SEARCH

SEARCH BY CITATION

Summary

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

Nitrogen assimilation in the methanogenic archaeon Methanococcus maripaludis is regulated by transcriptional repression involving a palindromic ‘nitrogen operator’ repressor binding sequence. Here we report the isolation of the nitrogen repressor, NrpR, from M. maripaludis using DNA affinity purification. Deletion of the nrpR gene resulted in loss of nitrogen operator binding activity in cell extracts and loss of repression of nif (nitrogen-fixation) and glnA (glutamine synthetase) gene expression in vivo. Genetic complementation of the nrpR mutation restored all functions. NrpR contained a putative N-terminal winged helix–turn–helix motif followed by two mutually homologous domains of unknown function. Comparison of the migration of NrpR in gel-filtration chromatography with its subunit molecular weight (60 kDa) suggested that NrpR was a tetramer. Several lines of evidence suggested that the level of NrpR itself is not regulated, and the binding affinity of NrpR to the nitrogen operator is controlled by an unknown mechanism. Homologues of NrpR were found only in certain species in the kingdom Euryarchaeota. Full length homologues were found in Methanocaldococcus jannaschii and Methanothermobacter thermoautotrophicus, and homologues lacking one or more of the three polypeptide domains were found in Archaeoglobus fulgidus, Methanopyrus kandleri, Methanosarcina acetivorans, and Methanosarcina mazei. NrpR represents a new family of regulators unique to the Euryarchaeota.


Introduction

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

Among the three domains of life, the Archaea and Bacteria are similar in overall cellular structure and the possession of wide metabolic and physiological diversity (Barns et al., 1996; Hugenholtz et al., 1998). However, the two domains are distinct at the molecular level, with Archaea tending more to resemble Eukarya. Transcription is a prime example (Thomm, 1996; Soppa, 1999). Most bacterial promoters resemble the canonical promoter of Escherichia coli, with two conserved hexameric sequences placed about 35 and 10 basepairs upstream of the transcription start site (Record et al., 1996). Transcription may be initiated when the sigma factor that associates with the four-subunit core RNA polymerase recognizes and binds the promoter (Record et al., 1996). In contrast, archaeal promoters are characterized by an octameric AT-rich element (TATA box) about 25 bp upstream of the transcription start site (Bell and Jackson, 2001), similar to the case in eukaryotes. The TATA box is usually preceded by a purine-rich B-recognition element (BRE) that helps determine the orientation of transcription (Bell et al., 1999a). Homologues of the eukaryotic transcription factors TATA box binding protein (TBP) and transcription factor TFIIB (TFB in Archaea) recognize and bind these elements and recruit the archaeal RNA polymerase (8–13 subunits homologous to those of eukaryotic RNA polymerase II) to the promoter (Hausner et al., 1996). This combination of factors constitutes a functional cell-free transcription system (Bell and Jackson, 2001), although recently an additional factor, a homologue of the eukaryotic transcription factor TFIIE, was found to increase transcription in vitro (Bell et al., 2001; Hanzelka et al., 2001). Thus, the archaeal transcription complex is essentially a simplified version of the eukaryotic transcription complex, which involves additional factors (Bell and Jackson, 1998; Kornberg, 1999).

Despite the resemblance between the archaeal and eukaryotic transcriptional apparatus, the sequencing of archaeal genomes has revealed a surprisingly greater abundance of homologues to bacterial transcriptional regulators than eukaryotic ones (Aravind and Koonin, 1999; Kyrpides and Ouzounis, 1999). This finding has led to a desire to understand the interactions between these regulators and the eukaryotic-like transcription apparatus in Archaea. Recently, some data along these lines have emerged. For example, homologues of the bacterial Lrp (leucine responsive protein) in Pyrococcus furiosus, Sulfolobus sulfataricus and Methanocaldococcus jannaschii (formerly Methanococcus jannaschii) bind to their own promoter regions in vitro, resulting in autorepression (Napoli et al., 1999; Bell and Jackson, 2000; Brinkman et al., 2000; Ouhammouch and Geiduschek, 2001; Dahlke and Thomm, 2002). In addition, an Lrp homologue in Sulfolobus sulfataricus activates transcription of lysine metabolizing genes (Brinkman et al., 2002). In Archaeoglobus fulgidus, MDR1, a homologue of the bacterial metal-dependent repressor DtxR, inhibits transcription of its own operon in vitro by binding to three operator elements that overlap the transcription start site (Bell et al., 1999b). Similar to DtxR, the binding properties of MDR1 are regulated by iron. Regulators with characteristics of eukaryotic systems are found as well. In Methanothermobacter thermoautotrophicus (formerly Methanobacterium thermoautotrophicum strain ΔH), Tfx binds in vitro to a site downstream of the promoter for the fmdECB operon encoding the molybdenum formylmethanofuran dehydrogenase. Tfx contains a possible acidic activation domain reminiscent of eukaryotic regulators (Hochheimer et al., 1999). GvpE from Haloferax mediterranei activates transcription of gas vacuole genes, and belongs to the leucine zipper class of eukaryotic transcriptional regulators (Kruger et al., 1998). These observations show that Archaea contain homologues of regulators from the other domains, but it should be kept in mind that many regulator families may be present only in Archaea. This paper describes one such regulator.

Our laboratory is studying nitrogen regulation in Archaea, and we have chosen the species Methanococcus maripaludis because of its ability to fix nitrogen and the availability of a set of facile genetic tools (Whitman et al., 1997; Tumbula and Whitman, 1999; Lange and Ahring, 2001). In our previous studies, we characterized the nif (nitrogen fixation) (Kessler et al., 1998) and the glnA (glutamine synthetase) (Cohen-Kupiec et al., 1999) operons. Transcription of both operons was regulated in vivo by nitrogen availability. nif expression was undetectable during growth on ammonia but high under nitrogen-fixing (diazotrophic) conditions (Cohen-Kupiec et al., 1997). Similarly, glnA expression occurred at a basal level during growth on ammonia (Cohen-Kupiec et al., 1999) but at a high level during diazotrophic growth. Expression of both operons was intermediate when alanine was the nitrogen source (Lie and Leigh, 2002). Genetic analysis allowed us to show that both operons were regulated via palindromic (inverted repeat) sequences within each promoter region (Cohen-Kupiec et al., 1997; 1999). The palindromic sequences contained eight bp in common, which led us to identify the ‘nitrogen operator’ consensus GGAA-N6-TTCC (Kessler and Leigh, 1999).

