Rv transformants containing pMV261, pMD31::SinhA, pMV261::inhA, pMV261::kasA, pMV261::kasB, pMV261::kasAB, pMH29::inhA or pMH29::kasAB. The strains were randomized and given numbers 1 to 7 so that the analysis was blind. One laboratory screened the isolates using established critical concentrations in the radiometric BACTEC system and agar proportion methods, and then determined the MIC using the BACTEC system in the presence of kanamycin selection. The second laboratory determined the MIC using the BACTEC system and limiting dilution agar plate analysis. Table 3 shows that the results from the two different laboratories using different methods characterized all the strains containing kasAB as susceptible to INH, with a MIC of 0.05 µg ml−1. In contrast, the inhA transformants were characterized as INH resistant, with MICs of 0.8 and 1.0 µg ml−1. In addition, plasmid DNA was isolated by one laboratory from the strains used in the assays. Relevant regions of the plasmids were sequenced and found to contain the expected sequences. One of the laboratories tested the possibility that KM in the plates might affect susceptibilities to INH. However, no difference in results was observed when standard media were compared with media containing KM. Additionally, antibiotic susceptibility profiles were performed on 7H10 media supplemented with either ADS or OADC; less than a twofold difference in MIC was observed (data not shown).

Table 3. .  Susceptibility testing of M. tuberculosis H37Rv strains by independent clinical laboratories.
MethodBACTEC screenaAgar proportion method (% resistantb)aBACTEC MICaBACTEC MICc INH (µg ml−1)7H11 agar MICc INH (µg ml−1)
Antibiotic testedINH 0.1 µg ml−1INH 0.1 µg ml−1INH 0.2 µg ml−1INH 1.0 µg ml−1ETH 5.0 µg ml−1KM 5.0 µg ml−1INH (µg ml−1)ETH (µg ml−1)
  • a . Performed at New York State TB Laboratory, Albany, NY .

  • b

    . The number of cfu on the drug-containing agar were counted and reported as a percentage of those counted on the agar with no drug.

  • c

    . Performed at National Jewish Center, Denver, CO.

H37RvSS  0  0  0  00.05  0.3125 0.05 0.12
pMV261SS  0  0  01000.05  0.525 0.05 0.12
pMD31::SinhARR1001001001003.2>90.0>4.0>4.0
pMV261::inhARR  50  0  41000.9 10 1 2
pMV261::kasABSS  0  0  01000.05  0.3125 0.05 0.12
pMH29::inhARR100100 301000.9 20 1 4
pMH29::kasABSS  0  0  01000.05  0.3125 0.05 0.12

RT-PCR analysis of mRNA levels of inhA and kasA in the M. tuberculosis strains containing multicopy inhA or kasA plasmids

To determine whether overexpressed inhA and kasA mRNA levels correlate directly with INH resistance, we performed quantitative real-time reverse transcription polymerase chain reaction (RT-PCR) assays (Gold et al., 2001) in M. tuberculosis strains after incubation with INH. INH had been shown previously to induce kasA expression in INH-susceptible M. tuberculosis strains, but not in INH-resistant strains (Wilson et al., 1999). Messenger RNA was isolated from triplicate cultures of M. tuberculosis cells containing inhA or kasA plasmid immediately before the addition of INH and at 1 h and 4 h after the addition of INH (1 µg ml−1). Increased amounts of inhA mRNA were detected in both strains containing inhA plasmids (10-fold for pMV261::inhA; 90-fold for pMH29::inhA), compared with M. tuberculosis containing pMV261 at all time points (Fig. 4). The inhA mRNA levels of pMH29::inhA strain were higher than those of the pMV261::inhA strain, which correlates directly with the pMH29::inhA strain displaying a higher MIC for INH than the pMV261::inhA strain (Table 2).

image

Figure 4. Induction of kasA and inhA genes in M. tuberculosis H37Rv strains containing pMV261 (filled squares), pMV261:: inhA (filled triangles), pMV261:: kasA (filled circles), pMH29:: inhA (open triangles) or pMH29:: kasA (open circles). Cultures were incubated with 1 µg ml −1 INH for 0, 1 or 4 h at 37°C. Each value is the average of three culture replicates, each of which was evaluated twice. Error bars correspond to 95% confidence intervals.

Download figure to PowerPoint

Before the addition of INH, there was no significant increase in kasA mRNA expression in the kasA plasmid-containing strains compared with controls (Fig. 4). INH treatment had no effect on kasA mRNA levels in the INH-resistant strains containing pMV261::inhA and pMH29::inhA. In contrast, kasA mRNA levels were significantly increased in the pMV261 control strain and in the strains containing either pMV261::kasA or pMH29::kasA plasmid when these strains were treated with INH (Fig. 4). These results are consistent with our findings that the strains containing pMV261::kasA and pMH29::kasA are INH susceptible, and that overexpression of kasA to levels that are sufficient to bestow TLM resistance does not confer resistance to INH. Furthermore, overexpression of inhA does not affect kasA expression. That kasA RT-PCR results do not correlate with the TLM results suggests that kasA overexpression, although physiologically relevant, might be too small to be detected by the RT-PCR assay, or else that KasA is principally increased at the protein level and not at the mRNA level in these strains.

