SEARCH

SEARCH BY CITATION

Summary

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

Streptomycetes are mycelial bacteria that produce sporulating aerial hyphae on solid media. Bald (bld) mutants fail to form aerial mycelium under at least some conditions. bldA encodes the only tRNA species able to read the leucine codon UUA efficiently, implying the involvement of a TTA-containing gene in initiating aerial growth. One candidate for such a gene was bldH, because the bldH109 mutant of Streptomyces coelicolor resembles bldA mutants in some aspects. In the work reported here, adpAc, an S. coelicolor gene similar to the Streptomyces griseus A factor-regulated adpAg, was found to complement the bldH109 mutant partially at both single and multiple copies. The sequence of adpAc from the bldH109 mutant revealed a frameshift. A constructed in frame deletion of adpAc conferred a bald colony phenotype, and the mutant behaved like bldA mutants and bldH109 in its pattern of extracellular signal exchange. Both adpAc and adpAg contain a TTA codon. A TTA-free version of adpAc was engineered by replacing the TTA leucine codon with a cognate TTG leucine codon. The adpA(TTA[RIGHTWARDS ARROW]TTG) gene could partially restore aerial mycelium formation to a bldA mutant when it was followed in cis by the gene ornA, as in the natural chromosomal arrangement. This indicated that the UUA codon in adpAc mRNA is the principal target through which bldA influences morphological differentiation. It also implied that translational arrest at the UUA codon in adpAc mRNA caused a polar effect on the downstream ornA, and that the poor translation of both genes contributes extensively to the deficiency of aerial mycelium formation in bldA mutants. Unlike the situation in S. griseus, adpAc transcription does not depend on the host's γ-butyrolactone signalling system, at least in liquid cultures. In addition, sigma factor BldN, which is the homologue of an S. griseus sigma factor AdsA that is absent from adpAg mutants of S. griseus, was present in the constructed adpAc null mutant of S. coelicolor.


Introduction

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

In Streptomyces coelicolor, mutation of bldA, which encodes the tRNA for the rare leucine codon UUA, causes pleiotropic deficiencies in both the development of reproductive aerial hyphae and the production of antibiotics on most media (Merrick, 1976; Lawlor et al., 1987). Because most genes containing TTA codons are phenotypically very poorly expressed in bldA mutants, it is assumed that no essential genes contain this codon (Leskiw et al., 1991). (A caveat to this statement arises from the discovery that the UUA-containing mRNA for the pathway-specific regulator of the linked pathways to clavulanic acid and cephamycin C in Streptomyces clavuligerus is translated effectively in a bldA mutant; Trepanier et al., 2002.) Examination of the recently completed genome sequence of S. coelicolor (Bentley et al., 2002) reveals that only 145 of the 7825 genes in the 8.7 Mb genome contain a TTA codon, and none of these is recognizably a housekeeping gene. The TTA-containing genes include pathway-specific regulatory genes for the biosynthesis of at least two of the antibiotics made by S. coelicolor and, in each case, it has been shown that the regulatory gene is the sole and direct means by which bldA exerts its effects on production of the cognate antibiotic (Fernandez-Moreno et al., 1991; Passantino et al., 1991; White and Bibb, 1997; Guthrie et al., 1998). Thus, it appears that there is no globally acting bldA target gene for secondary metabolism and development. It might be supposed that bldA target genes should be found among mutants with developmental defects similar to bldA mutants. The literature describes at least 20 genes with mutations that lead to loss of aerial mycelium formation (the bald phenotype, hence the frequent designation of such genes as bld; for a list of bld genes, see Chater, 2001). DNA complementing most bld mutants has been cloned and characterized, but none of the genes identified contains a TTA codon. Thus, until now, bldA target genes influencing the development of S. coelicolor have remained undiscovered. The purpose of the work described in this paper was to identify such genes.

In extracellular complementation experiments on the rich medium R2YE, Willey et al. (1993) established a hierarchy of extracellular signal exchanges among bld mutants of S. coelicolor. A secreted oligopeptide is taken up via the bldK-specified ABC transporter (Nodwell et al., 1996; Nodwell and Losick, 1998), and its perception leads to the secretion of a second (unknown) extracellular signal, and so on through three further bld gene-dependent steps, until the morphogenetic protein SapB is secreted and allows aerial hyphae to form. Production of the second of the five proposed extracellular signals requires two known genes, bldA and bldH, which fall between bldK and bldG in the cascade. Not only do bldA and bldH have the same extracellular complementation phenotype, they also have a somewhat similar morphological phenotype (although the two previously described bldH mutants make pigmented antibiotics on minimal medium with mannitol as carbon source, unlike bldA mutants; Champness, 1988). In our search for the target gene(s) through which the bldA tRNA exerts its effects on morphological differentiation, we reasoned that bldH was a promising candidate. Our results confirm this prediction.

Results

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

Complementation of bldH, a potential target of bldA

In order to clone bldH, we attempted to restore aerial mycelium formation to WC109 [the bldH109 mutant used by Willey et al. (1993) in extracellular complementation] with a library of Sau3AI fragments inserted into the positive selection high-copy-number plasmid pIJ699 (Kieser and Melton, 1988). Several colonies (five out of ≈ 9000 transformants) were identified in which aerial growth had been partially restored (Fig. 1). All the clones contained overlapping DNA from the same part of the genome, with a common overlap that included three complete genes (SCO2791–2793 in the genome sequence; Bentley et al., 2002) (Fig. 1A). Further reduction of the DNA in one of the clones localized the bldH-complementing gene(s) to just one open reading frame (ORF), SCO2792, which was indeed one of the 145 TTA-containing S. coelicolor genes (Fig. 1C). Moreover, SCO2792 was a close homologue of adpA, a gene of Streptomyces griseus known to play a key role in development (84.4% identity between the gene products) (Ohnishi et al., 1999). The equivalence with adpA was further supported by local synteny of gene arrangement around the S. coelicolor and S. griseus genes (Fig. 1A). For clarity, in this paper, we use the subscripts c (coelicolor) and g (griseus) to distinguish between the genes of the two organisms. It is relevant to note that mutations in the gene downstream of the two adpA genes, ornA, have been shown previously to give rise to a slow-growing and sparse aerial mycelium formation phenotype, and that some ornAg transcripts emanate from the adpAg promoter region (Ohnishi et al., 2000). It is likely that the oligoribonuclease encoded by ornA is involved in mRNA degradation (Ohnishi et al., 2000).

