SEARCH

SEARCH BY CITATION

Summary

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

Multiple regulatory mechanisms for coping with stress co-exist in low G+C Gram-positive bacteria. Among these, the HrcA and CtsR repressors control distinct regulons in the model organism, Bacillus subtilis. We recently identified an orthologue of the CtsR regulator of stress response in the major pathogen, Staphylococcus aureus. Sequence analysis of the S. aureus genome revealed the presence of potential CtsR operator sites not only upstream from genes encoding subunits of the Clp ATP-dependent protease, as in B. subtilis, but also, unexpectedly, within the promoter regions of the dnaK and groESL operons known to be specifically controlled by HrcA. The tandem arrangement of the CtsR and HrcA operators suggests a novel mode of dual heat shock regulation by these two repressors. The S. aureus ctsR and hrcA genes were cloned under the control of the PxylA xylose-inducible promoter and used to demonstrate dual regulation of the dnaK and groESL operons by both CtsR and HrcA, using B. subtilis as a heterologous host. Direct binding by both repressors was shown in vitro by gel mobility shift and DNase I footprinting experiments using purified S. aureus CtsR and HrcA proteins. ΔctsR, ΔhrcA and ΔctsRΔhrcA mutants of S. aureus were constructed, indicating that the two repressors are not redundant but, instead, act together synergistically to maintain low basal levels of expression of the dnaK and groESL operons in the absence of stress. This novel regulatory mode appears to be specific to Staphylococci.


Introduction

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

Staphylococcus aureus is a major human opportunistic pathogen responsible for a broad spectrum of infections ranging from food poisoning and superficial skin abscesses to more serious diseases such as pneumonia, meningitis, endocarditis, septicaemia or toxic shock syndrome. Several pathogenicity factors, such as cell surface proteins, invasins and exotoxins, have been characterized, yet it is the unique adaptive potential displayed by S . aureus that has made it one of the major causes of nosocomial infections. Its ubiquitous nature stems mostly from its ability to survive in a great variety of environmental extremes, such as nutrient starvation, a wide range of pH and growth temperatures, metal ion restriction, desiccation or high salt concentrations. An increasing amount of data indicates that the capacity to survive stress conditions, often involving increased expression of stress response genes, is highly correlated with virulence in both S. aureus ( Clements and Foster, 1999 ) and other pathogens ( Hübel et al., 1997 ; Rouquette et al., 1998 ).

Most stress-induced proteins are molecular chaperones or proteases, consistent with their role in protein folding and degradation (Gottesman et al., 1997). Although some stress proteins, such as GroESL, are extremely well conserved among bacteria, heat shock regulatory mechanisms exhibit great diversity. In Escherichia coli, expression of most heat shock genes is under the control of two alternative sigma factors (σ32 and σE) (Bukau, 1993). In the Gram-positive model organism Bacillus subtilis, four different classes of heat shock genes can be distinguished: class I genes, encoding classical chaperones (DnaK, GroES, GroEL), are controlled by the HrcA repressor, which recognizes the highly conserved CIRCE operator sequence (TTAGCACTC-N9-GAGTGCTAA); class II genes encode general stress proteins, and their expression requires the σB stress sigma factor; class III heat shock genes are repressed by CtsR (Class three stress gene Repressor), which recognizes a tandem heptanucleotide direct repeat (A/GGTCAAANANA/GGT CAAA); and class IV genes are those that are not controlled by HrcA, σB or CtsR (Schumann et al., 2002). The regulatory mechanisms controlling heat shock induction of the first three classes of stress response genes have been studied in some detail in B. subtilis. The GroE chaperonin machine has been shown to be required in vivo to allow HrcA to adopt its active conformation and repress class I heat shock genes efficiently. After heat shock, GroE is thought to be titrated through association with misfolded proteins in the cell, and HrcA becomes inactive and dissociates from its operator sequence, leading to induction of the HrcA regulon (Mogk et al., 1997). Activity of the σB alternative σ factor controlling class II genes is regulated post-translationally by a complex signal transduction network involving multiple protein–protein interactions and serine/threonine phosphorylation (Price, 2002). Induction of class III genes is thought to involve targeted degradation of the CtsR repressor by the Clp ATP-dependent protease (Derréet al., 2000; Krüger et al., 2001).

Until recently, surprisingly little was known about stress response regulation in Gram-positive bacteria other than B. subtilis, despite the fact that many stress proteins play an important role in virulence, such as ClpX of S. aureus (Mei et al., 1997), ClpE and ClpC of Streptococcus pneumoniae (Polissi et al., 1998; Lau et al., 2001) or ClpC, ClpE and ClpP of Listeria monocytogenes (Rouquette et al., 1996; 1998; Nair et al., 1999; 2000a; Gaillot et al., 2000; 2001). Besides the subunits of the ubiquitous Clp ATP-dependent protease, classical chaperones such as DnaK or GroESL are also thought to play an important role in virulence. Indeed, the GroESL chaperonin was shown to be involved in cell adherence of Clostridium difficile and cell invasion by Legionella pneumophila (Garduno et al., 1998; Hennequin et al., 2001). In L. monocytogenes, expression of the groESL operon is induced during intracellular infection, and DnaK is required for efficient phagocytosis with macrophages (Hanawa et al., 1999; Gahan et al., 2001). Synthesis of the two major S. aureus chaperones, DnaK and GroESL, was shown to be induced during infection of human epithelial cells, and antibodies specifically directed against these proteins can be detected in sera from infected patients (Qoronfleh et al., 1993; 1998). An understanding of the regulatory mechanisms controlling stress gene expression is therefore essential in studying the virulence of different pathogens.

An analysis of the complete S. aureus genome sequence (Kuroda et al., 2001) and several recent reports indicate that, as originally defined in B. subtilis, at least four different types of heat shock response regulatory mechanisms may co-exist (Clements and Foster, 1999): class I and II genes were identified with the characterization of the dnaK and groESL operons (Kuroda et al., 1999) and the σB regulon (Gertz et al., 2000), and many genes belonging to class IV of B. subtilis also have orthologues present in S. aureus.

We have recently identified the ctsR gene of S. aureus (Derréet al., 1999a), strongly suggesting that class III regulation could be present. We have identified tandemly arranged CtsR and HrcA operator sites upstream from the S. aureus dnaK and groESL operons, suggesting a novel mode of dual heat shock regulation for these genes by both repressors. We show here that the S. aureus dnaK and groESL operons are repressed by both CtsR and HrcA, which act together synergistically to maintain low levels of expression in the absence of stress.

Results

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

The S. aureus dnaK and groESL operons: novel members of the CtsR regulon

A detailed DNA motif analysis of the complete S. aureus genome (Kuroda et al., 2001) was carried out using the CtsR direct repeat heptad operator sequence (A/GGT CAAANANA/GGTCAAA) (Derréet al., 1999a), indicating that there are only five likely CtsR binding sites. Three are next to genes encoding potential subunits of the Clp ATP-dependent protease, in agreement with the previously studied CtsR regulons, which essentially consist of clp genes (Derréet al., 1999a,b; Nair et al., 2000b; Varmanen et al., 2000; Chastanet et al., 2001).