Discussion

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

Two different genes, inhA and kasA, have been postulated to encode the primary target for INH based on the abilities of each overexpressed gene to confer INH and ETH resistance to mycobacteria. As different laboratories have reported varied results as to the abilities of each overexpressed gene to confer INH resistance in M. tuberculosis, we have re-examined the mode of action of INH and ETH. Both inhA and kasA genes cloned downstream from two different highly active promoters on multicopy plasmids were analysed in M. smegmatis, M. bovis BCG and three different strains of M. tuberculosis. The resulting transformants were analysed by agar dilution analysis, broth dilution analysis or BACTEC analysis in four independent laboratories yielding one consistent set of results. First, all mycobacterial strains transformed with overexpression plasmids containing inhA20-fold increased resistance to INH and>10-fold increased resistance to ETH. The increased resistance to INH or ETH correlated directly with an increased level of inhA mRNA levels. Secondly, for all five mycobacterial strains, the transformants containing plasmids with kasA, kasB or kasAB conferred no detectable resistance to either INH or ETH. The inability to confer resistance to INH or ETH did not result from a failure to overexpress kasA as M. smegmatis, M. bovis BCG and M. tuberculosis containing the overexpressed kasA were resistant to the known condensing enzyme inhibitor TLM. We were able to achieve much higher levels of inhA overexpression than kasA overexpression using multicopy plasmids. It is possible that further expression of kasA might have resulted in INH resistance. However, all the INH-susceptible strains achieved very high levels of kasA expression upon INH treatment. Therefore, it is unlikely that any degree of kasA overexpression would have had a significant effect on INH MIC.

A series of articles has been published stating that inhA is not the primary target of INH, rather that kasA encodes the primary target of INH in M. tuberculosis (Mdluli et al., 1996; 1998; Barry, 1997; 2001; Slayden et al., 2000; Slayden and Barry, 2000). In a recent paper (Slayden et al., 2000), it was postulated that both inhA and kasA encode targets of INH, but that kasA encodes the primary target. This inference is based on the fact that an M. tuberculosis strain overexpressing kasA confers fivefold increased resistance to INH, and an M. tuberculosis strain overexpressing inhA yields a twofold increase in INH resistance (Slayden et al., 2000). Our results are contrary and led to significantly different conclusions than those of Slayden et al. (2000) as to the mechanism of action of INH and ETH. First, we did not observe any increased INH resistance with two independent sets of kasA or kasAB plasmids, including the strains from Slayden et al. (2000). Secondly, the level of increased INH resistance mediated by the inhA plasmid from their laboratory was 20- to 80-fold in our experiments instead of their reported twofold. These genetic data are consistent with the hypothesis that inhA encodes the primary target of INH and ETH in M. tuberculosis, M. bovis BCG and M. smegmatis. In contrast, we have been unable to find any genetic evidence that kasA encodes even a secondary target of INH or ETH.

In earlier work Mdluli et al. (1996) postulated that M. smegmatis possessed a different target for INH than M. tuberculosis because: (i) M. tuberculosis is 100-fold more sensitive to INH than M. smegmatis; (ii) multicopy plasmids containing inhA failed to confer INH resistance in M. tuberculosis; and (iii) the blocking of the inhA-encoded enoyl-ACP reductase could not readily account for the accumulation of a saturated C26 fatty acid in M. tuberculosis, a characteristic of INH treatment. However, the premise that M. smegmatis and M. tuberculosis have a different target for INH is countered by a number of lines of investigation. First, the 100-fold increased INH sensitivity of M. tuberculosis predominantly results from the expression of the M. tuberculosis katG-encoded catalase peroxidase (the activator of INH) in M. tuberculosis as expression of this gene from a multicopy plasmid increases the sensitivity of M. smegmatis to INH 10-fold. Secondly, the operon organization of the inhA gene of M. smegmatis differs from that of M. tuberculosis in that the M. smegmatis inhA gene is in an individual transcription unit, whereas the M. tuberculosis inhA gene is in an operon with mabA, the gene encoding the β-ketoacyl-ACP reductase (Banerjee et al., 1998). The failure of multicopy plasmids to express inhA is probably a result of the tight regulation of the inhA operon in M. tuberculosis. Thus, INH resistance can be readily transferred to M. tuberculosis with the M. smegmatis inhA gene or M. tuberculosis inhA gene fused to an efficiently expressed promoter. Lastly, the premise that inhibition of InhA could not account for the accumulation of a saturated C26 fatty acid is incorrect as Vilcheze et al. (2000) have shown that thermal inactivation of a temperature-sensitive InhA protein in M. smegmatis leads to the accumulation of the FASI end-product, the saturated C24 fatty acid, with no detectable unsaturated intermediates. The saturated C24 fatty acid, instead of the saturated C26 fatty acid, had been expected, as in vitro studies had established that FASI of M. tuberculosis and M. smegmatis make C26:0 (Kikuchi et al., 1992) and C24:0 (Peterson and Bloch, 1977) respectively. Thus, the correlation of genetic, biochemical and structural data demonstrate that M. tuberculosis and M. smegmatis share a common target.