image

Figure 1. Complementation of the bldH mutation of WC109 and localization of the complementing DNA to adpAc. A. Inserts of the bldH-complementing clones and subclones, and comparison with the equivalent region of Streptomyces griseus (Ohnishi et al., 1999; 2000). The vector in pSPH1, 2, 3, 4, 5 and pHZ2512 was pIJ699. The vector in pHZ2513 and pHZ2517 was pSET152. The size of each insert based on the genome sequence is given on the left. The left insert plasmid boundaries of pSPH1 and pSPH5 were not sequence identified; thus, only the estimated size is given. B. Plate showing complementation of bldH109 in WC109 by pSPH2, containing adpAc in the multicopy vector pIJ699. The cultures were grown on R2 medium for 3 days. C. Plate showing complementation of bldH109 in WC109 by pHZ2517, containing adpAc in the integrating vector pSET152. The cultures were grown on R2 medium for 3 days.

Download figure to PowerPoint

WC109 was caused to produce aerial mycelium even by a single copy of adpAc (Fig. 1C), reinforcing the possibility that the complementation was true, rather than some kind of suppression effect. We therefore sequenced adpAc from WC109 and found that it contained a frameshift mutation (Fig. 2). The protein resulting from the frameshift was deduced to be terminated at a stop codon only 5 bases downstream from the authentic stop codon, so any potential polar effects on expression of the downstream ornA gene were not expected to be severe; but the weak morphological defect remaining in the complemented mutant could have been attributable to slight polarity. Note that adpAc is separated by about one-third of the genome from the region to which bldH had been mapped genetically (Champness, 1988) [indeed, we had initially failed in attempts to complement bldH109 with a series of 37 overlapping cosmids (p8–1A9; Redenbach et al., 1996) encompassing nearly all the mthB–cysD interval, based on the genetic map location between mthB and cysD suggested by Champness (1988)]. In contrast to WC109, the bald phenotype of WC181, previously believed to be a bldH mutant (Champness, 1988), was not complemented by DNA containing adpAc, and sequencing revealed no mutations in the adpAc region of WC181 DNA, from 500 bp upstream of the start codon to 14 bp downstream of the stop codon (data not shown).

image

Figure 2. The sequence of adpAc from WC109 reveals a frameshift. An extra G (in bold) inserted after the G at nt 221 in adpAc shifted the reading frame a nucleotide forward, so the amino acid sequence after 74 amino acids was changed. The length of the new gene product is 399 amino acids, compared to 398 amino acids for the wild type AdpAc. The coding sequence is in bold, and the underlined bold denotes the amino acid sequence that has been changed in the mutant.

Download figure to PowerPoint

A constructed adpAc mutant shows a bald colony phenotype

An in frame deletion of adpAc was constructed by polymerase chain reaction (PCR) targeting. The resulting mutant, M851, showed a bald phenotype when grown on R2 (Fig. 3), R5 or SMMS media. However, there was no obvious mutant phenotype on MM mannitol or MS (data not shown). Unlike bldA mutants, and like bldH mutants, the colonies produced red pigment on certain media. This pigment might have been either of two known antibiotics made by S. coelicolor. In a simple test to discriminate between them, fuming of the plates with ammonia resulted in a yellow colour characteristic of undecylprodiginines (‘Red’ antibiotic), and not of actinorhodin which would turn blue (data not shown). The constructed mutation was responsible for the phenotype, as a wild-type copy of adpAc introduced on the pSET152 integrating vector fully restored the wild-type phenotype.

image

Figure 3. Deletion of adpAc causes a Bld phenotype that is complemented by adpAc. M851 was an adpAc in frame-deleted derivative of M145. The cultures shown here contained the integrating vector pSET152, which in one case carried a copy of adpAc (pHZ2517; Fig. 1A). Cultures were grown on R2 medium for 3 days.

Download figure to PowerPoint

If adpAc is a major and direct target for bldA, then the extracellular complementation pattern of M851 should be like that of bldA mutants and WC109, which have been shown to be stimulated to form aerial hyphae by growth close to a bldG mutant, and to be able to stimulate aerial growth of an adjacent bldK culture (Nodwell et al., 1996). Figure 4 shows that this was indeed the case: M851 restored a fringe of aerial mycelium production to a bldK mutant, whereas a bldG mutant restored a fringe of aerial mycelium production to M851.

image

Figure 4. The pattern of extracellular complementation exhibited by an adpAc mutant. M851 (ΔadpAc) restored a fringe of aerial mycelium production in bldK (arrow), while bldG restored a fringe of aerial mycelium production in M851 (arrow). The strains were grown on R5 for 3 days.