Interestingly, the two remaining target sequences are located upstream from the groESL and dnaK operons, encoding the major cell chaperones. These operons are also preceded by the highly conserved HrcA operator, CIRCE, and were shown previously to be controlled by HrcA (Kuroda et al., 1999). Among the more than 40 CtsR binding sites identified to date (Derréet al., 1999a; Schumann et al., 2002), none was previously found to be located upstream from a dnaK operon. This tandem operator arrangement suggests a novel mode of dual heat shock repression by both CtsR and HrcA. Furthermore, as HrcA is encoded by the first gene of the dnaK operon, this would indicate that HrcA synthesis in S. aureus is itself repressed by CtsR.

CtsR and HrcA of S. aureus both repress dnaK and groESL expression in the heterologous host, B. subtilis

In order to test whether CtsR does indeed play a role in controlling expression of the S. aureus dnaK and groESL operons, B. subtilis was used as a heterologous host. Derivatives of B. subtilis strain QB8068, in which the endogenous ctsR gene is deleted (Chastanet et al., 2001), were constructed in several steps. The resulting strains carry transcriptional β-galactosidase fusions with the promoter regions of the S. aureus dnaK or groESL operons (dnaK′–bgaB or groES′–bgaB) integrated as single copies at the amyE locus, a deletion/replacement of the endogenous hrcA gene by the cat chloramphenicol resistance gene (Mogk et al., 1997) as well as a copy of the S. aureus ctsR or hrcA gene integrated at the thrC locus under control of the xylose-inducible promoter PxylA (Table 1 and Experimental procedures).

Table 1. .B. subtilis and S. aureus strains used in this study.
StrainGenotypeSource or reference
B. subtilis
 AS02ΔhrcA::cat Mogk et al. (1997 )
 QB4922 trpC2 Δ hrcA :: cat AS02[RIGHTWARDS ARROW]168
 QB8068 trpC2 Δ ctsR amyE :: cat Chastanet et al. (2001 )
 QB8072 trpC2 Δ ctsR amyE ::( dnaK∠bgaB aphA3 ) pDKdnaKSau[RIGHTWARDS ARROW]QB8068
 QB8075 trpC2 Δ ctsR amyE ::( dnaK∠bgaB aphA3 ) Δ hrcA :: cat QB4922[RIGHTWARDS ARROW]QB8072
 QB8076 trpC2 Δ ctsR amyE ::( dnaK∠bgaB aphA3 ) Δ hrcA :: cat pXTctsRsau[RIGHTWARDS ARROW]QB8075
thrC ::(p xylActsR sau )  
 QB8077 trpC2 Δ ctsR amyE ::( dnaK∠bgaB aphA3 ) Δ hrcA :: cat pXThrcAsau[RIGHTWARDS ARROW]QB8075
thrC ::(p xylAhrcA sau )  
 QB8127 trpC2 Δ ctsR amyE ::( groES∠bgaB aphA3 ) pDKgroEsau[RIGHTWARDS ARROW]QB8068
 QB8128 trpC2 Δ ctsR amyE ::( groES∠bgaB aphA3 ) Δ hrcA :: cat QB4922[RIGHTWARDS ARROW]QB8127
 QB8129 trpC2 Δ ctsR amyE ::( groES∠bgaB aphA3 ) Δ hrcA :: cat pXTctsRsau[RIGHTWARDS ARROW]QB8128
thrC ::(p xylActsR sau )  
 QB8130 trpC2 Δ ctsR amyE ::( groES∠bgaB aphA3 ) Δ hrcA :: cat pXThrcAsau[RIGHTWARDS ARROW]QB8128
thrC ::(p xylAhrcA sau )  
S. aureus
 RN4220  Kreiswirth et al. (1983 )
 SA2000ΔctsR::spcpRNΔctsR[RIGHTWARDS ARROW]RN4220
 SA2001ΔhrcApMADΔhrcA[RIGHTWARDS ARROW]RN4220
 SA2002ΔctsR::spcΔhrcApMADΔhrcA[RIGHTWARDS ARROW]SA2000

β-Galactosidase assays were performed during growth at 37°C in the presence or absence of xylose (Fig. 1). Expression of dnaK–bgaB was repressed up to 48-fold by CtsR (strain QB8076, Fig. 1A) and 3.2-fold by HrcA (strain QB8077, Fig. 1A), whereas expression of groES–bgaB was repressed 24-fold by CtsR and approximately sevenfold by HrcA (strains QB8129 and QB8130 respectively; Fig. 1B).

image

Figure 1. CtsR and HrcA of S . aureus repress expression of dnaK ′– bgaB and groES ′– bgaB transcriptional fusions in B . subtilis . Expression of dnaK–bgaB (A) and groES–bgaB (B) was measured in cells expressing ctsR (squares) or hrcA (circles). Cells were grown in LB medium at 37°C until OD 600  = 0.3, and xylose was added to half the culture at a final concentration of 20 mM. Cultures grown in the presence of xylose are represented by black symbols and in the absence of xylose by white symbols. Dotted lines indicate optical density at 600 nm, and solid lines indicate β-galactosidase specific activity expressed as nmol of ONP min −1  mg −1 protein.

Download figure to PowerPoint

In order to test whether repression by CtsR or HrcA of S. aureus in the heterologous host B. subtilis was relieved during heat shock, expression was tested in these strains during growth in the presence of xylose at 37°C or 48°C. As shown in Fig. 2, expression of dnaK′–bgaB (Fig. 2A) and groES–bgaB (Fig. 2B) was found to be fully derepressed in the presence of CtsR or HrcA during growth at 48°C. These results clearly demonstrate that the S. aureus dnaK and groESL operons are subjected to dual negative regulation by CtsR and HrcA, and that this repression no longer occurs during growth at high temperature, leading to heat shock induction of these operons.

image

Figure 2. Repression of dnaK–bgaB and groES–bgaB fusions in B . subtilis by CtsR and HrcA of S. aureus is abolished by heat shock. Expression of dnaK–bgaB (A) and groES–bgaB (B) was measured in cells expressing ctsR (squares) or hrcA (circles). Cells were grown in LB medium at 37°C until OD 600  = 0.3, 20 mM xylose was added, and half the culture was shifted to 48°C. Cultures grown at 37°C are represented by white symbols and at 48°C by black symbols. Dotted lines indicate optical density at 600 nm, and solid lines indicate β-galactosidase specific activity expressed as nmol of ONP min −1  mg −1 protein.

Download figure to PowerPoint

Purified CtsR and HrcA of S. aureus bind specifically to upstream regions of the dnaK and groESL operons

As shown above, both CtsR and HrcA control the S. aureus dnaK and groESL operons. In order to determine whether the two repressors bind simultaneously or in a mutually exclusive fashion, an in vitro approach based on gel mobility shift DNA-binding assays and DNase I footprinting was performed.