The role that KasA plays in INH action is unclear. To date, there is only one report of a gene transfer experiment to establish INH resistance mediated by kasA or a kasA allele (Slayden et al., 2000). However, as detailed earlier, these results are not consistent with the data reported here. Therefore, we question the conclusion that kasA is the primary target of INH. Characterization of clinical isolates of kasA alleles has yielded different results, as four independent mutations had been described in INH-resistant mutants of M. tuberculosis (Mdluli et al., 1996), but three of these mutations have been found in INH-sensitive M. tuberculosis (Piatek et al., 2000; Lee et al., 2001). No studies have yet demonstrated that INH inhibits purified KasA activity. Mdluli and co-workers report that radioactive INH co-migrates with a KasA–ACP covalent complex, but the nature of that interaction is unclear. As a KasA–ACP covalent complex has been reported for E. coli (Rock and Cronan, 1996), it will be necessary to repeat, quantify and define the nature of this binding in M. tuberculosis. More studies will be required to define the role of KasA in INH action.

For 50 years, isoniazid has been a frontline antibiotic in the treatment of tuberculosis, making isoniazid one of the most widely used and effective chemotherapeutic agents ever developed. Knowledge of the mechanism of action of INH will potentially lead to novel treatments of mycobacterial infections, treatment of INH-resistant strains and understanding of a pathway that ends in cell lysis and death. Moreover, knowledge of the primary target will lead to novel inhibitors by way of high-throughput screens and structure-based drug design methods (Duncan and Sacchettini, 2000).

Experimental procedures

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

Media and plasmids

Plasmids used in this study are listed in Table 1. M. tuberculosis strains were grown in Middlebrook 7H9 broth (Difco) supplemented with 0.2% glycerol, 10% OADC (Difco) and 0.05% Tween 80. M. bovis BCG and M. smegmatis strains were grown in Middlebrook 7H9 broth (Difco) supplemented with 0.2% glycerol, 0.5% bovine serum albumin (BSA), 0.2% dextrose, 0.85% sodium chloride and 0.05% Tween 80. The cultures were incubated at 37°C while standing for 2–3 weeks (M. tuberculosis and M. bovis strains) or shaking for 2 days (M. smegmatis strains).

Transformation experiments

The mycobacterial cultures were grown at 37°C as described above until they reached an optical density at 600 nm (OD600) of 0.8–1. The cultures were spun and pellets were washed with 10% glycerol twice and resuspended in 10% glycerol (1/10th of the initial culture volume). The cell suspensions were mixed with plasmid DNA and electroporated (2500 V, 25 µFd, 1000 Ω). The cell preparations and electroporations were done at 4°C for M. smegmatis and at room temperature for M. tuberculosis and M. bovis strains. The resulting suspensions were incubated at 37°C for 2 h for M. smegmatis and overnight for M. bovis and M. tuberculosis then plated on KM (20 µg ml−1)-containing plates (Middlebrook 7H10 media supplemented as described above).

Determination of MIC using broth macrodilution method

The mycobacterial cultures were grown at 37°C (OD600 ≈0.8) and diluted to obtain 103−104 cells ml−1. The diluted suspensions (100 µl) were added to tubes containing Middlebrook 7H9 broth (2 ml), supplemented as described above, with increasing concentration of isoniazid. For M. tuberculosis and M. bovis strains, the concentrations (in µg ml−1) were as follows: 0, 0.015, 0.03, 0.06, 0.12, 0.25, 0.5, 1, 2 and 4. For M. smegmatis strains, the concentrations (in µg ml−1) were as follows: 0, 1.5, 3, 6, 12.5, 25, 50, 75 and 100.

Determination of MIC using radiometric (BACTEC) method

The source of inoculum for susceptibility testing was freshly grown M. tuberculosis from a primary 7H12 liquid medium (BACTEC 12B vial) with a GI reading between 900 and 999. After vortexing and mixing with the syringe to break up clumps of bacteria, 0.1 ml of the suspension was used to inoculate vials containing various concentrations of drugs and a control vial (C-0) without any drug. A 1:100 dilution of the suspension was used to inoculate a second control vial (C-100). When growth in the C-100 control vial, inoculated with 1% of the inoculum in the drug-containing vials, reached a GI of 30, it was used to compare increases in daily readings of the drug-containing vials. When the difference in the GI values between two consecutive days in the drug-containing vial was less than that in the C-100 vial, the strain was determined to be susceptible; when the difference was more, the strain was resistant. The concentrations of INH tested were 12 serial dilutions from 0.006 to 12.8 µg ml−1 and, for ETH, 11 serial dilutions from 0.078 to 80.0 µg ml−1. This assay was performed in the presence or absence of 10 µg ml−1 KM.