Download figure to PowerPoint

Transcription of adpAc does not depend on a γ-butyrolactone signalling molecule

In S. griseus, adpAg occupies a crucial position in the signal transduction system by which the γ-butyrolactone signalling molecule A factor activates morphological differentiation and secondary metabolism (Horinouchi, 2002). Expression of adpAg is directly repressed by ArpA, a γ-butyrolactone binding protein, and is induced at transition phase by the production of A factor. S. coelicolor produces a different spectrum of γ-butyrolactones. The S. coelicolor genome contains only one homologue of afsA, the S. griseus gene believed to be responsible for A factor biosynthesis (Horinouchi et al., 1989; Bentley et al., 2002), and disruption of this gene (scbA) eliminated γ-butyrolactone production and had the unexpected effect of increasing pigmented antibiotic production, while having no obvious effects on morphological differentiation (Takano et al., 2001). In addition, a mutant disrupted in scbR (the gene next to scbA), a homologue of arpA, which in S. griseus encodes the A factor-binding protein, produced no γ-butyrolactones, yet showed delayed production of Red (Takano et al., 2001). We analysed adpAc expression by S1 nuclease mapping using RNA isolated from liquid cultures of a wild type and its scbA, scbR disruption derivatives. Three apparent mRNA 5′ ends were detected (Fig. 5A) presumably corresponding to three promoters, and their expression was more or less constant during growth in the wild type (Fig. 5B); the same three mRNA 5′ ends were detected in samples from surface cultures of M145 and M600 (Fig. 5C). There was little difference in the profile of these three mRNAs in any of the strains used, except that, in surface cultures, p1 appeared to be used more abundantly, and the signals were diminished in the latest time samples, possibly approximately coinciding with the onset of sporulation in the aerial mycelium. Gel retardation experiments conducted using ScbR did not show any ScbR binding to the adpAc promoter region (data not shown). These results suggest that, unlike in the case of S. griseus, adpAc is not part of a γ-butyrolactone signal transduction cascade. Consistent with this, there is considerable sequence divergence between the adpA upstream regions of the two species in the region previously shown to bind ArpA in S. griseus, which corresponds to the major promoter of adpAg (Fig. 6; Ohnishi et al., 1999). Interestingly, although none of the three adpAc promoters corresponds in position to the published promoter of adpAg, they all have quite extensive similarity to equivalent regions in the non-coding region upstream of adpAg.

image

Figure 5. Transcription of adpAc is unaffected by mutations eliminating γ-butyrolactone production in liquid cultures. A. S1 nuclease mapping of the transcriptional start sites of adpAc was conducted using a 463 bp PCR product uniquely labelled at the 5′ end. The asterisks indicate the probable transcriptional start points; the sequences shown are those of the template strand. Lanes G, A, T and C are sequence ladders derived from the same labelled primer that was used to generate the PCR product. B. Transcription analysis of adpAc using RNA isolated from liquid SMMS-grown cultures of S. coelicolor M145, M751 (ΔscbA) and M752 (ΔscbR). p1, p2 and p3 indicate the three promoters of adpAc. E, TRAN and S indicate the exponential, transition and stationary phases of growth respectively. The shaded boxes labelled RED denote the presence of undecylprodigiosin, and the box labelled A denotes actinorhodin in the mycelium. C. Transcription analysis of adpAc using RNA isolated from solid R5-grown cultures of S. coelicolor M145 and M600. p1, p2 and p3 indicate the three promoters of adpAc. The numbers denote the time (h) after which the RNA was harvested, and arrows indicate the presence of vegetative mycelium or aerial mycelium in the cultures. A control shows that the signals from solid and liquid cultures of M600 co-migrate.

Download figure to PowerPoint

image

Figure 6. Sequence comparison of the adpAc and adpAg promoter regions. The upper line denotes the DNA sequence from S. griseus and the lower that from S. coelicolor. Transcriptional start sites are indicated by arrows. The coding sequences of adpAc and adpAg are indicated in bold. The underlined coding sequences represent homologous sequences. Presumptive −10 and −35 regions of adpAg are underlined, and the ArpA binding site is in bold (Ohnishi et al., 1999).

Download figure to PowerPoint

Sigma BldN is present in an adpAc mutant

In S. griseus, AdpA regulates a large number of genes (Horinouchi, 2002). One of these (adsA) encodes a sigma factor needed for development (Yamazaki et al., 2000). In S. coelicolor, the homologous protein, σBldN, is also necessary for aerial growth (Bibb et al., 2000). Levels of σBldN are affected by several different bld mutations. Notably, WC109 (bldH109) lacks σBldN, as detected by Western blotting, and contains no bldN mRNA (Bibb et al., 2000; Bibb and Buttner, 2003). On the simple assumption that bldH and adpAc are the same gene, we expected that the adpAc disruption mutant should also lack bldN expression. We analysed extracts of the mutant by Western blotting with antiσBldN antibodies and unexpectedly found an undiminished signal in the mutant compared with the bldH+ parent (Fig. 7). This result may indicate that either WC109 contains another mutation as well as its adpAc frameshift or the frameshift in adpAc in WC109 affects σBldN levels indirectly through polarity on the downstream oligoribonuclease gene ornA. However, in the adpAc insertion mutant that was constructed first to obtain the in frame mutant, σBldN was also present; so, in the polarity model, we would have to assume that the insertion has a less severe polarity effect than the bldH109 frameshift. Whatever the explanation for the discrepancy between the bldH109 and adpAc phenotypes with respect to bldN, the undiminished expression of bldN in the adpAc mutant again showed that adpA plays a somewhat different role in S. coelicolor from that previously found in S. griseus.

image

Figure 7. Western immunoblot analysis of σBldN expression during growth on R2YE solid medium of S. coelicolor M145 and the adpAc mutant M851. Molecular weight markers (MW) are shown in the leftmost lane in kDa. Days indicate the times for which the cultures were incubated.