A factor present in cell-free extracts of M. maripaludis bound specifically to the nitrogen operators present in the nif promoter region (Cohen-Kupiec et al., 1997; Lie and Leigh, 2002). We hypothesized that this factor (a repressor protein) regulates nif and glnA expression by binding to the nitrogen operator sequences and preventing transcription. In this paper, we purify the repressor protein and identify the gene encoding it. We confirm its function in the repression of nif and glnA expression in vivo using gene disruption and genetic complementation. The protein represents a new family of regulators, with known homologues only in certain species in the kingdom euryarchaeota. We designate the protein NrpR (nitrogen regulatory protein).

Results

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

Purification and identification of NrpR

Previous work indicated the presence of a repressor protein (here designated NrpR) in M. maripaludis that regulates the expression of nitrogen assimilation genes (Cohen-Kupiec et al., 1997; 1999). We purified this protein from cell-free extract, monitoring activity using a gel mobility-shift assay for specific binding of the protein to nitrogen operator sequences in the nif promoter region (Cohen-Kupiec et al., 1997). Cells were grown in McC medium (a medium containing ammonium chloride and yeast extract, see Experimental procedures), and cell-free extract was subjected to ammonium sulphate precipitation. Activity was found in the fraction that precipitated between 50% and 80% ammonium sulphate. Subsequent gel-filtration chromatography yielded a peak of activity corresponding to a molecular weight of approximately 275 kDa (Fig. 1). Compared with the subunit molecular weight of the purified protein (60 kDa, below), this value suggested that NrpR may be a tetramer.

image

Figure 1. Gel-filtration chromatography of NrpR. Abilities of fractions to cause a gel shift by binding to nif operator DNA are shown. The higher and lower shifted bands (horizontal arrows) correspond to those observed previously with high and low concentrations of cell extract (Lie and Leigh, 2002). Elution points of molecular weight standards are indicated.

Download figure to PowerPoint

We estimated the total NrpR-DNA binding activity at this stage of the purification as described in Experimental procedures. Comparing the total activity after the gel-filtration step with the activity in the original cell extract indicated a yield of 190%. Evidently, no additional factor needed for NrpR binding activity was lost during the purification, and substances inhibiting activity may have been removed.

For the final step in the purification of NrpR, we took advantage of the known binding properties of the protein to nif promoter region DNA. The nif promoter region contains two nitrogen operator sequences, nif operator 1 and nif operator 2, situated between the transcription start site and the ribosome binding site. Experiments with cell extracts have shown that strong binding occurs to DNA containing both nif operators, whereas weaker binding occurs when only nif operator 1 is present (Cohen-Kupiec et al., 1997; Lie and Leigh, 2002). We prepared DNA spanning both nif operators by polymerase chain reaction (PCR) and attached it to magnetic beads. Addition of the beads to the pooled gel-filtration eluate resulted in nearly complete absorption of NrpR activity, and retention during washing (Fig. 2, ‘both operators wild type’). However, NrpR activity could not be recovered from the bead-bound DNA with 1 or 5 M NaCl, with or without 1 mM EDTA, or by adjusting the pH to 6.5. As a control, NrpR from the gel-filtration column retained activity when in-cubated under the same conditions and desalted. Furthermore, these treatments yielded no proteins visible after SDS-PAGE.

image

Figure 2. Attachment of NrpR to DNA affinity beads. Pooled fractions from gel-filtration chromatography were treated with nif operator DNA bound to magnetic beads. Gel-shift activities are shown before and after addition of bead-bound DNA, and for the first of three washes. DNA bound to beads contained either nif operators 1 and 2 or only nif operator 1 (mutant nif operator 2).

Download figure to PowerPoint

In an attempt to improve our ability to elute NrpR from bead-bound DNA, we repeated the affinity purification procedure, weakening the interaction between NrpR and the bead-bound DNA by keeping nif operator 1 intact but eliminating nif operator 2 by base-change mutations. However, only partial absorption occurred and retention was poor during the wash (Fig. 2, ‘only first operator wild type’). We therefore returned to the use of bead-bound DNA with both nif operators.

As NrpR appeared to bind to the double operators with high affinity, we reasoned that free DNA containing both operators might shift NrpR from the bead-bound DNA to the free DNA. Therefore, we tried a three- to fourfold excess of free polymerase chain reaction (PCR) product as eluant. This experiment yielded a single 60 kDa protein band after SDS-PAGE (Fig. 3). NrpR activity could not be detected by gel shift, presumably because the DNA binding site of NrpR was occupied by the eluant DNA. The 60 kDa protein was submitted for N-terminal amino acid sequencing, yielding the sequence MDSNIDVEILSILK. A blast search of the M. maripaludis genome sequence (see Experimental procedures) yielded a single DNA interval whose translation matched this sequence. Subsequent analysis of the genome sequence revealed a single open reading frame (ORF) with the corresponding N-terminal sequence (below).

image

Figure 3. SDS-PAGE profile of eluate from DNA affinity chromatography. Protein was eluted from DNA affinity beads with free nif operator DNA and run on SDS-PAGE. Gel was silver stained. Left lane, molecular weight standards; right lane, eluate. The lower band stained with ethidium bromide in a separate analysis and is attributed to the DNA used as eluant.

Download figure to PowerPoint

Mutagenesis and genetic complementation of nrpR

Genetic analysis allowed us to test the function in vivo of the ORF identified above. We cloned a DNA fragment containing the ORF, deleted an internal portion, and inserted a selectable marker for puromycin resistance (pac gene). We transformed this construct (ΔnrpR::pac) into M. maripaludis strain LL (wild type), yielding strain Mm500. As expected, cell-free extract from Mm500 lacked NrpR activity in the gel-shift assay (Fig. 4, Mm500).

image

Figure 4. NrpR-DNA binding activities (gel-shift analysis) of extracts from nrpR and nrpR+ strains. Mm500, nrpR mutant; Mm500RCC, complemented mutant; Mm500VC, vector control for complemented mutant; Mm505S1, nrpR mutant in an Mm312 background (see below). Cell extracts were obtained from cultures grown in McC medium; 10 µg of protein and 4.8 fmol of DNA probe were loaded into each lane.