Determination of MIC using the agar proportion method

Actively growing BACTEC 12B cultures were checked daily until the GI reading reached 999 for two consecutive days. Controls with no drugs or drug-containing 7H10 agar slants were inoculated with 0.1 ml of a well-dispersed suspension. The control slants were checked once a week for 3 weeks until the no-drug control contained at least 50–150 visible colonies. The number of colonies on the drug-containing media was reported as a percentage of the number of colonies on the no-drug control. When the percentage of colonies was>1%, the isolate was scored as resistant to that drug at the concentration tested. The concentrations tested for INH were 0.2 and 1.0 µg ml−1, whereas ETH and KM were each tested at 5.0 µg ml−1.

Isolation of plasmids from mycobacterial cultures

Total DNA was isolated from cultures of M. tuberculosis as follows. A 15 ml bacterial culture was grown to saturation, and the cells were pelleted. The growth medium was removed, and the pellet was resuspended in an equal volume of GTE (50 mM glucose, 25 mM Tris-HCl, pH 8.0, 10 mM EDTA). Cells were pelleted and resuspended in 450 µl of GTE. An aliquot of 50 µl of a 10 mg ml−1 lysozyme (Sigma) solution was added, and the cell suspension was incubated overnight at 37°C. Samples of 100 µl of 10% sodium dodecyl sulphate (SDS) and 50 µl of 10 mg ml−1 proteinase K (Sigma) were added to the cell suspension, which was then incubated at 55°C for 30 min. Samples of 200 µl of 5 M NaCl and 160 µl of CTAB (hexadecytrimethyl ammonium bromide) preheated to 65°C were added to the cell suspension, followed by incubation at 65°C for 10 min. Chloroform–isoamyl alcohol (24:1; 1 ml) was added to the cell lysates, which were mixed gently. The samples were then microcentrifuged for 5 min. A sample of 900 µl of the aqueous layer was removed to a fresh microcentrifuge tube, and the chloroform–isoamyl alcohol extraction was repeated. An aliquot of 800 µl of the resulting aqueous phase was removed and mixed with 560 µl of isopropanol. DNA was precipitated by gently mixing the solution and incubating at room temperature. The DNA was microcentrifuged for 10 min, and the pellet was washed with 70% ethanol. After the supernatant was aspirated, the pellet was air dried and then resuspended in 50 µl of TE (Tris-EDTA). Each DNA solution (1 µl) was used to transform either DH5α or HB101 strains of E. coli. Transformants were selected on LB media containing 40 µg ml−1 KM. Plasmid DNA preparations were made from the E. coli transformants for further characterization.

Total RNA extraction

Cell pellets from 20 ml of cultures with an OD600 of 0.8 were resuspended in 1.5 ml of Trizol (Gibco BRL). This suspension was then transferred to a 2 ml screw-cap microcentrifuge tube containing 60% of its volume in 0.1 mm zirconia/silica beads (Biospec Products). Tubes were filled with Trizol and placed in a Mini-Bead Beater 8 (Biospec Products), which was run at 3200 r.p.m. for 7 min. The tubes were then placed on ice for 5 min. The supernatants were collected and mixed with 500 µl of Trizol and 300 µl of chloroform and centrifuged for 15 min at 9000 g at 4°C. Upper phases were mixed with 0.6 volume of isopropanol, followed by an overnight incubation at −70°C. Tubes were microcentrifuged at 15 000 g for 30 min, and the pellets were washed with 70% ethanol. Pellets were resuspended in water, and DNA contamination was minimized using 4 U of RQ1 DNase and 40 U of RNasin (Promega) for 20 min at 37°C. Total RNA was purified using the Qiagen RNeasy mini kit according to the manufacturer's recommendations.

CDNA synthesis

The cDNA was synthesized using 200 ng of RNA with the CTherm polymerase (Roche Molecular Biochemicals) according to the manufacturer's recommendations. Per reaction, 75 fmol of each of the antisense primers was used (Table 4). As control for chromosomal DNA contamination, a control reaction was performed by replacing the CTherm enzyme volume with water. The cDNA polymerization was performed at 60°C for 30 min, followed by an inactivation for 2 min at 95°C. The cDNA was diluted 10 times, and 2 µl was used per PCR.

Table 4. .  PCR primers and molecular beacons used for the RT-PCR.
GeneNameSequence 5′[RIGHTWARDS ARROW]3′aFunctionReference
  • a

    . Underlined sequences indicate the inverted repeated arms of the molecular beacons. Fluorophores: TET (tetramethylrhodamine) and FAM (fluorescein). Quencher: DABCYL. The co-ordinates of the beacons are available upon request.

sigA sigA.1–ctgacatgggggcccgctacgttgAntisense primer Gold et al. (2001 )
sigA + 0.2ggccagccgcgcacccttgacForward amplification 
sigA – 0.2gtccaggtagtcgcgcaggaccReverse amplification 
sigA-FAMFAM-CCTCGCgtcgaagttgcgccatccgaGCGAGG-DABCYLMolecular beacon 
inhA inhAR2tgggcgccctgctcctggAntisense primerThis study
inhAF4ctggacggcaaacggattctggtForward amplification 
inhAR4gctacccgtgcgatgtgaaacReverse amplification 
inhA16-21TET-CGAAGCCtcatcaccgactcgtcgatcgcGGCTTCG-DABCYLMolecular beacon 
kasA kasAR1tgggcatgatcatctgaacgAntisense primerThis study
kasAF5gccgttgttgtcggcaccgForward amplification 
kasAR4gaacggccagcggggacacReverse amplification 
kasA121TET-CGCATCagccgagaggattgtcgagaGATGCG-DABCYLMolecular beacon 
aph aphR4gtacggataaaatgcttgatggtcggAntisense primerThis study
aphF3gttgccaatgatgttacagatgagatggForward amplification 
aphR3aatgcttgatggtcggaagaggcReverse amplification 
aphBeaconFAM-GCGCTGagactaaactggctgacggaCAGCGC-DABCYLMolecular beacon 