Download figure to PowerPoint

The TTA codon in adpAc contributes markedly to the bldA dependence of normal development

Our discovery that a TTA-containing gene, adpAc, is needed for normal aerial mycelium development, and is involved in the same step in the extracellular signalling cascade for sporulation as bldA, led to the possibility that it might be the sole bldA target gene essential for differentiation. To test this, we generated a mutant copy of adpAc in which the TTA codon had been changed to the alternative leucine codon TTG. This mutant adpAc was inserted into pSET152, both with and without the downstream ornA gene, to give pHL72 and pHZ2528 respectively. The constructs were then introduced into a bldA mutant (J1700). The TTA-free adpAc restored aerial mycelium formation, but only when coupled in cis to ornA (Fig. 8), suggesting that bldA affects the translation of both adpAc and the downstream TTA-free ornA, and showing that the TTA codon in adpAc is a major contributor to the morphological deficiency of bldA mutants. Consistent with the idea of a cis-acting effect of the TTA codon in adpAc on ornA, some of the J1700/pHZ2528 adpAc(TTA)/adpAc(TTG) heterogenote colonies displayed sporulating sectors (which remained unpigmented), suggesting that recombinational interaction of the two adpAc copies had inserted the TTG codon into the adpAc copy located in its natural chromosomal position, where bldA-independent expression could bypass possible polarity on ornA.

image

Figure 8. Restoration of aerial hyphal formation to a bldA mutant when the TTA codon of adpAc is changed to a TTG codon. A. The insert of each construct introduced into the chromosomal φC31 attB site of the bldA mutant J1700. The vector in these constructs was pSET152. B. Restoration of aerial hyphal formation to J1700 by the TTA-free adpAc–ornA cassette. Cultures were grown on R2YE for 6 days.

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

Several pieces of evidence indicate that the principal cause of the bldH109 phenotype is a mutation in adpAc. Thus, adpAc at least partially complements bldH109; bldH109 contains a frameshift mutation in adpAc; an adpAc knockout mutant is defective in aerial growth but retains pigmented antibiotic production; and the adpAc mutant has the same extracellular complementation phenotype as the bldH109 mutant. The only other previously known candidate bldH mutant (WC181) proved not to be allelic with WC109. bldH (= adpAc) is the first S. coelicolor bld gene shown to contain a TTA codon, raising the possibility that it could provide (part of) the explanation for the morphological deficiency of bldA mutants. This hypothesis was strongly supported by the finding that the morphological defect of a bldA deletion mutant was largely suppressed by a TTA-free copy of adpAc when the mutation was in cis with a copy of the downstream gene ornA. Further work will be needed to establish whether this requirement for ornA is indeed a reflection of co-transcription of the two genes, especially in view of the 341 bp interval between them – in S. griseus the equivalent interval is 9 bp (Ohnishi et al., 2000).

We can now account for most of the main aspects of the bldA phenotype: failure to make actinorhodin is because of the presence of a TTA codon in actIIorf4, the essential pathway-specific activator gene for actinorhodin biosynthesis (Fernandez-Moreno et al., 1991; Passantino et al., 1991); failure to make undecylprodigiosin pigments is because of a TTA-containing gene, redZ, that is the first of two pathway-specific activators in the mini-cascade leading to undecylprodigiosin biosynthesis (White and Bibb, 1997; Guthrie et al., 1998); failure to make methylenomycin results from TTA codons in regulatory elements in the gene cluster for methylenomycin biosynthesis (S. O’Rourke, C. J. Bruton, N. Hartley and K. F. Chater, manuscript in preparation); and failure to make aerial hyphae is largely attributable to a TTA codon in a regulatory gene, adpAc. It was interesting to find that adpAc is not needed for undecylprodigiosin synthesis, in view of the fact that its apparent orthologue in S. griseus is needed for streptomycin biosynthesis, aerial growth and yellow pigment formation. In addition, the regulation of adpAc and adpAg seems to differ, notably in their dependence on γ-butyrolactones; and the promoter regions of adpA in the two species have only punctuated similarity to each other and show different transcriptional start points (Fig. 6). The S. coelicolor genome contains some seven adpA-like genes, of which adpAc is the most similar and the only one to show local synteny with adpAg. While it is clear that adpAc is not important for the production of at least one of the pigmented antibiotics of S. coelicolor (undecylprodigiosin), we cannot rule out the possibility of such a role for other adpA-like genes – indeed, if any of those genes do carry out such a role, then it is possible that adpAc does interact with secondary metabolism pathways, with this activity being masked by the presence of one or more other genes with overlapping function. A similar explanation is possible for the observation that, in S. coelicolor, adpAc is not needed for the expression of bldN, whereas in S. griseus, the equivalent sigma factor gene (adsA) is adpAg dependent (Yamazaki et al., 2000). We did not observe any obvious actinorhodin production in the constructed adpAc mutant, for reasons that remain to be determined. However, we note that actinorhodin production can be activated in a bldA mutant by changing the TTA codon in the actII-orf4 pathway-specific regulatory gene (Fernandez-Moreno et al., 1991). As the bldA mutation would have effectively inactivated adpAc expression in this strain, actinorhodin production is evidently not strongly dependent on adpAc. AdpA proteins are members of the AraC family of regulators, and AdpAg has been shown to bind DNA (Ohnishi et al., 1999), reinforcing the growing evidence that most bld genes are regulatory. Thus, the subsequent steps in the bld gene-mediated extracellular signalling cascade are defined by mutations in bldG (encoding a homologue of such antiantisigma proteins as SpoIIAA in Bacillus subtilis; Bignell et al., 2000), bldC and bldD (encoding DNA-binding proteins; A. Hunt, personal communication; Elliot et al., 1998; 2001). It follows that the bld genes that define the extracellular complementation cascade are not likely to be directly involved in the synthesis of a diffusible extracellular factor. We therefore assume that each of these regulatory genes directly or indirectly activates a pathway for production of the relevant factor. In addition, the pattern of extracellular complementation among the bld mutants used to define the cascade implies, for any one mutant, that none of the bld genes defining other steps is inactive in that mutant by any mechanism other than signal deficiency. In other words, we suggest that none of these bld genes is dependent for expression in a gene-to-gene manner on any of the bld genes governing other steps in the cascade. This in turn implies that the bld genes represent at least four distinct intracellular regulatory systems that must be activated to permit morphological differentiation on the rich R2YE medium, and which intercommunicate via the extracellular signals. In the simplest case, the extracellular signals would bind directly to the product of the bld gene involved in the next step in the cascade to activate production of the next signal. Signal production is presumed to be associated with different aspects of physiology, also under bld gene control, that are characteristic of the region of the colony from which aerial hyphae emerge. These aspects might include starvation, secondary metabolism, storage metabolism, cell–cell contact or controlled cell death. Only when all the bld gene-dependent processes have been activated, we suggest, will it be appropriate for aerial hyphae to emerge. This model has also been discussed in some detail by Chater and Horinouchi (2003).