The S. aureus CtsR and HrcA proteins were overproduced and purified using plasmid pET28/16 (see Experimental procedures). HrcA was renatured to a soluble active form in the presence of poly-(dI–dC), without denaturing agents or additional chaperonin proteins such as GroESL (see Experimental procedures). The two purified proteins were then used in gel mobility shift DNA-binding assays (Fig. 3) with radiolabelled DNA fragments corresponding to the promoter regions of the dnaK or groESL operons, in the presence of an excess of non-specific competitor DNA [1 µg of poly-(dI–dC)]. CtsR bound specifically, forming two protein–DNA complexes with the dnaK promoter region (Fig. 3A, lanes 2–4) and a single complex with the groESL DNA fragment (Fig. 3C, lanes 2–4). The HrcA protein is notoriously insoluble, and previous attempts at purifying it in an active form have met with limited success (Mogk et al., 1997). As shown here, the purified S. aureus HrcA protein is highly active, binding specifically to the dnaK (Fig. 3B) and groESL (Fig. 3D) DNA fragments and forming a single complex in each case, with complete displacement of the radiolabelled fragment to the slower migrating protein–DNA complex as protein concentrations are increased (Fig. 3B and D, lanes 2–5). Binding of HrcA was specific, as no shift in electrophoretic mobility was seen when HrcA was incubated with a radiolabelled DNA fragment carrying the upstream region of the clpB gene, which lacks the CIRCE sequence (data not shown).

image

Figure 3. Specific binding of CtsR or HrcA to the dnaK and groESL promoter regions. Gel mobility shift experiments were performed by incubating purified CtsR or HrcA proteins with radiolabelled DNA fragments (10 000 c.p.m.) corresponding to the promoter regions of the dnaK (positions −121 to +2) (A and B) or groESL operons (positions −136 to +1) (C and D).

A and C. Lanes 1–4, 0, 20, 40 and 80 ng of CtsR.

B and D. Lanes 1–5, 0, 125, 250, 500 and 1000 ng of HrcA. Positions are given with respect to the translation initiation codon.

Download figure to PowerPoint

When both CtsR and HrcA proteins were incubated together with the labelled fragments, a new protein–DNA complex was observed, migrating more slowly than those formed with CtsR or HrcA alone (Fig. 4A and B, lanes 2–4). These results clearly demonstrate that CtsR and HrcA of S. aureus control the expression of these two operons by binding directly and specifically to their promoter regions. The two repressors can bind simultaneously and independently, as each is able to bind without the other, with a complete displacement of the labelled fragment in each case. No co-operativity was observed for binding of CtsR and HrcA when varying the concentrations of one repressor once the other was bound (data not shown).

image

Figure 4. Specific binding of both CtsR and HrcA to the dnaK and groESL promoter regions. Gel mobility shift experiments were performed by incubating purified CtsR and/or HrcA proteins with radiolabelled DNA fragments (10 000 c.p.m.) corresponding to the promoter regions of the dnaK (positions −121 to +2) (A) and groESL operons (positions −136 to +1) (B). Lane 1, no protein; lane 2, CtsR (1 µg); lane 3, HrcA (1 µg); lane 4, CtsR (1 µg) + HrcA (1 µg). Positions are given with respect to the translation initiation codon.

Download figure to PowerPoint

To determine precisely the extent of the CtsR and HrcA binding sites, DNase I footprinting assays were performed on DNA fragments carrying the dnaK and groESL promoter regions. As shown in Fig. 5, when the template strand was end-labelled, CtsR protected a region extending from positions −54 to −84 for dnaK (Fig. 5A, lane 2) and from −68 to −94 for groESL (Fig. 5B, lane 2). In each case, the region protected by CtsR contains the tandem heptanucleotide repeat recognition sequence and the −35 sequence of the promoter (Fig. 5C). Positions are given with respect to the translation initiation codon. A third potential heptanucleotide repeat is located within the dnaK promoter region, just upstream from the characteristic CtsR binding site (5′-TTTAACA-3′; Fig. 5C), which could explain the two distinct protein–DNA complexes seen in gel mobility shift experiments (Fig. 3A). A similar situation was reported for the B. subtilis clpC operon, in which the promoter region also carries three direct repeats, or one and a half CtsR binding sites, which also led to two protein–DNA complexes when incubated with CtsR in gel mobility shift experiments (Derréet al., 1999a).

imageimage

Figure 5. DNase I footprinting analysis of CtsR and HrcA binding to the hrcA and groESL promoter regions. Each lane contains 50 000 c.p.m. of radiolabelled DNA fragment corresponding to the dnaK (A) or groESL (B) promoter regions incubated with 5 µg of purified CtsR and/or HrcA. Lane 1, no protein; lane 2, CtsR; lane 3, HrcA; lane 4, CtsR + HrcA; lane 5, G+A Maxam and Gilbert reaction of the corresponding DNA fragment (template strand). Regions protected from DNase I cleavage are indicated by brackets on the left-hand side for CtsR and the right-hand side for HrcA.

C. Nucleotide sequences of the dnaK and groESL promoter regions. Consensus −35 and −10 sequences are overlined; transcriptional start points are indicated by +1; CtsR heptad direct repeat operator sequences are indicated by arrows; the CIRCE operator sequence is indicated by inverted arrows; regions protected in DNase I footprinting experiments by CtsR and HrcA are indicated by brackets or shaded brackets below the sequence respectively. Positions are numbered relative to the translation initiation codon.

Owing to the insoluble nature of HrcA, no DNase I footprinting results have been reported to date. As shown here, HrcA protects two areas within each promoter region, extending from positions −11 to −24 and −30 to −44 for dnaK (Fig. 5A, lane 3) and from −28 to −42 and −47 to −62 for groESL (Fig. 5B, lane 3). These regions contain the two inverted repeat sequences of the CIRCE element and the transcription initiation site (Fig. 5C). When both proteins were added to the DNA, the regions protected by both HrcA and CtsR were observed (Fig. 5A and B, lanes 4), confirming that the two repressors can bind simultaneously to their specific operator sequences.

Repression by CtsR and HrcA of S. aureus is not redundant

CtsR and HrcA both repress the dnaK and groESL operons, known to be induced under heat shock conditions. In order to examine the in vivo contribution of each repressor, expression of the groESL operon was compared by primer extension experiments in S. aureus RN4220 and different mutant strains: SA2000 (ΔctsR), SA2001 (ΔhrcA) and SA2002 (ΔctsRΔhrcA) (see Experimental procedures). As shown in Fig. 6, the groESL operon is expressed at a low basal level in strain RN4220 during growth in brain–heart infusion (BHI) at 37°C (Fig. 6, lane 1). Primer extension experiments carried out using RNA from strains SA2000 (ΔctsR) or SA2001 (ΔhrcA) revealed transcription levels of groESL that were increased three- to fourfold in either of the mutants (Fig. 6, lanes 2 and 3). In the ΔctsRΔhrcA mutant (strain SA2002), however, groESL expression was increased 20-fold (Fig. 6, lane 4), indicating that the two repressors act together synergistically to maintain low expression levels in the absence of stress. As a control, primer extension experiments were performed in parallel on the clpB gene, which is only controlled by CtsR, and expression levels were identical in strain RN4220 and the ΔhrcA mutant, or in the ΔctsR and ΔctsRΔhrcA mutants, as expected (data not shown). When cells were subjected to a 10 min heat shock at 46°C, full derepression of groESL transcription was observed in all strains (Fig. 6, lanes 5–8).

image

Figure 6. Primer extension analysis of groESL transcription in different genetic backgrounds, during growth at 37°C (lanes 1–4) or after a 10 min heat shock at 46°C (lanes 5–8). Total RNA (10 µg) isolated from the wild-type S . aureus strains RN4220 (lanes 1 and 5), SA2000 (Δ ctsR ) (lanes 2 and 6), SA2001 (Δ hrcA ) (lanes 3 and 7) or SA2002 (Δ ctsR Δ hrcA ) (lanes 4 and 8) was used as a template for reverse transcriptase. The corresponding DNA sequence is shown on the left.