PCR primers and molecular beacons design

The molecular beacons and PCR primers used in this study are shown in Table 4. PCR primers (Invitrogen) were de-signed to anneal to their targets at 60°C, using the primer express software (version 1.5a, Applied Biosystems). Mol-ecular beacons (Biosearch Technologies) were designed to anneal to their target sequences at 60°C as described (http:www.molecular-beacons.org).

PCR with molecular beacons

PCR and mRNA quantification was performed as described previously (Manganelli et al., 1999; Gold et al., 2001), except that an Applied Biosystems 7900HT sequence detector system and 384-well plates were used for real-time PCR and analysis. Each 5 µl contained 1× Amplitaq Gold polymerase buffer (Perkin-Elmer), 4 mM MgCl2, 2.5 pmol of each primer, 0.25 U of Amplitaq Gold polymerase and 5 ng of each molecular beacon. ROX [6-carboxy-X-rhodamine, succinimidyl ester (6-ROX, SE) Molecular Probes] was used as a reference dye; it was added in sufficient quantity so that its fluorescence was equivalent to 1/10th to one-third of the beacon's expected fluorescence. A molecular beacon specific to the M. tuberculosis sigA gene was used as reference gene (Manganelli et al., 1999), and the aph gene that confers KM resistance to each of the plasmids was used to confirm the presence of the plasmids in each strain. Quantification of inhA and kasA mRNA was performed in multiplex PCRs containing primers and molecular beacons specific to sigA and kasA or inhA in the same reaction well. The presence of the aph gene was assessed in separate wells.

PCR conditions were: 10 min at 95°C, 30 s at 60°C, followed by 40 cycles of 72°C for 30 s, 95°C for 20 s and 60°C for 30 s. The data from the last step were collected and analysed with sds software version 2.0a23 (Applied Biosystems). External standards for quantitative analysis included 10-fold dilutions (between 107 and 103 genomes) of M. tuberculosis H37Rv genomic DNA or similar quantities of pMV261 (vector) molecules. Quantitative results for inhA and kasA cDNA were normalized to the number of sigA cDNA molecules measured in the same reaction well. Chromosomal DNA contamination was measured by performance of real-time PCR of control ‘cDNA’ synthesized without the addition of the reverse transcriptase. The number of contaminating genomic DNA molecules was then subtracted from each sample when necessary. Analysis was based on at least three replicates per sample.

Acknowledgements

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

This work was supported by NIH grant AI46669, the Medical Research Council (49343 and 49338), the National Cooperative Drug Discovery Groups for the Treatment of Opportunistic Infections (NCDDG-OI), NIAID and NIH (AI-38087). G.S.B. is currently a Lister Institute Jenner Research Fellow, and L.K. was supported through a Heiser Trust postdoctoral fellowship. The authors wish to acknowledge Dr Benjamin Gold (for RT-PCR support) and Dr Clifton Barry (for H37Rv strains containing pMH29::inhA and pMH29::kasAB and permission to send the strains to independent clinical laboratories). Thanks also to Keith Derbyshire and Michael Glickman for critical reading of the manuscript.