Experimental procedures

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

Bacterial strains, plasmids, growth conditions

Streptomyces coelicolor A3(2) strains (Table 1) were manipulated as described previously (Kieser et al., 2000). For routine subcloning, Escherichia coli K-12 strains JM101, DH5α (Sambrook et al., 1989) and ET12567 (dam dcm hsdS; MacNeil et al., 1992) were grown and transformed according to Sambrook et al. (1989). ET12567 was used to propagate unmethylated cosmid DNA for introduction of DNA into S. coelicolor by transformation or conjugation. pIJ699, a high-copy-number positive selection vector (Kieser and Melton, 1988), was used for shotgun cloning in Streptomyces. pIJ2925 was a high-copy-number pUC-type plasmid used for routine subcloning (Kieser et al., 2000). pSET152 (Bierman et al., 1992), which integrates into the S. coelicolor chromosome by site-specific recombination at the bacteriophage φC31 attachment site, attB (Kuhstoss and Rao, 1991), was used to introduce single copies of genes into the S. coelicolor chromosome. SCC13 and SCC105 (Redenbach et al., 1996) were two cosmids carrying adpAc. E. coli BW25113/pIJ790 was the host for λRED-mediated PCR-targeted mutagenesis (Gust et al., 2003), and E. coli DH5α/BT340 was the host for FLP recombinase-mediated deletion of disruption cassettes to leave non-polar, phenotypically unmarked deletion mutations (Datsenko and Wanner, 2000). pIJ773 (Gust et al., 2003) was used as the template for amplification of a disruption cassette containing aac(3)IV (conferring apramycin resistance) and the RK2 origin of transfer (oriT), flanked by recognition sites for FLP recombinase.

Table 1. .S. coelicolor strains used in this study.
StrainRelevant genotypeSource or reference
M145PrototrophKieser et al. (2000)
M600PrototrophChakraburtty and Bibb (1997)
NS17bldK::aadANodwell et al. (1996)
WC103hisA1 uraA1 strA1 bldG103Champness (1988)
WC109hisA1 uraA1 strA1 bldH109Champness (1988)
WC181hisA1 uraA1 strA1′ bldH181′Champness (1988)
J1700hisA1 uraA1 strA1 bldA39Lawlor et al. (1987)
M751M145 ΔscbATakano et al. (2001)
M752M145 ΔscbRTakano et al. (2001)
M757M145 adpAc::aadC(3)IVThis study
M851M145 ΔadpAcThis study
J1501hisA1 uraA1strA1Kieser et al. (2000)

Several different Streptomyces media were used. SMMS medium was as reported by Takano et al. (2001). MS agar (Kieser et al., 2000) was used to make spore suspensions and for plating out conjugations with E. coli ET12567 containing the RP4 derivative pUZ8002 (Flett et al., 1997). R2, R2YE or R5 media and minimal medium (MM mannitol) (Kieser et al., 2000) were used for scoring sporulation. All Streptomyces cultivation was at 30°C.

Shotgun cloning of bldH

pIJ699 was digested with BamHI and BglII, then the 4.8 kb BglII fragment was gel purified. Self-religation of this vector fragment forms a long uninterrupted perfect palindrome, rendering the plasmid non-viable in host bacteria (Kieser and Melton, 1988). After partial digestion of M145 genomic DNA with Sau3AI, 4–8 kb fragments were agarose gel purified and ligated with the purified 4.8 kb pIJ699 BglII fragment. The ligation mixture was introduced into WC109 (bldH109) protoplasts, and transformants were selected by flooding the regeneration plates with thiostrepton (25 µg ml−1). Five individual colonies were found to form aerial mycelium at day 5 among ≈ 9000 transformants. The plasmids isolated from these colonies were named pSPH1, pSPH2, pSPH3, pSPH4 and pSPH5. For subcloning to localize the complementing DNA (Fig. 1), first the insert of pSPH2 was excised as a 3.2 kb HindIII fragment and inserted into pIJ2925 to give pHZ2511. The 2.4 kb BglII fragment of pHZ2511 was then ligated with BglII-digested pIJ699 to give pHZ2512, and the 0.9 kb SacII fragment was ligated with SacII-digested pSET152 to give pHZ2513. The 2.4 kb BglII fragment was also cloned in pSET152 to give pHZ2517.

Identification of the insert boundaries of the bldH complementing clones

The pSPH1 to pSPH5 plasmid insert boundaries were amplified by ligation-mediated PCR (LM-PCR) and sequenced. The oligonucleotides used were: UNIV5-AD1 (5′-GACTCGC GAATTCCGACAGTTGA), AGA1-AD2 (5′-GGCCTCAACT GTCG) and UNI699 (5′-CTAACGTCTGGAAAGACGAC). UNIV5-AD1 and AGA1-AD2 were annealed to give an adaptor with a 5′-GGCC overhang, which is cohesive with EagI digestion ends. UNI699 was complementary to a sequence near the cloning site of pIJ699. The plasmids to be sequenced were digested with EagI and then ligated with the adaptor. With the ligation mixture as template, UNIV5-AD1 and UNI699 were used to prime amplification of the two vector-insert junctions of each clone. The PCR product was gel purified and sequenced with UNI699 as primer. The sequences of the plasmid-insert boundaries were compared with the S. coelicolor genome sequence (http://www.sanger.ac.uk/Projects/S_coelicolor/) to reveal the inserts.