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

Unlike the model organisms B. subtilis and E. coli, little was known until recently about the regulation of stress response in S. aureus. Analysis of the complete genome sequence (Kuroda et al., 2001) and several recent reports indicate the existence of the σB (Gertz et al., 2000) and HrcA (Kuroda et al., 1999) regulons in S. aureus, and we recently identified an orthologue of the CtsR class III stress regulator, as well as several potential target genes (Derréet al., 1999a).

However, the presence of potential CtsR binding sites in the promoter regions of the dnaK and groESL operons was rather unexpected, as their expression was known to be controlled by HrcA (Kuroda et al., 1999). This finding suggested the existence of a regulatory overlap between class I and class III genes, with dual heat shock regulation by CtsR and HrcA.

Using three different approaches, we have shown that the S. aureus dnaK and groESL operons are indeed repressed by both CtsR and HrcA. Using B. subtilis as a heterologous host, we showed that transcription from the dnaK or groESL promoters was significantly decreased in the presence of S. aureus CtsR or HrcA. By constructing inactivation mutants of S. aureushrcA, ΔctsR, ΔhrcAΔctsR), we were able to show that CtsR and HrcA act synergistically to maintain low expression levels of groESL in the absence of stress.

An in vitro protein–DNA interaction approach using purified CtsR and HrcA proteins from S. aureus allowed us to show independent or simultaneous binding of both proteins to the dnaK and groESL promoter regions by gel mobility shift and DNase I footprinting. The CIRCE sequence is located downstream from the transcription start site (Fig. 5C), as is the case for most genes controlled by HrcA, whereas the CtsR direct repeat operator overlaps the −10 or −35 promoter sequences (Fig. 5C) in agreement with previously characterized CtsR binding sites (Derréet al., 1999a; Schumann et al., 2002).

Previous attempts at purifying HrcA in an active form have been hampered by the low solubility of this protein, which forms inclusion bodies in E. coli and aggregates rapidly in the absence of denaturing agents such as urea (Ohta et al., 1996; Mogk et al., 1997; Minder et al., 2000; Martirani et al., 2001). For this reason, DNase I footprinting data for HrcA have been lacking until now. Previous in vitro gel mobility shift experiments used purified HrcA from either a Gram-negative bacterium, Bradyrhizobium japonicum (Minder et al., 2000), or thermophilic organisms such as Streptococcus thermophilus or Bacillus stearothermophilus, under partially denaturing conditions or in the presence of purified GroEL (Mogk et al., 1997; Martirani et al., 2001). In each case, most of the HrcA protein was inactive, with only a small fraction of the radiolabelled DNA fragment sequestered in the protein–DNA complex, precluding more detailed analyses such as DNase I footprinting.

Recently, the HrcA protein from another thermophile, Bacillus thermoglucosidasius, was purified and renatured to an active form by solubilization in the presence of DNA containing the CIRCE element (Watanabe et al., 2001). Based on a modification of this protocol, we purified active S. aureus HrcA in non-denaturing conditions without the addition of GroEL or of DNA containing the CIRCE element. This is the first report of active HrcA from a Gram-positive non-thermophilic organism, allowing us to carry out both gel mobility shift DNA-binding assays and DNase I footprinting experiments.

We show here that HrcA protects two regions in each of the dnaK and groESL promoters, which contain the inverted repeat sequences known as CIRCE. Interestingly, the poorly conserved 9 bp separating the two inverted repeats are not protected from DNase I cleavage (Fig. 5), indicating that HrcA binds specifically to the inverted repeats and not to the inter-repeat region, contrary to a previous report based on atomic force microscopy (Ohta et al., 1996). The presence of DNase I hypersensitive sites within the regions protected by HrcA suggests that the DNA undergoes bending once HrcA is bound (Fig. 5). The palindromic nature of the HrcA binding site strongly suggests that the protein binds as a dimer, with its twofold axis of symmetry coinciding with that of the DNA binding site. This is in agreement with a previous report indicating that HrcA is likely to form a homodimer in solution (Martirani et al., 2001). The two 9 bp inverted repeat sequences are separated by 9 bp, thus placing them two turns apart on the same face of the DNA double helix. The two HrcA subunits would therefore interact in the same manner with each inverted repeat, which is typical of HTH DNA-binding proteins. However, no classical HTH motif could be detected within HrcA using the method of Dodd and Egan (1990), although some limited similarity has been reported with the DeoR family of DNA-binding proteins (W. Schumann, personal communication).

Comparative genomics indicate that CtsR and its target sequences are highly conserved among low-G+C Gram-positive bacteria, including several pathogens (Schumann et al., 2002). Genome sequence analysis allowed us to predict the existence in many Gram-positive bacteria of an overlap between class I and class III genes, suggesting that several may be under dual heat shock regulation by CtsR and HrcA (Fig. 7). Indeed, in B. subtilis and closely related species (B. anthracis, B. stearothermophilus, B. halodurans, Clostridium acetobutylicum, C. difficile, C. perfringens, L. monocytogenes, L. innocua), the HrcA and CtsR regulons are clearly distinct (Fig. 7). In the Streptococci group (S. pneumoniae, S. pyogenes, S. mutans, S. agalactiae, S. thermophilus, Lactococcus lactis), the two regulons partially overlap, as the groESL operon belongs to both, with the highly conserved CIRCE-HrcA recognition sequence as well as the CtsR target site organized in tandem (Chastanet et al., 2001). Interestingly, although there is no CtsR binding site upstream from the dnaK operon in these bacteria, two CIRCE operator sequences are present instead within the promoter region in every case except L. lactis, perhaps compensating for the absence of combined dual repression by CtsR and HrcA. We have also noted the presence of a vestigial CtsR binding site upstream from the dnaK operon promoter of L. monocytogenes, which is controlled by HrcA. CtsR binds to this site, but is not able to repress, as the active promoter and transcription start site lie in between the CtsR operator and the CIRCE sequence (A. Chastanet, unpublished results). This may represent an evolutionary remnant, suggesting that this operon was once under dual regulation like that of the closely related bacterium S. aureus.

image

Figure 7. Dual regulation by CtsR and HrcA is present in several Gram-positive bacteria. In the Bacillus group (top), the dnaK and groESL operons are only controlled by HrcA. In the Streptococcus group (middle), the dnaK operon has two tandemly arranged CIRCE HrcA binding sites but no CtsR box (*with the exception of L. lactis in which only one CIRCE sequence is present). Among the bacteria in this group, the groESL operon has operator sequences for both CtsR and HrcA in every case. In the Staphylococcus group (bottom), both the dnaK and groESL operons are dually regulated by CtsR and HrcA, with single operator sequences for each repressor.