Download figure to PowerPoint

To confirm the effect of nrpR, we complemented the mutation. The PCR product of the nrpR coding sequence was cloned into a replicative shuttle vector and transformed into Mm500. As a control, the vector without nrpR was transformed into Mm500 as well. The complemented strain regained NrpR activity, whereas the control strain did not (Fig. 4, Mm500RCC and Mm500VC).

We also determined the effect of nrpR on gene expression. As nifH and glnA contain similar operator sequences, we hypothesized that NrpR would regulate the expression of both genes. To test this hypothesis, we constructed an nrpR mutation in a background that facilitates accurate comparison of glnA mRNA levels. Previously we constructed strain Mm312 (Cohen-Kupiec et al., 1999), which contains two copies of glnA, one full length and one shortened by an internal in-frame deletion. In addition, the shortened gene contains an operator mutation that renders its expression constitutive. As a result, in Northern blots the degree of regulated expression can be determined by comparing the intensities of the longer and shorter mRNAs. As before (Lie and Leigh, 2002), in Mm312 the normally regulated (full-length) glnA gene was expressed at a low basal level with ammonia, at an intermediate level with alanine, and at the maximum level with dinitrogen (Fig. 5A, Mm312). To test the effect of nrpR, we constructed ΔnrpR::neo (same as ΔnrpR::pac but with neomycin resistance instead of puromycin resistance) and introduced it into Mm312. The gel-shift assay confirmed that NrpR activity was lost (Fig. 4, Mm505S1). Expression of glnA was constitutive at a high level (Fig. 5A, Mm505S1). A similar effect of nrpR on glnA expression could be seen in the Mm500 background complemented and mock-complemented with vector, although no constitutive glnA is available for comparison (Fig. 5A, Mm500RCC and Mm500VC). To determine the effect of nrpR on nif expression, we probed the same blot with nifH DNA. The nrpR mutation had marked effects on nif expression, eliminating repression as expected (Fig. 5B). These results show that NrpR represses nif and glnA expression by binding to nitrogen operator sequences.

image

Figure 5. Northern analysis of glnA (A) and nifH (B) expression in nrpR and nrpR+ strains. Mm312, LL with an inserted glnA construct that is constitutively expressed and contains an internal in-frame deletion ΔglnA, see text). mRNA from ΔglnA serves as a control for determining regulated levels of mRNA. Mm505S1, Mm312 with nrpR mutation. Mm500RCC, nrpR mutation in LL, complemented. Mm500VC, vector control. Strains were grown in nitrogen-free medium with nitrogen sources indicated. Approximately 3 µg of RNA was loaded per lane.

Download figure to PowerPoint

The nrpR mutants Mm500 and Mm500VC grew more slowly in liquid McC medium and colony diameters on McC agar were about half those of wild-type or complemented strains, indicating that disrupting the nrpR gene resulted in slower growth with ammonia. However, the mutants grew well under nitrogen-fixing conditions. Switch-off of nitrogenase activity by ammonia (Kessler et al., 2001) occurred normally (results not shown), showing that regulation at the level of nitrogenase enzyme activity remained intact.

NrpR-DNA binding activity in extracts from repressed and derepressed cultures

To determine whether the level of NrpR was itself regulated by nitrogen, we performed quantitative gel-shift assays on extracts from wild-type cells grown with dinitrogen, alanine, and ammonia as nitrogen source. First, we calibrated the assay by determining the amount of DNA required to saturate the binding capacity of each extract (see Experimental procedures). The results showed that the amount of NrpR in each extract was similar and that NrpR was present in molar excess over the radiolabelled probe DNA. To measure NrpR-DNA binding activity, the relationship between extract concentration and binding was determined. Levels of NrpR activity were similar in all three extracts (Fig. 6). These results suggest that the regulation that functions in vivo is not reflected in the binding properties measured in vitro, and the level of NrpR protein itself is not regulated.

image

Figure 6. NrpR-DNA binding activities of extracts from dinitrogen (▴), alanine (×), and ammonia-grown (▪) cells. Cells were grown in nitrogen-free medium with the appropriate nitrogen source. Results from gel-shift assays were plotted.

Download figure to PowerPoint

Informatic analysis of NrpR

The protein deduced from the NrpR DNA sequence contained 536 amino acids and had a calculated molecular weight of 59 601. No known function could be discerned by analysis of the amino acid sequence using blast, pfam and cog. The genes adjacent to nrpR in the genome sequence had no discernible function in nitrogen assimilation. NrpR was searched against the NCBI non-redundant database using blastp. Homologues (e-values less than 10−5) were found only in the following species of Euryarchaeota: M. jannaschii (MJ0159, 46% amino acid identity), M. thermoautotrophicus (MTH1569, 34%), Methanopyrus kandleri AV19 (MK0337, 31%), A. fulgidus (AF2227, 30%), Methanosarcina acetivorans (MA4404, 34% and MA0822, 30%), and Methanosarcina mazei (MM1085, 35% and MM1969, 30%). None of the homologues had a known function. No homologues were found in any Bacteria or Eukaryotes, nor in any other Archaea including Aeropyrum pernix, Pyrobaculum aerophilum, the Pyrococcus species, the Halobacterium species, the Sulfolobus species and the Thermoplasma species.

NrpR of M. maripaludis, as well as the homologues in M. jannachii and M. thermoautotrophicus, contained three polypeptide domains (Fig. 7A). A putative N-terminal winged helix–turn–helix domain was detected previously in the M. jannaschii and M. thermoautotrophicus proteins (Aravind and Koonin, 1999). The remainder of each protein consisted of two additional domains (domain 1 and domain 2, Fig. 7A), that were homologous to each other (Fig. 7B). The remaining homologues contained only subsets of these three domains (Fig. 7A). The A. fulgidus and M. kandleri proteins, and one of the M. acetivorans and M. mazei homologues, contained the helix–turn–helix domain and domain 1. Additionally, M. acetivorans and M. mazei had a second homologue that contained only domain 1 without the helix–turn–helix domain.

image

Figure 7. A. Alignment of NrpR homologues.

B. Alignment of the domain 1 with domain 2. HTH, helix–turn–helix region; LL, Methanococcus maripaludis strain LL; Mj, Methanocaldococcus jannaschii; Mt, Methanothermobacter thermoautotrophicus; Ma, Methanosarcina acetivorans; Mm, Methanosarcina mazei; Mk, Methanopyrus kandleri; Af, Archaeoglobus fulgidus; D1, domain 1; D2, domain 2. Alignment was carried out with Multalin (Corpet, 1988) and edited with genedoc (http:www.psc.edubiomedgenedoc; K. B. Nicholas and B. Hugh). Black, grey and light grey shadings represent 100%, 80% and 30% conservation respectively.