References

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References
  • Baca , A.M. , Sirawaraporn , R. , Turley , S. , Sirawaraporn , W. , and Hol , W.G. ( 2000 ) Crystal structure of Mycobacterium tuberculosis 7,8-dihydropteroate synthase in complex with pterin monophosphate: new insight into the enzymatic mechanism and sulfa-drug action . J Mol Biol 302 : 11931212 .
  • Banerjee , A. , Dubnau , E. , Quemard , A. , Balasubramanian , V. , Um , K.S. , Wilson , T. , et al. ( 1994 ) inhA , a gene encoding a target for isoniazid and ethionamide in Mycobacterium tuberculosis . Science 263 : 227230 .
  • Banerjee , A. , Sugantino , M. , Sacchettini , J.C. , and Jacobs , W.R. ( 1998 ) The mabA gene from the inhA operon of Mycobacterium tuberculosis encodes a 3-ketoacyl reductase that fails to confer isoniazid resistance . Microbiology 144 : 26972704 .
  • Barry , C.E. , III ( 1997 ) New horizons in the treatment of tuberculosis . Biochem Pharmacol 54 : 11651172 .
  • Barry , C.E. ( 2001 ) Mycobacterium smegmatis : an absurd model for tuberculosis? Trends Microbiol 9 : 473474 .
  • Basso , L.A. , Zheng , R. , Musser , J.M. , Jacobs , W.R. , and Blanchard , J.S. ( 1998 ) Mechanisms of isoniazid resistance in Mycobacterium tuberculosis: enzymatic characterization of enoyl reductase mutants identified in isoniazid-resistant clinical isolates . J Infect Dis 178 : 769775 .
  • Baulard , A.R. , Betts , J.C. , Engohang-Ndong , J. , Quan , S. , McAdam , R.A. , Brennan , P.J. , et al. ( 2000 ) Activation of the pro-drug ethionamide is regulated in mycobacteria . J Biol Chem 275 : 2832628331 .
  • Bernstein , J.W. , Lott , W.A. , Steinberg , B.A. , and Yale , H.L. ( 1952 ) Chemotherapy of experimental tuberculosis . Am Rev Tuberc 65 : 357374 .
  • Davies , R.W. , and Gronenborn , A.M. ( 1982 ) Molecular cloning of the gene for dihydrofolate reductase from Lactobacillus casei . Gene 17 : 229233 .
  • DeBarber , A.E. , Mdluli , K. , Bosman , M. , Bekker , L.G. , and Barry , C.E. , III ( 2000 ) Ethionamide activation and sensitivity in multidrug-resistant Mycobacterium tuberculosis . Proc Natl Acad Sci USA 97 : 96779682 .
  • Dessen , A. , Quemard , A. , Blanchard , J.S. , Jacobs , W.R. , and Sacchettini , J.C. ( 1995 ) Crystal structure and function of the isoniazid target of Mycobacterium tuberculosis . Science 267 : 16381641 .
  • Donnelly-Wu , M.K. , Jacobs , W.R. , Jr , and Hatfull , G.F. ( 1993 ) Superinfection immunity of mycobacteriophage L5: applications for genetic transformation of mycobacteria . Mol Microbiol 7 : 407417 .
  • Dubnau , E. , Fontan , P. , Manganelli , R. , Soares-Appel , S. , and Smith , I. ( 2002 ) Mycobacterium tuberculosis genes induced during infection of human macrophages. Infect Immun 70 : 27872795 .
  • Duncan , K. , and Sacchettini , J.C. ( 2000 ) Approaches to tuberculosis drug development . In Molecular Genetics of Mycobacteria . Hatfull , G.F. , and Jacobs , W.R. (eds) . Washington, DC : American Society for Microbiology Press , pp. 297312 .
  • Fox , H.H. ( 1952 ) The chemical approach to the control of tuberculosis . Science 116 : 129134 .
  • Gold , B. , Rodriquez , R. , Marras , S. , Pentecost , M. , and Smith , I. ( 2001 ) The Mycobacterium tuberculosis IdeR is a dual functional regulator that controls transcription of genes involved in iron acquisition, iron storage, and survival in macrophages . Mol Microbiol 42 : 851865 .
  • Hampele , I.C. , D’Arcy , A. , Dale , G.E. , Kostrewa , D. , Nielsen , J. , Oefner , C. , et al. ( 1997 ) Structure and function of the dihydropteroate synthase from Staphylococcus aureus . J Mol Biol 268 : 2130 .
  • Heifets , L.B. ( 1991 ) Drug Susceptibility in the Chemotherapy of Mycobacterial Infections . Boston : CRC Press .
  • Heym , B. , Honore , N. , Truffot-Pernot , C. , Banerjee , A. , Schurra , C. , Jacobs , W.R. , et al. ( 1994 ) Implications of multidrug resistance for the future of short-course chemotherapy of tuberculosis: a molecular study . Lancet 344 : 293298 .
  • Johnsson , K. , and Schultz , P.G. ( 1994 ) Mechanistics studies of the oxidation of isoniazid by the catalase peroxidase from Mycobacterium tuberculosis . J Am Chem Soc 116 : 74257426 .
  • Kiepiela , P. , Bishop , K. , Smith , A.N. , Roux , L. , and York , D.F. ( 2000 ) Genomic mutations in the katG, inhA and aphC genes are useful for the prediction of isoniazid resistance in Mycobacterium tuberculosis isolates from Kwazulu Natal, South Africa . Tubercle Lung Dis 80 : 4756 .