Download figure to PowerPoint

In S. aureus and S. epidermidis, however, the entire HrcA regulon (dnaK and groESL operons) is embedded within the CtsR regulon, with the synthesis of HrcA itself repressed by CtsR, as hrcA is the first gene of the dnaK operon (Fig. 8). Many clp genes of S. aureus (clpB, clpP, clpC) are also controlled by CtsR but not by HrcA (A. Chastanet, unpublished results; Fig. 8). In an attempt to identify specific signals to which only CtsR or HrcA might respond, stress gene expression was examined in S. aureus under different conditions. Expression of both clpB and the dnaK operon was strongly induced during heat shock or growth in the presence of SDS or ethanol but not by salt, alkaline or acid stress (data not shown). Furthermore, expression of the dnaK operon was not significantly different in the parental strain or the ΔctsR mutant after heat shock or ethanol stress (data not shown). These results suggest that both HrcA and CtsR respond to heat shock and ethanol stress. Thus, in S. aureus, there appear to be only three distinct classes of heat shock genes, as class I genes, defined in B. subtilis as the HrcA regulon, are in fact a subgroup of class III genes, the CtsR regulon. The remaining stress response genes belong to class II (σB) or class IV, a heterogeneous class of genes, the regulatory mechanisms of which remain to be defined.

image

Figure 8. The HrcA regulon of S . aureus is entirely embedded within the CtsR regulon, with the synthesis of HrcA itself repressed by CtsR. Many of the clp genes of S . aureus ( clpB , clpP , clpC ) appear to be controlled by CtsR but not by HrcA. Perpendicular bars indicate negative regulation, and arrows indicate protein synthesis. The arrow linking GroESL to HrcA indicates the positive role that the GroE chaperonin machine is thought to play in allowing HrcA to adopt an active conformation.

Download figure to PowerPoint

Several reports indicate induction of GroEL synthesis in L. monocytogenes (Gahan et al., 2001) or S. aureus (Qoronfleh et al., 1998) during the infectious process, suggesting that the chaperonin may be produced specifically in response to host cell signals. CtsR also controls the stress-induced synthesis of Clp ATP-dependent protease subunits, which are implicated in the virulence of several pathogens (Misra et al., 1996; Rouquette et al., 1998; Gaillot et al., 2000; 2001). The presence of a CtsR binding site upstream from the ctsR clpC operon and the existence of a CIRCE sequence within the promoter region of the dnaK operon strongly suggest that both CtsR and HrcA negatively autoregulate their own synthesis. As CtsR also represses hrcA expression and that of the entire HrcA regulon in S. aureus, this dual regulatory mechanism ensures that the dnaK and groESL operons can only be expressed under stress conditions such as host infection that must also induce the expression of genes belonging to the CtsR regulon (clpB, clpP, clpC). Furthermore, combined repression by CtsR and HrcA allows expression of these genes to be maintained at very low basal levels in the absence of stress, as the two repressors act synergistically, allowing 20-fold repression of groESL expression levels, whereas either repressor alone only allows approximately threefold repression (Fig. 6). Dual regulation by CtsR and HrcA of the S. aureus dnaK and groESL operons could therefore play an important role in ensuring that synthesis of the classical chaperones is tightly co-ordinated with that of the Clp proteins during host infection, thus enhancing the adaptability of this pathogen under adverse environmental conditions.

Experimental procedures

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

Strains and media

Bacillus subtilis and S . aureus strains used in this study are listed in Table 1 . Escherichia coli K-12 strain TG1 ( Gibson, 1984 ) was used for cloning experiments, and E. coli strain BL21 λDE3 ( Studier and Moffatt, 1986 ) for protein overexpression and purification. E. coli strains were grown in LB medium and transformed by electroporation ( Sambrook et al., 1989 ). B. subtilis 168 trpC2 derivatives were grown in LB medium and transformed as described previously ( Msadek et al., 1998 ). S . aureus RN4220 ( Kreiswirth et al., 1983 ) and its derivatives were grown in BHI and transformed by electroporation, with selection on BHI plates supplemented with spectinomycin (100 µg ml −1 ) or erythromycin (1 µg ml −1 ) plus lincomycin (25 µg ml −1 ).

DNA manipulations

Standard procedures were used to extract plasmids from E. coli (Sambrook et al., 1989). Chromosomal DNA of B. subtilis and S. aureus was isolated as described previously (Msadek et al., 1998), except for lysis of S. aureus cells, which was carried out using lysostaphin (60 µg ml−1). DNA sequencing and polymerase chain reactions (PCRs) were carried out as described previously (Chastanet et al., 2001).

Plasmid constructions

Plasmids used in this study are listed in Table 2 and oligonucleotides in Table 3. Plasmid pDK (Chastanet et al., 2001) was used for constructing transcriptional fusions between the promoter regions of the S. aureus dnaK or groESL operons and the B. stearothermophilus bgaB gene, encoding a thermostable β-galactosidase (Hirata et al., 1986), with subsequent integration at the B. subtilis amyE locus. Transcriptional fusions in pDK were constructed using EcoRI–BamHI DNA fragments generated by PCR using oligonucleotide pairs TM286/TM287 and AC34/AC35, corresponding to the S. aureus dnaK and groESL promoter regions respectively. These fragments were cloned into the respective sites of plasmid pDK to produce plasmids pDKdnaKSau and pDKgroESau respectively.

Table 2. .  Plasmids used in this study.
PlasmidsDescriptionSource or reference
pXTPlasmid allowing integration at the thrC locus and expression from the PxylA xylose-inducible promoter Derréet al. (2000 )
pXTctsRsaupXT derivative carrying the S. aureus ctsR coding sequenceThis study
pXThrcAsaupXT derivative carrying the S. aureus hrcA coding sequenceThis study
pDKPlasmid allowing transcriptional fusions with bgaB and integration at the amyE locus Chastanet et al. (2001 )
pDKdnaKsaupDK derivative carrying a dnaK∠bgaB fusionThis study
pDKgroEsaupDK derivative carrying a groE∠bgaB fusionThis study
pET16bVector for overproducing His-tagged proteinsNovagen
pET28aVector for overproducing His-tagged proteinsNovagen
pET28/16pET16b derivative for overproduction of His-tagged proteinsThis study
pETHisCtsRpET28/16 derivative for overproduction of CtsRThis study
pETHisHrcApET28/16 derivative for overproduction of HrcAThis study
pRN5101pE194 derivative with a thermosensitive origin of replication Villafane et al. (1987 )
pRNΔctsRpRN5101 derivative carrying a spc gene, for deletion/replacement of the S. aureus ctsR geneThis study
pMADpRN5101 derivative carrying a constitutively expressed bgaB geneM. Débarbouillé and M. Arnaud (unpublished)
pMADΔhrcApMAD derivative, for deletion/replacement of the S. aureus hrcA geneThis study
Table 3. .  Oligonucleotides used in this study.
NameSequenceDescription
TM286GAAGAATTCAAGCTTTCCTAATAAATGATTAAAAAAATTG pdnaK∠bgaB fusion
TM287GGAGGATCCATGTTTTCACCTCATTAGCACTCAC pdnaK∠bgaB fusion
AC34GAAGAATTCGTAAATAACTTGAAGTTACAAAAC pgroE∠bgaB fusion
AC35GGAGGATCCTGATTGTTCCTCCTTAAAAAACC pgroE∠bgaB fusion
AC3GGAGGATCCAAAGGGGTGATATACATGCAC pxylA∠ctsR fusion
AC4GAAGAATTCACCTCATTTCATTTAGTAATA pxylA∠ctsR fusion
AC11AAGAAGCTTGCTAATGAGGTGAAAACATGATTACAGATAGGC pxylA∠hrcA fusion
AC12GAAGAATTCTTTCTAATCCATCATTACCAAATTCTATTTA pxylA∠hrcA fusion
AC76ATACATATGCACAATATGTCTGACATC ctsR overexpression
AC77TCAGGATCCTTAGTAATAATTTATAACTGGTAAC ctsR overexpression
AC78GAACATATGATTACAGATAGGCAATTGAG hrcA overexpression
AC79AATGGATCCTTACCAAATTCTATTTAATAATTG hrcA overexpression
AC26AAGCTTTCCTAATAAATGATTAAAAAAATTGpdnaK DNase I footprint
AC27CGCTCAATTAGTGTTTTAGAACCAACGGGpdnaK DNase I footprint
AC108GCCCATAATCTTGTCATAATTTTCCpgroE DNase I footprint
AC109CACGATTTCCAATTGGTTTTAGCpgroE DNase I footprint
TM323GAAGAATTCGCTCTCTGAATTTCAACGACA ctsR deletion
TM324GAAGAATTCACCTAGATCCTTTTGACTCTA spc cassette
TM325GGTGGTACCTGTTATTGCAATAAAATTAGC spc cassette
TM326GGAGGATCCCATTGCGCCTACAATGACAGC ctsR deletion
TM327ATGGGTACCTAGAAAGTATTGGAGGACAGA ctsR deletion
TM328AAGAAGCTTGATTATATAAAGCCTGTAATG ctsR deletion
JF3TACGGATCCCGTTTACAATCACAGGCGAGT hrcA deletion
JF4GTTTCTAGATCATTAGCACTCACTTATCTC hrcA deletion
JF5ATGGGTACCTAGAAAGTATTGGAGGACAGA hrcA deletion
JF6CTGGAGCTCCTTGTGGTGTGTATGATTTAC hrcA deletion