PCR sequencing of bldH

The adpAc alleles of WC109 and WC181 were sequenced as follows. First, the entire adpAc segments were PCR amplified from both strains using Pfu, a high-fidelity DNA polymerase. The primers were adp1 (5′-CCGAATTCCACCTGCACGGA CAGG) and adp2 (5′-AGGGATCCGTCTGCTCACCTCACG), which were complementary to sequences upstream and downstream of the adpAc ORF but with an EcoRI and a BamHI site respectively. The amplification included the region from 303 bp upstream of the translation start codon GTG to 14 bp downstream of the stop codon. The purified 1525 bp PCR products of the two strains were digested with BamHI and EcoRI and cloned into pIJ2925 to give pHZ2516 and pHZ2519 respectively. pHZ2516 and pHZ2519 were then sent to TaKaRa Biotechnology (Dalian) for sequencing. The resulting sequences were compared with the EMBL database to identify any mutations. The DNA region around the mutated point found in WC109 was further confirmed by sequencing the PCR products using genomic DNA of both strains as templates. The primers for PCR and sequencing were adp19 (5′-CCATGTCGACAATGTCCCAAG) and adp4 (5′-GGGTCGACGTGCACCGACGG). The promoter regions of both strains, from 500 bp upstream to 111 bp downstream of the GTG start codon, extending 125 bp into the upstream divergent gene, were PCR amplified and sequenced. The primers used were adp2 (5′-GTCTGCTGCTGCGGCGT TCCG) and adp11 (5′-GAACTCTCGAAGATGGGGCCG).

S1 nuclease mapping

RNA was isolated as described by Strauch et al. (1991). For each S1 nuclease reaction, 30 or 40 µg of RNA was hybridized in NaTCA buffer [Murray, 1986; solid NaTCA (Aldrich) dissolved to 3 M in 50 mM PIPES, 5 mM EDTA, pH 7.0] to about 0.002 pmol (≈ 104 Cerenkov counts min−1) of the following probes. For adpAc, the oligonucleotide 5′-CACCCT TCGGGTCTGTCGCTC, which anneals within the adpAc coding region, was uniquely labelled at its 5′ end with [32P]-ATP using T4 polynucleotide kinase and used in the PCR with the unlabelled oligonucleotide 5′-GTCTGCTGCTGCGGCG TTCCG, which anneals upstream of the adpAc promoter, to generate a 463 bp probe. The cosmid SCC13 (Redenbach et al., 1996) was used as the PCR template. For hrdB, the probe was made as described previously (Aigle et al., 2000). Subsequent steps were as described by Strauch et al. (1991). The sequence ladder was generated using a Sequenase 7-deaza-GTP sequencing kit (USB) with the same labelled primer as was used for the probe.

Construction and complementation of in frame deletion mutants of adpAc

A mutant adpAc allele, in which most of the adpAc coding region (amino acids 57–378 out of 398) was deleted, was constructed by PCR targeting using oligonucleotide primers (5′-C A T C T TCGAGAGTTCCATACCGCTGCGGTGTTCGGG ATCATTCCGGGGATCCGTCGACC and 5′-G C G G C G G  GTCTGG A ACGGGACCGCGTTCTCCGGGGCGAGGTGTAGGCTGGAGCTGCTT) with 5′ ends overlapping the 5′ and 3′ ends of the adpA coding sequence, and 3′ (priming) ends designed to amplify the apramycin resistance disruption cassette of pIJ773. The PCR product was introduced into E. coli BW25113/pIJ790 containing cosmid SCC13, preinduced for λRED functions by the addition of arabinose, to obtain an adpAc-disrupted version of SCC13. The disrupted cosmid was isolated and transferred via E. coli strain ET12567/pUZ8002 to S. coelicolor M145 by conjugation. Single cross-over exconjugants were selected on MS agar containing apramycin. Three such colonies were taken through two rounds of non-selective growth on MS agar, and spores were then plated for single colonies, which were scored for kanamycin sensitivity. Deletions within adpAc were confirmed by Southern hybridization (Kieser et al., 2000) using a PCR-generated probe (labelled with 32P by random oligopriming; Pharmacia). One such strain was designated M757. To construct a phenotypically unmarked in frame deletion, the adpAc-disrupted cosmid SCC13 adpAc::aac(3)IV was introduced into E. coli DH5α/BT340 to excise the disruption cassette from the cosmid by FLP recombinase. The resulting cosmid SCC13 ΔadpAc was then transferred to S. coelicolor M757 by conjugation via ET12567. Single cross-over exconjugants were selected on MS agar containing kanamycin and apramycin. Three such colonies were then taken through one round of non-selective growth on MS agar, and spores were plated for single colonies, which were scored for kanamycin and apramycin sensitivity. All the colonies tested were kanamycin and apramycin sensitive and were deleted for adpAc. Deletion within adpAc was confirmed by Southern hybridization using the same probe described above, and one such strain was designated M851. To complement the mutants, pHZ2517 (see above), which was a pSET152 derivative containing adpAc and its promoter, was transferred into S. coelicolor by conjugation via ET12567. Exconjugants were purified by single-colony isolation on medium containing apramycin, and plasmid integration was confirmed by Southern hybridization.

Site-directed mutation of the TTA codon of adpAc and construction of relevant integrative plasmids