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

Here we have used both biochemical and genetic techniques, and reference to a genome sequence, to identify and characterize NrpR, a novel repressor protein that regulates transcription of nitrogen assimilation genes in M. maripaludis. This regulatory system has some characteristics reminiscent of the general repression paradigm of Bacteria. Thus, a multimeric repressor binding to a palindromic operator appears to inhibit some step in transcription initiation. The presumed use of the helix–turn–helix motif for DNA binding is another similarity, although the ‘winged’ variation of the helix–turn–helix predominates in Archaea (Aravind and Koonin, 1999). Notable differences also exist between the system described here and bacterial repression, including the fact that the archaeal transcription system affected is distinct, resembling that of eukaryotes as discussed above. The identification of NrpR introduces another difference: a previously unknown family of regulators is the repressor.

The nitrogen regulatory system of M. maripaludis differs markedly from the well characterized proteobacterial system involving the two-component activator NtrB-NtrC (Merrick and Edwards, 1995). However, other systems of nitrogen regulation that differ from the NtrB–NtrC system are known. These include systems involving the NtcA activator of cyanobacteria (Herrero et al., 2001), the AmtR repressor of Corynebacterium glutamicum (Jakoby et al., 1997; 2000; Beckers et al., 2001) and, in Bacillus subtilis, the activator TnrA and the repressor GlnR (Fisher, 1999).

The identification of the nitrogen operator sequences, and now of the NrpR protein that binds them, characterizes part of the overall system for nitrogen regulation in M. maripaludis. We showed recently that NrpR binds more strongly to the two nitrogen operators in the nif promoter region than to a single operator when the second is eliminated by base-change mutations. Correspondingly, repression is also more stringent with the two operators (Lie and Leigh, 2002). The tetrameric structure of NrpR inferred here may facilitate co-operative binding to the two nif operators, as a dimeric component could bind to each palindromic operator. Strong binding of a repressor to multiple operators is suggestive of co-operative binding that also occurs in some bacterial repression systems including that of the tetrameric lac repressor (Choy and Adhya, 1996). Unlike nif, the glnA promoter region of M. maripaludis contains a single nitrogen operator (Cohen-Kupiec et al., 1999), and we speculate that weaker binding allows for the low level of constitutive expression that occurs under repressed conditions. In addition, the positions of the operators relative to the TATA boxes and transcription start sites vary between nif and glnA, suggesting that different steps in transcription initiation may be inhibited (Lie and Leigh, 2002).

However, much remains to be learned about the nitrogen regulation system in M. maripaludis. We know little of the system that controls binding of NrpR to the operators and the mechanism by which the nitrogen state of the cell is transmitted to that system. We have reported here that the operator binding activities in extracts from repressed and derepressed cells are indistinguishable. This observation is consistent with two others: nrpR expressed from the constitutive promoter used for complementation of the nrpR mutation mediates normal regulation (Fig. 5), and nrpR mRNA levels are similar in repressed and derepressed wild-type cells (T. J. Lie, unpublished). Hence, M. maripaludis does not regulate the level of the NrpR protein itself, but rather regulates its binding to the nitrogen operator. We observed recently that 2-ketoglutarate decreased the binding of NrpR in cell extract to nif operator DNA (T. J. Lie, unpublished). Whether 2-ketoglutarate interacts directly with NrpR or acts through another protein remains unknown, and the question remains open whether binding of NrpR to operator DNA is regulated directly by small effector molecules such as 2-ketoglutarate, by other proteins, or even by covalent modification. A related question involves the protein sensing of the nitrogen state of the cell. In all known bacterial systems, a widespread family of proteins, homologues of the Escherichia coli P-II protein, is involved in nitrogen sensing (Arcondeguy and Merrick, 2001). P-II senses the nitrogen state of the cell by directly or indirectly monitoring the levels of glutamine and 2-ketoglutarate. M. maripaludis has five homologues of P-II in its genome. Strikingly, deletion of all five in a single mutant showed that none of them is involved in transcriptional regulation of nif expression (unpublished), although two of them participate in modulation of nitrogenase activity (Kessler and Leigh, 1999; Kessler et al., 2001). Therefore, regardless of where 2-ketoglutarate interacts, the sensing mechanism must be novel.

The sequence of NrpR gives little indication of its functional mechanism. The helix–turn–helix motif is well known for DNA binding and this is probably the domain of NrpR that binds the nitrogen operators. The remainder of the protein, consisting of two novel domains that are homologues of each other, presumably mediate dimerization and tetramerization, and any interactions with other factors involved in nitrogen sensing or transduction of the nitrogen signal to NrpR. Whatever the functional mechanism of NrpR, the presence of homologues in other species of Euryarchaeota suggest similar function. Full-length homologues in M. jannaschi and M. thermoautotophicus correlate with the presence of the nitrogen operator consensus sequence upstream of potential nitrogen-regulated genes in those species, where a similar nitrogen regulon presumably exists (Kessler and Leigh, 1999). NrpR function in species with only one domain following the helix–turn–helix: M. kandleri, A. fulgidus, M. acetivorans; M. mazei is more difficult to evaluate and M. kandleri has the nitrogen operator consensus 13 bp upstream of its glnA coding sequence, but no such sequence is found in the other three species. The presence of a second NrpR homologue in M. acetivorans and M. mazei that lacks the helix–turn–helix domain is particularly intriguing, and suggests that whatever the function of NrpR homologues in other species, it may not always involve binding to DNA. NrpR may turn out to be a versatile regulator within the Euryarchaeota.

Experimental procedures

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

Strains, plasmids and growth conditions

Strains and plasmids are listed in Table 1. Methanococcus maripaludis strain LL (Kessler et al., 1998) is identical to strain S2 (Whitman et al., 1986; Lie and Leigh, 2002). For purification of NrpR, cells were grown in McC medium (Whitman et al., 1986) under H2:CO2 in modified 1 l bottles (Balch et al., 1979). For analyses of gene expression, cultures were grown in nitrogen-free liquid medium under a H2:CO2:N2 atmosphere as described (Blank et al., 1995; Lie and Leigh, 2002). Anaerobic solutions of ammonium chloride (10 mM) or l-alanine (10 mM) as nitrogen sources, and puromycin (2.5 µg ml−1) or neomycin sulphate (1 mg ml−1) were added as needed. All incubations were at 37°C with shaking.

