SEARCH

SEARCH BY CITATION

Keywords:

  • fluorescence ratio imaging;
  • green fluorescent protein (GFP);
  • pH;
  • proton fluxes

ABSTRACT

  1. Top of page
  2. ABSTRACT
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS AND DISCUSSION
  6. ACKNOWLEDGMENTS
  7. REFERENCES

This is the first report on using green fluorescent protein (GFP) as a pH reporter in plants. Proton fluxes and pH regulation play important roles in plant cellular activity and therefore, it would be extremely helpful to have a plant gene reporter system for rapid, non-invasive visualization of intracellular pH changes. In order to develop such a system, we constructed three vectors for transient and stable transformation of plant cells with a pH-sensitive derivative of green fluorescent protein. Using these vectors, transgenic Arabidopsis thaliana and tobacco plants were produced. Here the application of pH-sensitive GFP technology in plants is described and, for the first time, the visualization of pH gradients between different developmental compartments in intact whole-root tissues of A. thaliana is reported. The utility of pH-sensitive GFP in revealing rapid, environmentally induced changes in cytoplasmic pH in roots is also demonstrated.


INTRODUCTION

  1. Top of page
  2. ABSTRACT
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS AND DISCUSSION
  6. ACKNOWLEDGMENTS
  7. REFERENCES

Maintaining cytoplasmic pH (pHc) within a physiological range and its regulation are very important for protein stability, enzyme and ion channel activity, and many other processes required for cell growth or survival (Busa & Nuccitelli 1984; Putnam 1998). Moreover, in plants the proton pumps are the primary electrogenic force for the generation of ion gradients (Sze 1985; Briskin & Hanson 1992). Growing evidence suggests the involvement of pH changes in cell signalling, either directly or in concert with plant hormones, calcium and other ions (Felle 1989; Zimmermann et al. 1999). Thus, it would be helpful to have a plant pH-sensitive reporter gene system for non-invasive monitoring of intra- and extra-cellular pH dynamics. Such a system would have many advantages over conventional pH-sensitive fluorescent dyes, such as 2′,7′-bis-(2-carboxyethyl)-5-(and-6)-carboxyfluorescein (BCECF) or seminaphthorhodafluor (SNARF), in terms of loading, effects on cellular processes, targeting to different compartments and organelles, and time-lapse studies. Due to the presence of a cell wall and rapid compartmentalization of fluorescent dyes, plant cells are notoriously difficult to load and handle in quantitative imaging (Fricker et al. 1999). It has recently been demonstrated that several mutant green fluorescent proteins (GFPs) can be used as non-invasive intra- and extracellular pH sensors (Kneen, Farinas & Verkman 1998; Llopis et al. 1998; Miesenbock, Angelis & Rothman 1998). In particular, a pH-sensitive GFP derivative, ‘ratiometric pHluorin’, exhibits a reversible excitation ratio between pH 5·5 and 7·5, which makes it especially useful for ratio imaging in this pH range (Miesenbock et al. 1998). However, there were potential problems in the application of pHluorins for monitoring pH changes in plants: a wild-type Aequorea victoria gfp cDNA was used as a template for polymerase chain reaction (PCR) mutagenesis and development of pHluorins. Attempts at stable expression of the wild-type GFP in transgenic plants were unsuccessful until codon usage was optimized and the site of aberrant splicing was removed (Haseloff et al. 1997).

Therefore, we modified the ratiometric pHluorin gene and expressed it in Arabidopsis thaliana and tobacco plants.

MATERIALS AND METHODS

  1. Top of page
  2. ABSTRACT
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS AND DISCUSSION
  6. ACKNOWLEDGMENTS
  7. REFERENCES

Gene construction

Because the pHluorin gene contains all ‘pH-sensitive’ mutations downstream of the AGGTATTG sequence, the 5′ site of aberrant splicing in plants (Haseloff et al. 1997), we reasoned that exchanging the 5′ portion of the gene (which contains the 5′ splice site) with the corresponding part from the plant-modified smGFP gene (Davis & Vierstra 1998), would prevent aberrant splicing of the pHluorin premRNA. In addition, it would introduce the F99S mutation for increased protein solubility (Davis & Vierstra 1998). To replace the 5′ part of the pHluorin gene, the smGFP gene was cloned into the pBluescript II KS + and the ClaI–SacI fragment of the smGFP was exchanged with the corresponding fragment from the pHluorin (Fig. 1a). The smGFP gene was excised from the plasmid psmGFP (obtained from the Arabidopsis Biological Resource Center, Columbus, OH, USA) using BamHI and SacI restriction endonucleases (Promega, Madison, WI, USA) and cloned into the pBluescriptII KS + (Stratagene, La Jolla, CA, USA). A ClaI–SacI DNA fragment of the smGFP was exchanged with the corresponding fragment from the ratiometric pHluorin gene (kindly made available to us from Dr James E. Rothman of The Memorial Sloan-Kettering Cancer Center, New York, USA). To facilitate the replacement of the above fragment in the smGFP gene, ClaI and SacI recognition sites were introduced into the corresponding DNA fragment of the pHluorin gene using PCR with Thermococcus litoralis Vent DNA polymerase (New England Biolabs, Beverly, MA, USA) and two mutagenic oligonucleotides, GGTATCGATTTTAAAGATGATGGAAAC and GGGAGCTCTTATTTGTATAGTTCATCCATGC. (Sequences complementary to the ClaI and SacI restriction endonuclease sites are underlined). The absence of any undesirable PCR-introduced nucleotide misincorporations was verified after sequencing of both strands of the resulting phGFP gene. The phGFP gene was then expressed in Escherichia coli under the control of the lac promoter, and phGFP spectral properties were found to be identical to that of the ratiometric pHluorin (in particular, 395 and 475 nm excitation wavelengths, 510 nm emission wavelength, and 427 nm isoexcitation point).