Plasmid pXT (Derréet al., 2000) was used to integrate copies of the S. aureus ctsR and/or hrcA genes at the B. subtilis thrC locus under the control of a xylose-inducible promoter (PxylA). A BamHI–EcoRI DNA fragment corresponding to the coding sequence of S. aureus ctsR was generated by PCR using oligonucleotides AC3/AC4, and a HindIII–EcoRI DNA fragment corresponding to the coding sequence of S. aureus hrcA was generated by PCR using oligonucleotides AC11/AC12. These fragments were cloned into the respective sites of pXT to yield plasmids pXTctsRSau and pXThrcASau respectively.

CtsR and HrcA were overexpressed using pETHisCtsR and pETHisHrcA respectively. First, a derivative of plasmid pET16b (Novagen) was constructed, by replacing the 171 bp XbaI–BlpI fragment of pET16b with the 262 bp XbaI–BlpI fragment of pET28a (Novagen) to give plasmid pET28/16. In a second step, NdeI–BamHI DNA fragments, corresponding to the ctsR (471 bp) or hrcA (987 bp) coding sequences, were generated by PCR using oligonucleotide pairs AC76/AC77 or AC78/AC79, respectively, and cloned between the NdeI–BamHI sites of plasmid pET28/16. This allows the creation of translational fusions adding six histidine residues to the amino-terminus of the corresponding protein, placing expression of the genes under the control of a T7 promoter.

A deletion/replacement ΔctsR::spc mutant of S. aureus was generated using plasmid pRNΔctsR. This plasmid was constructed by first cloning a 1017 bp DNA fragment, generated by PCR using oligonucleotides TM324/TM325 and carrying the S. aureus spc spectinomycin resistance gene (Murphy, 1985), between two DNA fragments generated using oligonucleotides TM323/TM326 (1037 bp) and TM327/TM328 (1004 bp), corresponding, respectively, to the chromosomal DNA regions upstream and downstream from ctsR, in plasmid pRN5101, which has a thermosensitive pE194-based origin of replication (Villafane et al., 1987). The RN4220 S. aureus strain was transformed by pRNΔctsR with selection for erythromycin resistance. Transformants were grown at the non-permissive temperature (37°C), to select for cells in which the plasmid had been integrated into the chromosome by homologous recombination. To favour the second recombination event, a single colony was grown at 30°C for 10 generations and plated at 37°C overnight. SpectinomycinR/erythromycinS integrants (strain SA2000, ΔctsR::spc) arose through a double cross-over event, in which most of the ctsR coding sequence was deleted (codons 30–147) and replaced by the spc spectinomycin resistance gene, deprived of its transcription initiation and termination signals to prevent polar effects on the transcription of the remaining genes of the clpC operon.

A markerless ΔhrcA deletion mutant of S. aureus was constructed using a similar approach, by cloning two DNA fragments generated by PCR using oligonucleotides JF3/JF4 (1000 bp) and JF5/JF6 (1000 bp), corresponding, respectively, to the chromosomal DNA regions upstream and downstream from hrcA, in plasmid pMAD to yield plasmid pMADΔhrcA. pMAD is a pRN5101 derivative that carries a constitutively expressed transcriptional fusion with the bgaBβ-galactosidase gene, allowing easy detection on Xgal plates of transformants that have lost the plasmid vector through a double cross-over event (M. Arnaud and M. Débarbouillé, unpublished). Integration/excision of plasmid pMADΔhrcA was carried out as detailed above by transforming S. aureus strain RN4220, yielding strain SA2001 (ΔhrcA) in which the entire hrcA coding sequence was seamlessly removed, precisely fusing the regions immediately upstream and downstream from hrcA. PCR amplifications were used to confirm the loss of the ctsR or hrcA genes. Strain SA2002 (ΔctsRΔhrcA) was obtained by transforming strain SA2000 (ΔctsR) with the pMADΔhrcA plasmid.

Overproduction and purification of CtsR

pETHisCtsR was introduced into a BL21 λDE3 strain, in which the T7 RNA polymerase gene is under the control of the inducible lacUV5 promoter, which also carries the pRep4 plasmid allowing co-expression of the GroESL chaperonin, in order to optimize recombinant protein solubility (Amrein et al., 1995). The resulting strain was grown in LB medium at 30°C, and expression was induced during the mid-exponential growth phase by the addition of 0.1 mM IPTG. Cells were centrifuged at 10 800 g for 30 min and resuspended in 1/50th of the culture volume of buffer I (50 mM NaH2PO4, pH 8, 300 mM NaCl, 20 mM imidazole). Cells were disrupted by sonication, and cell debris was removed by two consecutive 30 min centrifugation steps at 17 200 g. E. coli crude protein extracts were loaded on a 0.15 ml Ni-NTA agarose (Qiagen) column equilibrated with buffer I. The column was washed with 10 volumes of buffer II (50 mM NaH2PO4, pH 6, 300 mM NaCl, 30 mM imidazole), and the CtsR protein was eluted with an imidazole gradient (30–500 mM). Fractions were pooled and dialysed against buffer III (50 mM NaH2PO4, pH 8, 300 mM NaCl, 50% glycerol) to remove imidazole and concentrate the protein solution approximately fourfold.

Purification and renaturation of HrcA

pETHisHrcA was introduced into the BL21 λDE3 pRep4 strain. His-tagged HrcA was overproduced by induction with IPTG (1 mM) and purified from the crude extract on a 0.15 ml Ni-NTA agarose column using the denaturing conditions (6 M urea) recommended by the manufacturer (Qiagen). Purified HrcA was then renatured in a two-step procedure essentially as described previously (Watanabe et al., 2001) using poly-(dI–dC) instead of plasmid DNA.