Table 1.  Strains and plasmids.
Strain or plasmidRelevant featuresReference
Strain
 LLWild-type M. maripaludis; same as strain S2Kessler et al. (1998)Lie and Leigh (2002)Whitman et al. (1986)
 Mm500ΔnrpR::pac (pac cassette contains Pmcr but not Tmcr); PurrThis study
 Mm312Plasmid pCM12 integrated by single crossover into glnA; PurrCohen-Kupiec et al. (1999)
 Mm505S1ΔnrpR::neo in Mm312; PurrNeorThis study
 Mm500VCMm500 (pWLG40NZ–R); PurrNeorThis study
 Mm500RCMm500 (pWLG40N+R); PurrNeorThis study
Plasmid
 PGEM®-7Zf(+)Cloning vector, AmrPromega
 pBluescript-II KS+Cloning vector, AmrStratagene
 pJK3Contains pac cassette (with Pmcr and Tmcr), AmrPurrMetcalf et al. (1997)
 pCM124.2 kb HindIII fragment containing glnA (Δ nucleotides 576–1190) cloned into pJK3; GGAA in 1st half of glnA operator changed to CCTT, AmrPurrCohen-Kupiec et al. (1999)
 pMmp1.11.8 kb EcoRI fragment containing part of nifH and upstream sequence in pBluescript, AmrCohen-Kupiec et al. (1997)
 pTJL11nrpR with 0.5 kb of flanking DNA cloned into XbaI and XhoI sites of pBluescript, AmrThis study
 pTJL11R3Replacement of EcoRV–EcoRI fragment of nrpR with pac cassette (Pmcr but no Tmcr); AmrPurrThis study
 pTJL11R4Replacement of EcoRV–EcoRI fragment of nrpR with neo cassette (Pmcr but no Tmcr); AmrNeorThis study
 pnifHmutAG2CT21.2 kb EcoRI–StuI fragment of nif promoter region cloned into pGEM; GGAA and TTCC of the 2nd nif operator changed to CCTT and AAGG; AmrCohen-Kupiec et al. (1997)
 pRCN230Contains neo cassette (with Pmcr and Tmcr), AmrNeorP. Kessler
 pWLG40+lacZReplicative vector for M. maripaludis; lacZ with M. voltae histone promoter; pac cassette (with Pmcr and Tmcr); AmrPurrW. Whitman
 pWLG40NZ–RpWLG40+lacZ with pac cassette replaced by neo cassette, AmrNeorThis study
 pWLG40N+RnrpR cloned into NsiI–MluI site of pWLG40NZ–RThis study

Preparation of DNA bound to magnetic beads

DNA containing nif operators 1 and 2 and DNA containing nif operator 1 only (eight base changes in nif operator 2 (Cohen-Kupiec et al., 1997; Lie and Leigh, 2002) were polymerase chain reaction (PCR)-amplified from plasmids pMmp1.1 and pnifHmutAG2CT2 respectively (Cohen-Kupiec et al., 1997; Lie and Leigh, 2002) with primers toml1 and nifbiotinecoxba1 (primers are listed in Table 2). The resulting PCR products extended from the last nucleotide of the TATA box to the 55th nucleotide of the nifH coding sequence. For purification of NprR for N-terminal sequencing, a shorter DNA fragment containing nif operators 1 and 2 was produced from pMmp1.1 using primers toml1 and StuXba. This DNA excluded the ribosome binding site and the nifH coding sequence. PCR used Taq polymerase (Promega) as follows: 95°C for 2 min; 25 cycles of 95°C, 50°C and 72°C for 1 min each; and 72°C for 10 min. PCR products were purified using the Qiagen PCR purification kit, digested overnight with XbaI, heat-treated and extended with Klenow (exo) (New England Biolabs) with dCTP, dGTP, dTTP and an equimolar concentration of biotin-14-dATP (Life Technologies). The product was purified using the Qiagen Minelute kit. To check the efficiency of biotinylation, streptavidin (Roche Molecular Biochemicals) was added to a portion of the product in 10 mM Tris pH 7.5–1 mM EDTA, incubated for 10 min at room temperature, and run on an agarose gel (2% w/v); mobility was compared with non-streptavidin-treated DNA. DNA that had been successfully biotinylated was coupled to streptavidin-coated magnetic beads (Dynal AS), following manufacturer's instructions. DNA-coupled beads were stored at 4°C until use.

Table 2.  PCR primers.
PrimerSequence (5′−3′)Restriction sites
Toml1AGTAAATAATCTATAGCATAGTTCACC 
Nifbiotinecoxba1GCTCTAGATATTTTGGAATTCCACCTTTTCCGTAAATTGCGXbaI, EcoRI
StuXbaGCTCTAGATATCCGGAAGGCCTCTATATATTGTTGACTTTCGGXbaI, StuI
LfRepKO1ATTATCTAGAAAAGCAATTTCGCTGAACAATGCXbaI
RtRepKO1ATATACTCGAGCTTTTACAACGAAATTTCCXhoI
PacpEcoRVITATAGATATCGAGAGTCTTAAAAAATCTTCGGEcoRV 
PactEcoRI3GTGAATTCTATAAGTCAGGCACCGGGEcoRI
ForpmcrneoEcoRVTATAGATATCGTAGGTCATAAAAAACGCCCEcoRV
RevneoEcoRIATAGAATTCTGTCCCGCTCAGAAGAACTCGEcoRI
ForpmcrneoBglIIGAAGATCTGTAGGTCATAAAAAACGCCCBglII
RevneoAflIII1TTACATGTGTCCCGCTCAGAAGAACTCGAflIII
RepcompfPstIAAAACTGCAGATGGACAGTAATATTGATGPstI
RepcomprMluIAAAACGCGTTTAAATATCGTCGTAATGTGMluI
ForwrepATGGACAGTAATATTGATGTTGAAATTTTATCC 
RevrepAAATATCGTCGTAATGTGTTAGTTCTGAATAGTC 