  • Kikuchi , S. , Rainwater , D.L. , and Kolattukudy , P.E. ( 1992 ) Purification and characterization of an unusually large fatty acid synthase from Mycobacterium tuberculosis var. bovis BCG . Arch Biochem Biophys 295 : 318326 .
  • Kremer , L. , Douglas , J.D. , Baulard , A.R. , Morehouse , C. , Guy , M.R. , Alland , D. , et al. ( 2000 ) Thiolactomycin and related analogues as novel anti-mycobacterial agents targeting KasA and KasB condensing enzymes in Mycobacterium tuberculosis . J Biol Chem 275 : 1685716864 .
  • Lee , A.S. , Lim , I.H. , Tang , L.L. , Telenti , A. , and Wong , S.Y. ( 1999 ) Contribution of kasA analysis to detection of isoniazid-resistant Mycobacterium tuberculosis. Singapore . Antimicrob Agents Chemother 43 : 20872089 .
  • Lee , A.S. , Teo , A.S. , and Wong , S.Y. ( 2001 ) Novel mutations in ndh in isoniazid-resistant Mycobacterium tuberculosis isolates . Antimicrob Agents Chemother 45 : 21572159 .
  • Leszczynska , K. , Bolhuis , A. , Leenhouts , K. , Venema , G. , and Ceglowski , P. ( 1995 ) Cloning and molecular analysis of the dihydrofolate reductase gene from Lactococcus lactis . Appl Environ Microbiol 61 : 561566 .
  • Li , R. , Sirawaraporn , R. , Chitnumsub , P. , Sirawaraporn , W. , Wooden , J. , Athappilly , F. , et al. ( 2000 ) Three-dimensional structure of M. tuberculosis dihydrofolate reductase reveals opportunities for the design of novel tuberculosis drugs . J Mol Biol 295 : 307323 .
  • Manganelli , R. , Dubnau , E. , Tyagi , S. , Kramer , F.R. , and Smith , I. ( 1999 ) Differential expression of 10 sigma factor genes in Mycobacterium tuberculosis . Mol Microbiol 31 : 715724 .
  • Mdluli , K. , Sherman , D.R. , Hickey , M.J. , Kreiswirth , B.N. , Morris , S. , Stover , C.K. , and Barry , C.E. ( 1996 ) Biochemical and genetic data suggest that InhA is not the primary target for activated isoniazid in Mycobacterium tuberculosis . J Infect Dis 174 : 10851090 .
  • Mdluli , K. , Slayden , R.A. , Zhu , Y. , Ramaswamy , S. , Pan , X. , Mead , D. , et al. ( 1998 ) Inhibition of a Mycobacterium tuberculosis beta-ketoacyl ACP synthase by isoniazid . Science 280 : 16071610 .
  • Nagate , T. , Inoue , M. , Inoue , K. , and Mitsuhashi , S. ( 1978 ) Plasmid-mediated sulfanilamide resistance . Microbiol Immunol 22 : 367375 .
  • O'Brien , K.L. , Dietz , H.C. , Romagnoli , M. , and Eiden , J. ( 1996 ) Evaluation of inhA gene and catalase-peroxidase gene among isoniazid-sensitive and resistant Mycobacterium tuberculosis isolates . Mol Cell Probes 10 : 16 .
  • Peterson , D.O. , and Bloch , K. ( 1977 ) Mycobacterium smegmatis fatty acid synthetase. Long chain transacylase chain length specificity . J Biol Chem 252 : 57355739 .
  • Piatek , A.S. , Telenti , A. , Murray , M.R. , El-Hajj , H. , Jacobs , W.R. , Jr, Kramer , F.R. , and Alland , D. ( 2000 ) Genotypic analysis of Mycobacterium tuberculosis. two distinct populations using molecular beacons: implications for rapid susceptibility testing . Antimicrob Agents Chemother 44 : 103110 .
  • Quemard , A. , Sacchettini , J.C. , Dessen , A. , Vilcheze , C. , Bittman , R. , Jacobs , W.R. , and Blanchard , J.S. ( 1995 ) Enzymatic characterization of the target for isoniazid in Mycobacterium tuberculosis . Biochemistry 34 : 82358241 .
  • Quemard , A. , Dessen , A. , Sugantino , M. , Jacobs , W.R. , Sacchettini , J.C. , and Blanchard , J.S. ( 1996 ) Binding of catalase-peroxidase activated isoniazid to wild-type and mutant Mycobacterium tuberculosis enoyl-ACP reductases . J Am Chem Soc 118 : 15611562 .
  • Ristow , M. , Mohlig , M. , Rifai , M. , Schatz , H. , Feldmann , K. , and Pfeiffer , A. ( 1995 ) New isoniazid/ethionamide resistance gene mutation and screening for multidrug-resistant Mycobacterium tuberculosis strains . Lancet 346 : 502503 .
  • Rock , C.O. , and Cronan , J.E. ( 1996 ) Escherichia coli as a model for the regulation of dissociable (type II) fatty acid biosynthesis . Biochim Biophys Acta 1302 : 116 .
  • Rouse , D.A. , Li , Z. , Bai , G.H. , and Morris , S.L. ( 1995 ) Characterization of the katG and inhA genes of isoniazid-resistant clinical isolates of Mycobacterium tuberculosis . Antimicrob Agents Chemother 39 : 24722477 .
  • Rozwarski , D.A. , Grant , G.A. , Barton , D.H. , Jacobs , W.R. , and Sacchettini , J.C. ( 1998 ) Modification of the NADH of the isoniazid target (InhA) from Mycobacterium tuberculosis . Science 279 : 98102 .