There is a TTA codon 674–676 nucleotides downstream of the start codon of adpAc. In order to change the TTA leucine codon to a TTG leucine codon, the insert of pSPH2 was cloned into pIJ2925 at the HindIII site to give pHZ2511. Then, pHZ2511 was digested, and the 2.4 kb BglII fragment, which carries the entire  adpAc,   was   cloned   into   the  BamHI  site of pIJ2925 to give pHZ2514, which was used as the PCR template for site-directed mutagenesis. Two synthetic oligonucleotides were designed: ADPA-TTGL (5′-CAGGTCTTT GCCGGAGGAGATCGG) and ADPA-TTGR (5′-CTCCTCCG GCAAAGACCTGTCGAGG). ADPA-TTGL and ADPA-TTGR were complementary to opposite strands of the TTA codon region of adpAc and contained the desired mutation as shown in bold/underline . The site-directed mutation procedure was modified from the Stratagene Quickchange kit instructions. The PCR was carried out with Pfu DNA polymerase. DMSO was added to the reaction mixture to a final concentration of 5%. The cycling conditions were 95°C for 30 s, 55°C for 1 min, 68°C for 10 min and 50 s (12 cycles). After temperature cycling, the PCR product was treated with DpnI to digest the methylated parental DNA template and to select for mutation-containing synthesized DNA. The mixture was then used to transform E. coli DH5α. Plasmid DNA from two transformants was sequenced to show that the inserted DNA fragment of both plasmids contained the designed TTA[RIGHTWARDS ARROW]TTG mutation and there was no other mutation. Then the 2.4 kb BglII fragment was excised from the mutated plasmid, gel purified and inserted into the BamHI site of pSET152 to give pHZ2528. Thus, pHZ2528 carried the intact adpAc with a TTA[RIGHTWARDS ARROW]TTG mutation and the phage φC31 attachment function for integrating into the chromosomal attB site. In order to get an integrative construct carrying the TTA-free adpAc together with the downstream gene ornA, pHL72 was constructed by replacing the 0.7 kb BclI–EcoRI fragment of pHZ2528 with a 1547 bp BclI–EcoRI fragment from a PCR amplification primed with adpa3 (5′-TGTCGGTGTTCGGGA TCG-3′) and ornA-C-EI (5′-CCGGAATTCAAGTGTACAGGG TCCGAAGG-3′), with M145 DNA as template. adpa3  was  complementary  to  the adpAc  sequence.  ornA-C-EI was complementary to a sequence downstream of ornA, but contained an engineered EcoRI site. pHL71 was the same as pHL72 but still carried the TTA codon.

Immunoblot analysis

Western blotting was done exactly as described by Bibb and Buttner (2003).

Acknowledgements

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

Much of this work was supported by a Joint Project grant from the National Natural Science Foundation of China and The Royal Society to Zixing Deng and Keith Chater. Eriko Takano was supported by a grant from the Human Frontiers Science Program to Mervyn Bibb. Meifeng Tao was supported by a grant from National Natural Science Foundation of China (no. 39970012). Maureen Bibb, Mark Buttner, Mervyn Bibb and Keith Chater were supported by a Competitive Strategic Grant from the BBSRC to the John Innes Centre. We thank Bertolt Gust for advice on targeted mutagenesis, Helen Kieser for providing cosmids, and Kay Fowler for providing oligonucleotides UNIV5-AD1, AGA1-AD2 and UNI699. Some of the initial attempts to use cosmids to complement bldH were done by Eunja Kim.