Purification of NrpR and identification of the nrpR gene

To obtain cell-free extract, 400 ml of M. maripaludis grown in McC medium were spun at 10 000 g at 4°C for 15 min, resuspended in 10 ml of cold 50 mM Tris-HCl (pH 7.5), and sonicated. Phenylmethylsulphonyl fluoride was added to 2 mM, and debris was removed by centrifugation at 10 000 g for 15 min at 4°C. Solid ammonium sulphate was added stepwise to the cell-free extract. Precipitates were dissolved in 50 mM Tris-HCl, desalted by repeated concentration with Centricon centrifugal filters (molecular weight cut-off 100 kDa, Millipore) and re-dilution in 10 mM Tris-HCl (pH 7.5), and assayed for activity. For gel-filtration chromatography, the precipitate from the 50–80% ammonium sulphate fraction was dissolved in 2 ml of 50 mM Tris-HCl (pH 7.5) and run at 4°C through a column (2.5 cm × 30 cm) containing Sephacryl S-300 HR resin (Amersham Pharmacia Biotech). Running buffer was 10 mM Tris-HCl (pH 7.5), and flow rate was 0.8 ml min−1. Fractions (3 ml) were collected. The column was calibrated with the molecular weight standards ferritin (440 kDa), catalase (232 kDa) and aldolase (158 kDa) (Amersham Pharmacia Biotech), and the molecular weight of eluting fractions was calculated from a plot of elution volume versus log molecular weight. Fractions exhibiting gel-shift activity were pooled and concentrated to 0.5 ml using Centricon centrifugal filters as above. No repressor activity was found in the filtrate, indicating that the protein was wholly retained by the filter.

DNA affinity purification was as follows: 300 µl of the concentrated gel-filtration eluate was added to 2 ml of final volume of 200 mM NaCl, 10 mM dithiothreitol (DTT), 10 mM Tris-HCl pH 7.5 and 240 µg ml−1 of bovine serum albumin (BSA). Magnetic beads prepared with bound DNA as above were added to the reaction mix and allowed to incubate at room temperature for 1 h, with gentle shaking. The beads were then magnetically pelleted and the reaction mix was pipetted out. The beads were then washed three times with 10 mM Tris-HCl pH 7.5, 10 mM DTT, 200 mM NaCl, and 160 µg ml−1 of poly dIdC.dIdC at room temperature for 2 min each. Various factors were tested for their ability to elute NrpR from bead-bound DNA. These factors were added to washed beads in 10 mM Tris-HCl pH 7.5, and incubated for 30 min to 1 h at room temperature. Supernatant was desalted with Centricon centrifugal filters (molecular weight cut-off 10 kDa) in 50 mM Tris-HCl pH 7.5, and tested for NrpR-DNA binding activity (gel-shift assay) or analysed by SDS-PAGE (12%). To elute bound NrpR, a three- to fourfold excess of free PCR product corresponding to the DNA bound to the beads was added to washed beads in 10 mM Tris-HCl pH 7.5 and 200 mM NaCl and incubated for 1 h. The eluted NrpR–DNA complex was then desalted as above and run on 12% SDS-PAGE. The 60 kDa band obtained by DNA affinity purification was blotted onto a polyvinyldifluoride membrane and sent to the Protein Core Facility at Columbia University for N-terminal sequencing. The resulting amino acid sequence was used in a tblastn query of a partial sequence of the M. maripaludis genome.

Construction of nrpR

Mutants nrpR and 0.5 kb of flanking sequences on either end of the gene were PCR amplified from genomic DNA with primers LfRepKO1 and RtRepKO1 (Table 2), pfu turbo polymerase (Stratagene), and conditions as follows: 95°C for 5 min; 30 cycles of 95°C for 30 s, 50°C for 30 s and 72°C for 5 min; and 72°C for 10 min. The 2.6 kb product was cloned into the XbaI–XhoI site of pBluescript-II KS+ generating plasmid pTJL11. The pac (puromycin resistance) cassette (with promoter Pmcr but without terminator Tmcr) was amplified from the NcoI–HindIII fragment of pJK3 with primers pacpEcoRVI and PacEcoRI3, pfu polymerase, and PCR conditions 95°C for 2 min; 25 cycles of 95°C for 1 min 15 s, 50°C for 30 s, and 72°C for 1 min 30 s; and 72°C for 10 min. The product was digested with EcoRV and EcoRI and cloned into EcoRV–EcoRI-digested pTJL11, replacing an internal fragment of nrpR with the pac cassette. The resulting plasmid pTJLl1R3 was transformed into M. maripaludis LL according to Tumbula et al. (1994) and puromycin-resistant colonies were re-streaked at least three times to ensure purity. The resulting strain Mm500 was thus LL ΔnrpR::pac. A similar mutation was generated in strain Mm312. As Mm312 is already puromycin resistant, the neo (neomycin resistance) cassette (Argyle et al., 1996) with Pmcr but without Tmcr was PCR amplified from pRCN230 using primers forpmcerneoEcoRV and revneoEcoRI and the same conditions as specified above for the pac cassette. The neo cassette was used to replace the internal fragment of nrpR as above to yield pTJL11R4. After digestion with XbaI and XhoI and heat inactivation of the enzymes, pTJL11R4 was transformed into Mm312 to yield Mm505S1. Colonies that were both neomycin and puromycin resistant were re-streaked three times to ensure purity. Deletion of nrpR and insertion of the selectable marker in all strains was confirmed by Southern analysis as described below.

Complementation of nrpR

To convert the replicative shuttle vector pWLG40+lacZ from puromycin to neomycin resistance, the neo cassette was PCR amplified from pRCN230 with primers pmcrneoBglII and revneoAflIII1 as above and digested with BglII and AflIII. The product was cloned into BglII–NcoI-digested pWLG40+lacZ to replace the pac cassette. The resulting vector was named pWLG40NZ–R. nrpR was amplified from genomic DNA using pfu turbo, primers repcompfPstI and repcompRmluI, and PCR conditions as follows: 95°C for 3 min; 30 cycles of 94°C for 30 s, 53°C for 30 s, and 72°C for 3 min; and 72°C for 10 min. The product was digested with PstI and MluI and cloned into NsiI–MluI-digested pWLG40NZ–R to give pWLG40N+R. In this construct, expression of the nrpR is driven by the constitutive histone promoter (Phmv) of Methanococcus voltae (Gardner and Whitman, 1999). pWLG40N+R, and pWLG40NZ–R as vector control, were transformed into Mm500 to yield Mm500RCC and Mm500VC respectively.