Gel mobility shift DNA-binding assays

Radiolabelled DNA fragments corresponding to the promoter regions of the ctsR and hrcA genes were generated by PCR using Pwo polymerase (Roche) and 20 pmol of oligonucleotides AC26/AC27 or AC108/AC109, respectively, one of which was previously labelled using T4 polynucleotide kinase (New England Biolabs) and [γ-32P]-dATP. DNA binding was performed as described previously (Derréet al., 1999a). After 15 min of binding at 4°C, samples were loaded directly onto a 6% polyacrylamide gel (89 mM Tris, 89 mM borate, 2 mM EDTA, 2.5% glycerol) during electrophoresis (14 V cm−1), which was then pursued for 1 h at 4°C.

DNase I footprinting

Radiolabelled DNA fragments corresponding to the ctsR or hrcA promoters prepared for gel shift experiments were used for DNase I footprinting. CtsR/HrcA binding to DNA was performed at 5°C in the presence of BSA (bovine serum albumin) (0.1 µg), and DNase I treatment was then performed as described previously (Derréet al., 1999a).

RNA extraction and primer extension

Staphylococcus aureus strains were grown in BHI medium at 37°C with aeration until the optical density reached 0.5–0.6 at 600 nm; half the culture was then shifted to 46°C, and incubation was pursued for another 10 min. Cells were pelleted and frozen immediately, and RNA extraction and primer extensions were performed as described previously ( Chastanet et al., 2001 ) using radiolabelled oligonucleotide AC109. Radioactive gels were exposed to storage phosphor screens and scanned with a Molecular Dynamics Storm 860 optical scanner. Quantification of primer extension products was performed using the imagequant 5.1 software package (Molecular Dynamics).

β-Galactosidase assays

β-Galactosidase activity was estimated on plates by Xgal hydrolysis (100 µg ml−1), and specific activities were determined as described previously (Chastanet et al., 2001), expressed as nmol of ONP min−1 mg−1 protein.

Database comparisons and sequence analysis

Computations were performed using the gcg sequence analysis software package (version 10.1). Sequence comparisons with the GenBank database were accomplished using the National Center for Biotechnology Information blast2 (Altschul et al., 1997) web server with the default parameter values provided.

Acknowledgements

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

We are grateful to Isabelle Derré for many helpful discussions, and Georges Rapoport for critical reading of the manuscript. We thank Marc Galimand for the gift of S. aureus RN4220 chromosomal DNA, as well as M. Arnaud and M. Débarbouillé for plasmid pMAD. We thank The Institute for Genomic Research, the University of Oklahoma Advanced Center for Genome Technology, the Laboratoire de Génomique des Microorganismes Pathogènes (Institut Pasteur), the Sanger Centre and Genome Therapeutics for generously providing access to unfinished microbial genome sequences, as well as Pascal Hols and Benoît Grossiord (Université Catholique de Louvain, Belgium) for the nucleotide sequences of stress genes from Streptococcus thermophilus LMG1831. This work was supported by research funds from the European Commission (grant QLG2-CT-1999-01455), the Centre National de la Recherche Scientifique, Institut Pasteur, Université Paris 7, Ministère de la Défense (Délégation Générale pour l’Armement, Grant 0034069004707501) and the Programme de Recherche Fondamentale en Microbiologie, Maladies Infectieuses et Parasitaires of the Ministère de la Recherche. Arnaud Chastanet was the recipient of a PhD thesis fellowship from the Ministère de la Recherche.