References

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References
  • Aigle, B., Wietzorrek, A., Takano, E., and Bibb, M.J. (2000) A single amino acid substitution in region 1.2 of the principal σ factor of Streptomyces coelicolor A3(2) results in the pleiotropic loss of antibiotic production. Mol Microbiol 37: 9951004.
  • Bentley, S.D., Chater, K.F., Cerdeno-Tarraga, A.M., Challis, G.L., Thomson, N.R., James, K.D., et al. (2002) Complete genome sequence of the model actinomycete Streptomyces coelicolor A3(2). Nature 417: 141147.
  • Bibb, M.J., and Buttner, M.J. (2003) Evidence that the Streptomyces coelicolor developmental transcription factor BldN is synthesized as a pro-protein. J Bacteriol 185: 23382345.
  • Bibb, M.J., Molle, V., and Buttner, M.J. (2000) ρBldN, an extracytoplasmic function RNA polymerase sigma factor required for aerial mycelium formation in Streptomyces coelicolor A3(2). J Bacteriol 182: 46064616.
  • Bierman, M., Logan, R., O'Brien, K., Seno, E.T., Rao, R.N., and Schoner, B.E. (1992) Plasmid cloning vectors for the conjugal transfer of DNA from Escherichia coli to Streptomyces spp. Gene 116: 4349.
  • Bignell, D.R., Warawa, J.L., Strap, J.L., Chater, K.F., and Leskiw, B.K. (2000) Study of the bldG locus suggests that an anti-anti-sigma factor and an anti-sigma factor may be involved in Streptomyces coelicolor antibiotic production and sporulation. Microbiology 46: 21612173.
  • Chakraburtty, R., and Bibb, M.J. (1997) The ppGpp synthetase gene (relA) of Streptomyces coelicolor A3(2) plays a conditional role in antibiotic production and morphological differentiation. J Bacteriol 179: 58545861.
  • Champness, W.C. (1988) New loci required for Streptomyces coelicolor morphological and physiological differentiation. J Bacteriol 170: 11681174.
  • Chater, K.F. (2001) Regulation of sporulation in Streptomyces coelicolor A3(2): a checkpoint multiplex? Curr Opin Microbiol 4: 667673.
  • Chater, K.F., and Horinouchi, S. (2003) Signalling early developmental events in two highly diverged Streptomyces species. Mol Microbiol 48: 915.
  • Datsenko, K.A., and Wanner, B.L. (2000) One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc Natl Acad Sci USA 97: 66406645.
  • Elliot, M., Damji, F., Passantino, R., Chater, K., and Leskiw, B. (1998) The bldD gene of Streptomyces coelicolor A3(2): a regulatory gene involved in morphogenesis and antibiotic production. J Bacteriol 180: 15491555.
  • Elliot, M.A., Bibb, M.J., Buttner, M.J., and Leskiw, B.K. (2001) BldD is a direct regulator of key developmental genes in Streptomyces coelicolor A3(2). Mol Microbiol 40: 257269.
  • Fernandez-Moreno, M.A., Caballero, J.L., Hopwood, D.A., and Malpartida, F. (1991) The act cluster contains regulatory and antibiotic export genes, direct targets for translational control by the bldA tRNA gene of Streptomyces. Cell 66: 769780.
  • Flett, F., Mersinias, V., and Smith, C.P. (1997) High efficiency intergeneric conjugal transfer of plasmid DNA from Escherichia coli to methyl DNA-restricting streptomycetes. FEMS Microbiol Lett 155: 223229.
  • Gust, B., Challis, G.L., Fowler, K., Kieser, T., and Chater, K.F. (2003) PCR-targeted Streptomyces gene disruption identifies a protein domain needed for biosynthesis of the sesquiterpene soil odor geosmin. Proc Natl Acad Sci USA 100: 15411546.
  • Guthrie, E.P., Flaxman, C.S., White, J., Hodgson, D.A., Bibb, M.J., and Chater, K.F. (1998) A response-regulator-like activator of antibiotic synthesis from Streptomyces coelicolor A3(2) with an amino-terminal domain that lacks a phosphorylation pocket. Microbiology 144: 727738.
  • Horinouchi, S. (2002) A microbial hormone, A-factor, as a master switch for morphological differentiation and secondary metabolism in Streptomyces griseus. Front Biosci 7: 20452057.
  • Horinouchi, S., Suzuki, H., Nishiyama, M., and Beppu, T. (1989) Nucleotide sequence and transcriptional analysis of the Streptomyces griseus gene (afsA) responsible for A-factor biosynthesis. J Bacteriol 171: 12061210.
  • Kieser, T., and Melton, R.E. (1988) Plasmid pIJ699, a multi-copy positive-selection vector for Streptomyces. Gene 65: 8391.
  • Kieser, T., Bibb, M.J., Buttner, M.J., Chater, K.F., and Hopwood, D.A. (2000) Practical Streptomyces Genetics. Norwich: John Innes Foundation.
  • Kuhstoss, S., and Rao, R.N. (1991) Analysis of the integration function of the streptomycete bacteriophage φC31. J Mol Biol 222: 897908.
  • Lawlor, E.J., Baylis, H.A., and Chater, K.F. (1987) Pleiotropic morphological and antibiotic deficiencies result from mutations in a gene encoding a tRNA-like product in Streptomyces coelicolor A3(2). Genes Dev 1: 13051310.
  • Leskiw, B.K., Lawlor, E.J., Fernandez-Abalos, J.M., and Chater, K.F. (1991) TTA codons in some genes prevent their expression in a class of developmental, antibiotic-negative, Streptomyces mutants. Proc Natl Acad Sci USA 88: 24612465.
  • MacNeil, D.J., Occi, J.L., Gewain, K.M., MacNeil, T., Gibbons, P.H., Ruby, C.L., and Danid, S.J. (1992) Complex organization of the Streptomyces avermitilis genes encoding the avermectin polyketide synthetase. Gene 155: 119125.
  • Merrick, M.J. (1976) A morphological and genetic mapping study of bald colony mutants of Streptomyces coelicolor. J Gen Microbiol 96: 299315.
  • Murray, M.G. (1986) Use of sodium trichloroacetate and mung bean nuclease to increase sensitivity and precision during transcription mapping. Anal Biochem 158: 165170.
  • Nodwell, J.R., and Losick, R. (1998) Purification of an extracellular signaling molecule involved in aerial mycelium formation by Streptomyces coelicolor. J Bacteriol 180: 13341337.
  • Nodwell, J.R., McGovern, K., and Losick, R. (1996) An oligopeptide permease responsible for the import of an extracellular signal governing aerial mycelium formation in Streptomyces coelicolor. Mol Microbiol 22: 881893.
  • Ohnishi, Y., Kameyama, S., Onaka, H., and Horinouchi, S. (1999) The A-factor regulatory cascade leading to streptomycin biosynthesis in Streptomyces griseus: identification of a target gene of the A-factor receptor. Mol Microbiol 34: 102111.
  • Ohnishi, Y., Nishiyama, Y., Sato, R., Kameyama, S., and Horinouchi, S. (2000) An oligoribonuclease gene in Streptomyces griseus. J Bacteriol 182: 46474653.
  • Passantino, R., Puglia, A.M., and Chater, K. (1991) Additional copies of the actII regulatory gene induce actinorhodin production in pleiotropic bld mutants of Streptomyces coelicolor A3(2). J Gen Microbiol 137: 20592064.
  • Redenbach, M., Kieser, H.M., Denapaite, D., Eichner, A., Cullum, J., Kinashi, H., and Hopwood, D.A. (1996) A set of ordered cosmids and a detailed genetic and physical map for the 8 Mb Streptomyces coelicolor A3(2) chromosome. Mol Microbiol 21: 7796.
  • Sambrook, J., Fritsch, E.F., and Maniatis, T. (1989) Molecular Cloning. A Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press.
  • Strauch, E., Takano, E., Baylis, H.A., and Bibb, M.J. (1991) The stringent response in Streptomyces coelicolor A3(2). Mol Microbiol 5: 289298.
  • Takano, E., Chakraburtty, R., Nihira, T., Yamada, Y., and Bibb, M.J. (2001) A complex role for the γ-butyrolactone SCB1 in regulating antibiotic production in Streptomyces coelicolor A3(2). Mol Microbiol 41: 10151028.
  • Trepanier, N.K., Jensen, S.E., Alexander, D.C., and Leskiw, B.K. (2002) The positive activator of cephamycin C and clavulanic acid production in Streptomyces clavuligerus is mistranslated in a bldA mutant. Microbiology 148: 643656.
  • White, J., and Bibb, M. (1997) bldA dependence of undecylprodigiosin production in Streptomyces coelicolor A3(2) involves a pathway-specific regulatory cascade. J Bacteriol 179: 627633.
  • Willey, J., Schwedock, J., and Losick, R. (1993) Multiple extracellular signals govern the production of a morphogenetic protein involved in aerial mycelium formation by Streptomyces coelicolor. Genes Dev 7: 895903.
  • Yamazaki, H., Ohnishi, Y., and Horinouchi, S. (2000) An A-factor-dependent extracytoplasmic function sigma factor (σAdsA) that is essential for morphological development in Streptomyces griseus. J Bacteriol 182: 45964605.