Gel mobility-shift assay for NrpR-DNA binding

Construction and radiolabelling of the DNA probe, binding of protein to DNA, and gel electrophoresis were conducted as described (Lie and Leigh, 2002). The probe DNA sequence spanned nif operators 1 and 2. For calibration of the quantitative assay, extract concentrations were held constant at 16 or 32 µg of protein, and 4.8 fmol of radiolabelled probe DNA was used in all cases. Increasing amounts of non-labelled probe DNA were added to each mixture, and the amount at which the shift of labelled probe disappeared was determined. Moles NrpR was estimated assuming a one-to-one correspondence between bound protein and DNA. For measurement of NrpR-DNA binding activity, 4.8 fmol of radiolabelled probe DNA was used, and the amount of protein was varied to obtain a plot of percentage of probe shifted versus µg of protein. Relative activity was determined from the amount of protein that shifted 50% of the probe.

Southern analysis

Chromosomal DNA was isolated with Masterpure DNA purification kit (Epicenter) and 10 µg of DNA was digested with StyI, run on 1% (w/v) agarose at 80 V, and transferred onto nylon membrane (Roche Molecular Biochemicals). nrpR probe was PCR amplified from pTJL11 (linearized with NotI) with Taq polymerase, primers forwrep and revrep, and PCR conditions 94°C for 2 min; 25 cycles of 94°C for 30 s, 50°C for 30 s, and 72°C for 2 min; and 72°C for 10 min. The product was purified using Qiagen Minelute kit, and DIG labelled by random priming (DIG DNA labelling kit, Roche Applied Science). Hybridization was performed at 55°C, followed by colorimetric detection.

Northern analysis

Extraction of RNA, synthesis and radiolabelling of glnA probe, and Northern analysis were as described (Lie and Leigh, 2002). The EcoRI–HindIII fragment of plasmid pMmp1.3 was used as a probe for nifH mRNA (Kessler et al., 1998). Blots were first hybridized with the nifH probe, stripped and re-hybridized with the glnA probe.

Sequence analysis

The sequencing of the M. maripaludis genome and its analysis is an ongoing collaboration of J.A.L. with M. Olson (University of Washington) and F. Larimer (Oak Ridge National Laboratories). ORFs were identified by the generation, glimmer, and critica programs. Gene functions and protein domains were deduced using blast, pfam, cog and prodom. The sequence of nrpR is deposited in GenBank (accession no. AY157992).

Acknowledgements

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

We wish to thank C. Daniel, J. Dodsworth, E. Hendrickson and G. Wood for insightful discussions. We are grateful to W. Whitman for kindly providing pWLG40+lacZ. This study was supported by grant GM-55255 from the National Institutes of Health.