References

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References
  • Altschul, S.F., Madden, T.L., Schaffer, A.A., Zhang, J., Zhang, Z., Miller, W., and Lipman, D.J. (1997) Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res 25: 33893402.
  • Amrein, K.E., Takacs, B., Stieger, M., Molnos, J., Flint, N.A., and Burn, P. (1995) Purification and characterization of recombinant human p50csk protein- tyrosine kinase from an Escherichia coli expression system overproducing the bacterial chaperones GroES and GroEL. Proc Natl Acad Sci USA 92: 10481052.
  • Bukau, B. (1993) Regulation of the Escherichia coli heat-shock response. Mol Microbiol 9: 671680.
  • Chastanet, A., Prudhomme, M., Claverys, J.P., and Msadek, T. (2001) Regulation of Streptococcus pneumoniae clp genes and their role in competence development and stress survival. J Bacteriol 183: 72957307.
  • Clements, M.O., and Foster, S.J. (1999) Stress resistance in Staphylococcus aureus. Trends Microbiol 7: 458462.
  • Derré, I., Rapoport, G., and Msadek, T. (1999a) CtsR, a novel regulator of stress and heat shock response, controls clp and molecular chaperone gene expression in Gram-positive bacteria. Mol Microbiol 31: 117132 .
  • Derré, I., Rapoport, G., Devine, K., Rose, M., and Msadek, T. (1999b) ClpE, a novel type of HSP100 ATPase, is part of the CtsR heat shock regulon of Bacillus subtilis. Mol Microbiol 32: 581593.
  • Derré, I., Rapoport, G., and Msadek, T. (2000) The CtsR regulator of stress response is active as a dimer and specifically degraded in vivo at 37°C. Mol Microbiol 38: 335347.
  • Dodd, I.B., and Egan, J.B. (1990) Improved detection of helix-turn-helix DNA-binding motifs in protein sequences. Nucleic Acids Res 18: 50195026.
  • Gahan, C.G., O'Mahony, J., and Hill, C. (2001) Characterization of the groESL operon in Listeria monocytogenes: utilization of two reporter systems (gfp and hly) for evaluating in vivo expression. Infect Immun 69: 39243932.
  • Gaillot, O., Pellegrini, E., Bregenholt, S., Nair, S., and Berche, P. (2000) The ClpP serine protease is essential for the intracellular parasitism and virulence of Listeria monocytogenes. Mol Microbiol 35: 12861294.
  • Gaillot, O., Bregenholt, S., Jaubert, F., Di Santo, J.P., and Berche, P. (2001) Stress-induced ClpP serine protease of Listeria monocytogenes is essential for induction of listeriolysin O-dependent protective immunity. Infect Immun 69: 49384943.
  • Garduno, R.A., Garduno, E., and Hoffman, P.S. (1998) Surface-associated hsp60 chaperonin of Legionella pneumophila mediates invasion in a HeLa cell model. Infect Immun 66: 46024610.
  • Gertz, S., Engelmann, S., Schmid, R., Ziebandt, A.K., Tischer, K., Scharf, C., et al. (2000) Characterization of the σB regulon in Staphylococcus aureus. J Bacteriol 182: 69836991.
  • Gibson, T.J. (1984) Studies on the Epstein–Barr Virus Genome. PhD Thesis, University of Cambridge, Cambridge.
  • Gottesman, S., Wickner, S., and Maurizi, M.R. (1997) Protein quality control: triage by chaperones and proteases. Genes Dev 11: 815823.
  • Hanawa, T., Fukuda, M., Kawakami, H., Hirano, H., Kamiya, S., and Yamamoto, T. (1999) The Listeria monocytogenes DnaK chaperone is required for stress tolerance and efficient phagocytosis with macrophages. Cell Stress Chaperones 4: 118128.
  • Hennequin, C., Porcheray, F., Waligora-Dupriet, A., Collignon, A., Barc, M., Bourlioux, P., and Karjalainen, T. (2001) GroEL (Hsp60) of Clostridium difficile is involved in cell adherence. Microbiology 147: 8796.
  • Hirata, H., Fukazawa, T., Negoro, S., and Okada, H. (1986) Structure of a β-galactosidase gene of Bacillus stearothermophilus. J Bacteriol 166: 722727.
  • Hübel, A., Krobitsch, S., Horauf, A., and Clos, J. (1997) Leishmania major Hsp100 is required chiefly in the mammalian stage of the parasite. Mol Cell Biol 17: 59875995.
  • Kreiswirth, B.N., Lofdahl, S., Betley, M.J., O'Reilly, M., Schlievert, P.M., Bergdoll, M.S., and Novick, R.P. (1983) The toxic shock syndrome exotoxin structural gene is not detectably transmitted by a prophage. Nature 305: 709712.
  • Krüger, E., Zühlke, D., Witt, E., Ludwig, H., and Hecker, M. (2001) Clp-mediated proteolysis in Gram-positive bacteria is autoregulated by the stability of a repressor. EMBO J 20: 852863.
  • Kuroda, M., Kobayashi, D., Honda, K., Hayashi, H., and Ohta, T. (1999) The hsp operons are repressed by the hrc37 of the hsp70 operon in Staphylococcus aureus. Microbiol Immunol 43: 1927.
  • Kuroda, M., Ohta, T., Uchiyama, I., Baba, T., Yuzawa, H., Kobayashi, I., et al. (2001) Whole genome sequencing of meticillin-resistant Staphylococcus aureus. Lancet 357: 12251240.
  • Lau, G.W., Haataja, S., Lonetto, M., Kensit, S.E., Marra, A., Bryant, A.P., et al. (2001) A functional genomic analysis of type 3 Streptococcus pneumoniae virulence. Mol Microbiol 40: 555571.
  • Martirani, L., Raniello, R., Naclerio, G., Ricca, E., and De Felice, M. (2001) Identification of the DNA-binding protein, HrcA, of Streptococcus thermophilus. FEMS Microbiol Lett 198: 177182.
  • Mei, J.M., Nourbakhsh, F., Ford, C.W., and Holden, D.W. (1997) Identification of Staphylococcus aureus virulence genes in a murine model of bacteraemia using signature-tagged mutagenesis. Mol Microbiol 26: 399407.
  • Minder, A.C., Fischer, H.M., Hennecke, H., and Narberhaus, F. (2000) Role of HrcA and CIRCE in the heat shock regulatory network of Bradyrhizobium japonicum. J Bacteriol 182: 1422.
  • Misra, N., Habib, S., Ranjan, A., Hasnain, S.E., and Nath, I. (1996) Expression and functional characterisation of the clpC gene of Mycobacterium leprae: ClpC protein elicits human antibody response. Gene 172: 99104.
  • Mogk, A., Homuth, G., Scholz, C., Kim, L., Schmid, F.X., and Schumann, W. (1997) The GroE chaperonin machine is a major modulator of the CIRCE heat shock regulon of Bacillus subtilis. EMBO J 16: 45794590.
  • Msadek, T., Dartois, V., Kunst, F., Herbaud, M.-L., Denizot, F., and Rapoport, G. (1998) ClpP of Bacillus subtilis is required for competence development, motility, degradative enzyme synthesis, growth at high temperature and sporulation. Mol Microbiol 27: 899914.
  • Murphy, E. (1985) Nucleotide sequence of a spectinomycin adenyltransferase AAD(9) determinant from Staphylococcus aureus and its relationship to AAD(3′)(9). Mol Gen Genet 200: 3339.
  • Nair, S., Frehel, C., Nguyen, L., Escuyer, V., and Berche, P. (1999) ClpE, a novel member of the HSP100 family, is involved in cell division and virulence of Listeria monocytogenes. Mol Microbiol 31: 185196.
  • Nair, S., Milohanic, E., and Berche, P. (2000a) ClpC ATPase is required for cell adhesion and invasion of Listeria monocytogenes. Infect Immun 68: 70617068 .
  • Nair, S., Derré, I., Msadek, T., Gaillot, O., and Berche, P. (2000b) CtsR controls class III heat shock gene expression in the human pathogen Listeria monocytogenes. Mol Microbiol 35: 800811.
  • Ohta, T., Nettikadan, S., Tokumasu, F., Ideno, H., Abe, Y., Kuroda, M., et al. (1996) Atomic force microscopy proposes a novel model for stem–loop structure that binds a heat shock protein in the Staphylococcus aureus HSP70 operon. Biochem Biophys Res Commun 226: 730734.
  • Polissi, A., Pontiggia, A., Feger, G., Altieri, M., Mottl, H., Ferrari, L., and Simon, D. (1998) Large-scale identification of virulence genes from Streptococcus pneumoniae. Infect Immun 66: 56205629.
  • Price, C.W. (2002) General stress response. In Bacillus subtilis and its Closest Relatives: from Genes to Cells. Sonenshein, A.L., Hoch, J.A., and Losick, R.M. (eds). Washington, DC: American Society for Microbiology Press, pp. 369384.
  • Qoronfleh, M.W., Weraarchakul, W., and Wilkinson, B.J. (1993) Antibodies to a range of Staphylococcus aureus and Escherichia coli heat shock proteins in sera from patients with S. aureus endocarditis. Infect Immun 61: 15671570.
  • Qoronfleh, M.W., Bortner, C.A., Schwartzberg, P., and Wilkinson, B.J. (1998) Enhanced levels of Staphylococcus aureus stress protein GroEL and DnaK homologs early in infection of human epithelial cells. Infect Immun 66: 30243027.
  • Rouquette, C., Ripio, M.-T., Pellegrini, E., Bolla, J.-M., Tascon, R.I., Vázquez-Boland, J.-A., and Berche, P. (1996) Identification of a ClpC ATPase required for stress tolerance and in vivo survival of Listeria monocytogenes. Mol Microbiol 21: 977987.
  • Rouquette, C., De Chastellier, C., Nair, S., and Berche, P. (1998) The ClpC ATPase of Listeria monocytogenes is a general stress protein required for virulence and promoting early bacterial escape from the phagosome of macrophages. Mol Microbiol 27: 12351246.
  • Sambrook, J., Fritsch, E.F., and Maniatis, T. (1989) Molecular Cloning: a Laboratory Manual, 2nd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press.
  • Schumann, W., Hecker, M., and Msadek, T. (2002) Regulation and function of heat-inducible genes in Bacillus subtilis. In: Bacillus subtilis and its Closest Relatives: from Genes to Cells. Sonenshein, A.L., Hoch, J.A., and Losick, R.M. (eds). Washington, DC: American Society for Microbiology Press, pp. 359368.
  • Studier, F.W., and Moffatt, B.A. (1986) Use of bacteriophage T7 RNA polymerase to direct selective high-level expression of cloned genes. J Mol Biol 189: 113130.
  • Varmanen, P., Ingmer, H., and Vogensen, F.K. (2000) ctsR of Lactococcus lactis encodes a negative regulator of clp gene expression. Microbiology 146: 14471455.
  • Villafane, R., Bechhofer, D.H., Narayanan, C.S., and Dubnau, D. (1987) Replication control genes of plasmid pE194. J Bacteriol 169: 48224829.
  • Watanabe, K., Yamamoto, T., and Suzuki, Y. (2001) Renaturation of Bacillus thermoglucosidasius HrcA repressor by DNA and thermostability of the HrcA-DNA complex in vitro. J Bacteriol 183: 155161.