  • Schimke , R.T. , Kaufman , R.J. , Alt , F.W. , and Kellems , R.F. ( 1978 ) Gene amplification and drug resistance in cultured murine cells . Science 202 : 10511055 .
  • Skold , O. ( 1976 ) R-factor-mediated resistance to sulfonamides by a plasmid-borne, drug-resistant dihydropteroate synthase . Antimicrob Agents Chemother 9 : 4954 .
  • Slayden , R.A. , and Barry , C.E. , III ( 2000 ) The genetics and biochemistry of isoniazid resistance in Mycobacterium tuberculosis . Microbes Infect 2 : 659669 .
  • Slayden , R.A. , Lee , R.E. , Armour , J.W. , Cooper , A.M. , Orme , I.M. , Brennan , P.J. , and Besra , G.S. ( 1996 ) Antimycobacterial action of thiolactomycin: an inhibitor of fatty acid and mycolic acid synthesis . Antimicrob Agents Chemother 40 : 28132819 .
  • Slayden , R.A. , Lee , R.E. , and Barry , C.E. ( 2000 ) Isoniazid affects multiple components of the type II fatty acid synthase system of Mycobacterium tuberculosis . Mol Microbiol 38 : 514525 .
  • Smith , D.R. , Rood , J.I. , Bird , P.I. , Sneddon , M.K. , Calvo , J.M. , and Morrison , J.F. ( 1982 ) Amplification and modification of dihydrofolate reductase in Escherichia coli. Nucleotide sequence of fol genes from mutationally altered plasmids . J Biol Chem 257 : 90439048 .
  • Snapper , S.B. , Lugosi , L. , Jekkel , A. , Melton , R.E. , Kieser , T. , Bloom , B.R. , and Jacobs , W.R. , Jr ( 1988 ) Lysogeny and transformation in mycobacteria: stable expression of foreign genes . Proc Natl Acad Sci USA 85 : 69876991 .
  • Snapper , S.B. , Melton , R.E. , Mustafa , S. , Kieser , T. , and Jacobs , W.R. , Jr ( 1990 ) Isolation and characterization of efficient plasmid transformation mutants of Mycobacterium smegmatis . Mol Microbiol 4 : 19111919 .
  • Stover , C.K. , de la Cruz , V.F. , Fuerst , T.R. , Burlein , J.E. , Benson , L.A. , Bennett , L.T. , et al. ( 1991 ) New use of BCG for recombinant vaccines . Nature 351 : 456460 .
  • Swedberg , G. , Castensson , S. , and Skold , O. ( 1979 ) Characterization of mutationally altered dihydropteroate synthase and its ability to form a sulfonamide-containing dihydrofolate analog . J Bacteriol 137 : 129136 .
  • Takayama , K. , Wang , L. , and David , H.L. ( 1972 ) Effect of isoniazid on the in vivo mycolic acid synthesis, cell growth, and viability of Mycobacterium tuberculosis . Antimicrob Agents Chemother 2 : 2935 .
  • Takayama , K. , Schnoes , H.K. , Armstrong , E.L. , and Boyle , R.W. ( 1975 ) Site of inhibitory action of isoniazid in the synthesis of mycolic acids in Mycobacterium tuberculosis . J Lipid Res 16 : 308317 .
  • Telenti , A. , Honore , N. , Bernasconi , C. , March , J. , Ortega , A. , Heym , B. , et al. ( 1997 ) Genotypic assessment of isoniazid and rifampin resistance in Mycobacterium tuberculosis: a blind study at reference laboratory level . J Clin Microbiol 35 : 719723 .
  • Vilcheze , C. , Morbidoni , H.R. , Weisbrod , T.R. , Iwamoto , H. , Kuo , M. , Sacchettini , J.C. , and Jacobs , W.R. ( 2000 ) Inactivation of the inhA-encoded fatty acid synthase II (FASII) enoyl-acyl carrier protein reductase induces accumulation of the FASI end products and cell lysis of Mycobacterium smegmatis . J Bacteriol 182 : 40594067 .
  • Wilson , T.M. , de Lisle , G.W. , and Collins , D.M. ( 1995 ) Effect of inhA and katG on isoniazid resistance and virulence of Mycobacterium bovis . Mol Microbiol 15 : 10091015 .
  • Wilson , M. , DeRisi , J. , Kristensen , H.H. , Imboden , P. , Rane , S. , Brown , P.O. , and Schoolnik , G.K. ( 1999 ) Exploring drug-induced alterations in gene expression in Mycobacterium tuberculosis by microarray hybridization . Proc Natl Acad Sci USA 96 : 1283312838 .
  • Winder , F.G. , and Collins , P.B. ( 1970 ) Inhibition by isoniazid of synthesis of mycolic acids in Mycobacterium tuberculosis . J Gen Microbiol 63 : 4148 .
  • Wise , E.M. , Jr , and Abou-Donia , M.M. ( 1975 ) Sulfonamide resistance mechanism in Escherichia coli: R plasmids can determine sulfonamide-resistant dihydropteroate synthases . Proc Natl Acad Sci USA 72 : 26212625 .
  • Zhang , Y. , Heym , B. , Allen , B. , Young , D. , and Cole , S. ( 1992 ) The catalase-peroxidase gene and isoniazid resistance of Mycobacterium tuberculosis . Nature 358 : 591593 .
  • Zhang , Y. , Garbe , T. , and Young , D. ( 1993 ) Transformation with katG restores isoniazid-sensitivity in Mycobacterium tuberculosis isolates resistant to a range of drug concentrations . Mol Microbiol 8 : 521524 .