References

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References
  • Aravind, L., and Koonin, E.V. (1999) DNA-binding proteins and evolution of transcription regulation in the archaea. Nucleic Acids Res 27: 46584670.
  • Arcondeguy, T., and Merrick, M. (2001) PII signal tranduction proteins, pivotal players in microbial nitrogen control. Microbiol Mol Biol Rev 65: 80105.
  • Argyle, J.L., Tumbula, D.L., and Leigh, J.A. (1996) Neomycin resistance as a selectable marker in Methanococcus maripaludis. Appl Environ Microbiol 62: 42334237.
  • Balch, W.E., Fox, G.E., Magrum, L.J., Woese, C.R., and Wolfe, R.S. (1979) Methanogens: re-evaluation of a unique biological group. Microbiol Rev 43: 260296.
  • Barns, S.M., Delwiche, C.F., Palmer, J.D., and Pace, N.R. (1996) Perspectives on archaeal diversity, thermophily and monophyly from environmental rRNA sequences. Proc Natl Acad Sci USA 93: 91889193.
  • Beckers, G., Nolden, L., and Burkovski, A. (2001) Glutamate synthase of Corynebacterium glutamicum is not essential for glutamate synthesis and is regulated by the nitrogen status. Microbiology 147: 29612970.
  • Bell, S.D., and Jackson, S.P. (1998) Transcription and translation in Archaea: a mosaic of eukaryal and bacterial features. Trends Microbiol 6: 222228.
  • Bell, S.D., and Jackson, S.P. (2000) Mechanism of autoregulation by an archaeal transcriptional repressor. J Biol Chem 275: 3162431629.
  • Bell, S.D., and Jackson, S.P. (2001) Mechanism and regulation of transcription in archaea. Curr Opin Microbiol 4: 208213.
  • Bell, S.D., Kosa, P.L., Sigler, P.B., and Jackson, S.P. (1999a) Orientation of the transcription preinitiation complex in archaea. Proc Natl Acad Sci USA 96: 1366213667.
  • Bell, S.D., Cairns, S.S., Robson, R.L., and Jackson, S.P. (1999b) Transcriptional regulation of an archaeal operon in vivo and in vitro. Mol Cell 4: 971982.
  • Bell, S.D., Brinkman, A.B., Van Der Oost, J., and Jackson, S.P. (2001) The archaeal TFIIEalpha homologue facilitates transcription initiation by enhancing TATA box recognition. EMBO Rep 2: 133138.
  • Blank, C.E., Kessler, P.S., and Leigh, J.A. (1995) Genetics in methanogens: transposon insertion mutagenesis of a Methanococcus maripaludis nifH gene. J Bacteriol 177: 57735777.
  • Brinkman, A.B., Dahlke, I., Tuininga, J.E., Lammers, T., Dumay, V., De Heus, E., et al. (2000) An Lrp-like transcriptional regulator from the archaeon Pyrococcus furiosus is negatively autoregulated. J Biol Chem 275: 3816038169.
  • Brinkman, A.B., Bell, S.D., Lebbink, R.J., De Vos, W.M., and Van Der Oost, J. (2002) The sulfolobus solfataricus Lrp-like protein LysM regulates lysine biosynthesis in response to lysine availability. J Biol Chem 277: 29537– 29549.
  • Choy, H., and Adhya, S. (1996) Negative control. In Escherichia Coli and Salmonella, Vol. 1. Neidhardt, F.C., Curtiss, R., and Ingraham, III, , J.L., Lin, E.C.C., Low, K.B., Magasanik, B., Reznikoff, W.S., Riley, M., Schaechter, M., and Umbarger, H.E. (eds). Washington DC: American Society for Microbiology, pp. 12871299.
  • Cohen-Kupiec, R., Blank, C., and Leigh, J.A. (1997) Transcriptional regulation in Archaea: in vivo demonstration of a repressor binding site in a methanogen. Proc Natl Acad Sci USA 94: 13161320.
  • Cohen-Kupiec, R., Marx, C.J., and Leigh, J.A. (1999) Function and regulation of glnA in the methanogenic archaeon Methanococcus maripaludis. J Bacteriol 181: 256261.
  • Corpet, F. (1988) Multiple sequence alignment with hierarchical clustering. Nucleic Acids Res 16: 1088110890.
  • Dahlke, I., and Thomm, M. (2002) A Pyrococcus homolog of the leucine-responsive regulatory protein, LrpA, inhibits transcription by abrogating RNA polymerase recruitment. Nucleic Acids Res 30: 701710.
  • Fisher, S.H. (1999) Regulation of nitrogen metabolism in Bacillus subtilis: vive la difference! Mol Microbiol 32: 223232.
  • Gardner, W.L., and Whitman, W.B. (1999) Expression vectors for Methanococcus maripaludis: overexpression of acetohydroxyacid synthase and beta-galactosidase. Genetics 152: 14391447.
  • Hanzelka, B.L., Darcy, T.J., and Reeve, J.N. (2001) TFE, an archaeal transcription factor in Methanobacterium thermoautotrophicum related to eucaryal transcription factor TFIIEalpha. J Bacteriol 183: 18131818.
  • Hausner, W., Wettach, J., Hethke, C., and Thomm, M. (1996) Two transcription factors related with the eucaryal transcription factors TATA-binding protein and transcription factor IIB direct promoter recognition by an archaeal RNA polymerase. J Biol Chem 271: 3014430148.
  • Herrero, A., Muro-Pastor, A.M., and Flores, E. (2001) Nitrogen control in cyanobacteria. J Bacteriol 183: 411425.
  • Hochheimer, A., Hedderich, R., and Thauer, R.K. (1999) The DNA binding protein Tfx from Methanobacterium thermoautotrophicum: structure, DNA binding properties and transcriptional regulation. Mol Microbiol 31: 641650.
  • Hugenholtz, P., Goebel, B.M., and Pace, N.R. (1998) Impact of culture-independent studies on the emerging phylogenetic view of bacterial diversity. J Bacteriol 180: 47654774.
  • Jakoby, M., Tesch, M., Sahm, H., Kramer, R., and Burkovski, A. (1997) Isolation of the Corynebacterium glutamicum glnA gene encoding glutamine synthetase I. FEMS Microbiol Lett 154: 8188.
  • Jakoby, M., Nolden, L., Meier-Wagner, J., Kramer, R., and Burkovski, A. (2000) AmtR, a global repressor in the nitrogen regulation system of Corynebacterium glutamicum. Mol Microbiol 37: 964977.
  • Kessler, P.S., and Leigh, J.A. (1999) Genetics of nitrogen regulation in Methanococcus maripaludis. Genetics 152: 13431351.
  • Kessler, P.S., Blank, C., and Leigh, J.A. (1998) The nif gene operon of the methanogenic archaeon Methanococcus maripaludis. J Bacteriol 180: 15041511.
  • Kessler, P.S., Daniel, C., and Leigh, J.A. (2001) Ammonia switch-off of nitrogen fixation in the methanogenic Archaeon Methanococcus maripaludis: mechanistic features and requirement for the novel GlnB homologues, NifI1 and NifI2. J Bacteriol 183: 882889.
  • Kornberg, R.D. (1999) Eukaryotic transcriptional control. Trends Cell Biol 9: M46M49.
  • Kruger, K., Hermann, T., Armbruster, V., and Pfeifer, F. (1998) The transcriptional activator GvpE for the halobacterial gas vesicle genes resembles a basic region leucine-zipper regulatory protein. J Mol Biol 279: 761771.
  • Kyrpides, N.C., and Ouzounis, C.A. (1999) Transcription in archaea. Proc Natl Acad Sci USA 96: 85458550.
  • Lange, M., and Ahring, B.K. (2001) A comprehensive study into the molecular methodology and molecular biology of methanogenic Archaea. FEMS Microbiol Rev 25: 553571.
  • Lie, T.J., and Leigh, J.A. (2002) Regulatory response of Methanococcus maripaludis to alanine, an intermediate nitrogen source. J Bacteriol 184: 53015306.
  • Merrick, M.J., and Edwards, R.A. (1995) Nitrogen control in bacteria. Microbiol Rev 59: 604622.
  • Metcalf, W.W., Zhang, J.K., Apolinario, E., Sowers, K.R., and Wolfe, R.S. (1997) A genetic system for Archaea of the genus Methanosarcina: liposome-mediated transformation and construction of shuttle vectors. Proc Natl Acad Sci USA 94: 26262631.
  • Napoli, A., Van Der Oost, J., Sensen, C.W., Charlebois, R.L., Rossi, M., and Ciaramella, M. (1999) An Lrp-like protein of the hyperthermophilic archaeon Sulfolobus solfataricus which binds to its own promoter. J Bacteriol 181: 14741480.
  • Ouhammouch, M., and Geiduschek, E.P. (2001) A thermostable platform for transcriptional regulation: the DNA-binding properties of two Lrp homologs from the hyperthermophilic archaeon Methanococcus jannaschii. EMBO J 20: 146156.
  • Record, M.T.J., Reznikoff, W.S., Craig, M.L., McQuade, K.L., and Schlax, P.J. (1996) Escherichia coli RNA polymerase (Eσ70), promoters, and the kinetics of the steps of transcription initiation. Escherichia Coli Salmonella 1: 792820.
  • Soppa, J. (1999) Transcription initiation in Archaea: facts, factors and future aspects. Mol Microbiol 31: 12951305.
  • Thomm, M. (1996) Archaeal transcription factors and their role in transcription initiation. FEMS Microbiol Rev 18: 159171.
  • Tumbula, D.L., and Whitman, W.B. (1999) Genetics of Methanococcus: possibilities for functional genomics in Archaea. Mol Microbiol 33: 17.
  • Tumbula, D.L., Makula, R.A., and Whitman, W.B. (1994) Transformation of Methanococcus maripaludis and identification of a PstI-like restriction system. FEMS Microbiol Lett 121: 309314.
  • Whitman, W.B., Shieh, J., Sohn, S., Caras, D.S., and Premachandran, U. (1986) Isolation and characterization of 22 mesophilic methanococci. System Appl Microbiol 7: 235240.
  • Whitman, W.B., and Tumbula, D.L., Yu, J.P., and Kim, W. (1997) Development of genetic approaches for the methane-producing archaebacterium Methanococcus maripaludis. Biofactors 6: 3746.