image

Figure 1. DNA constructs for expression of the pH-sensitive GFP in plants. (a) phGFP gene. Contains the BamHI–ClaI gene sequence (including F99S mutation) from smGFP (Davis & Vierstra 1998) and the ClaI – Sac I DNA fragment with ‘pH-sensitive’ mutations (E132D, S147E, N149L, I161T, N164I, K166Q, I167V, S202H) corresponding to the ratiometric pHluorin gene sequence (Miesenbock et al. 1998). (b) pHGFP-TR plasmid vector for transient expression of phGFP in plant cells. CaMV35S, the promoter of the cauliflower mosaic virus 35S RNA; pAnos, nopaline synthase gene transcription terminator. (c) pHGFP-35S binary vector for stable transformation of plants with phGFP. RB and LB, right and left T-DNA borders, respectively; nptII, neomycin phosphotransferase gene containing the promoter and transcription terminator of the nopaline synthase gene. (d) pHGFP-SP plant binary vector for stable expression of phGFP under the control of the chimeric (ocs)3mas promoter.

Download figure to PowerPoint

Plasmid construction for transient expression

In order to transiently express phGFP in plant cells, the phGFP gene was placed under the control of the CaMV 35S promoter (Odell, Nagy & Chua 1985) by substituting the smGFP gene sequence between the BamHI and SacI sites in the psmGFP with the corresponding phGFP sequence. The plasmid obtained, pHGFP-TR, was used for particle bombardment transformation of A. thaliana and Nicotiana benthamiana plants.

Binary vector construction for stable transformation

Two binary plasmid vectors, pHGFP-35S and pHGFP-SP, were constructed for stable plant transformation with the phGFP gene under the control of the CaMV35S and the chimeric (ocs)3mas (Ni et al. 1995) promoters, respectively. Plasmid pHGFP-35S was obtained by subcloning the phGFP into the plasmid pBI121 (Clontech, Palo Alto, CA, USA) between BamHI and SacI restriction endonuclease sites, and the pHGFP-SP was obtained after replacing the uidA gene sequence with the phGFP between XbaI and SacI sites in the pBISN1 (obtained from Dr Stanton B. Gelvin of the Purdue University, West Lafayette, IN, USA).

Plant transformation

Transient bombardment-mediated transformations of A. thaliana and N. benthamiana tissues were carried out with pHGFP-TR DNA using the protocol of Seki et al. (1991).

Transgenic A. thaliana (Columbia and Wassilevskija ecotypes) and tobacco N. benthamiana plants were produced using Agrobacterium-mediated transformation. Strain GV3101 of Agrobacterium tumefaciens was transformed with either pHGFP-35S or pHGFP-SP, and used for in planta transformation of A. thaliana as described by Clough & Bent (1998), as well as for in vitro transformation of N. benthamiana leaf discs as described by Horsch et al. (1985). Transgenic plants were screened for antibiotic resistance on selective growth media supplied with kanamycin, and, later, for phGFP expression using a Zeiss Axiophot fluorescence microscope (Carl Zeiss, Thornwood, NY, USA) equipped with a Plan-Neofluar 10× dry objective, N.A. 0·3 (Zeiss), and a Chroma Technology GFP filter set (exciter HQ450/50, dichroic mirror Q480LP, emitter HQ510/50; Chroma Technology Corp., Brattleboro, VT, USA).

Cell imaging

Subcellular localization of phGFP in transformed plant cells was examined using a Zeiss confocal laser scanning microscope LSM 510 equipped with a krypton-argon laser, and a Plan-Neofluar 40×, N.A. 1·3, oil objective.

For ratio imaging experiments, 5- to 21-day-old seedlings of transgenic plants were monitored on a Nikon FN600 microscope (Nikon, Melville, NY, USA) fitted with Plan Fluor 10×, 0·30 N.A., 40×, 0·75 N.A., Super Fluor 10×, 0·50 N.A., 40×, 0·90 N.A. dry objectives, and a Chroma Technology pHluorin filter set (exciters D410/30 and D470/20, dichroic mirror 500DCXR, emitter HQ535/50). Image acquisition and processing were carried out using a Hamamatsu Orca-100 cooled CCD camera (Hamamatsu Corp., Bridgewater, NJ, USA) and MetaFluor 4·0 image analysis software (Universal Imaging Corp., West Chester, PA, USA). In some experiments a camera binning of 2 or 4 was used to improve signal-to-noise ratio and to minimize photobleaching. Pixel by pixel ratio of intensities at 410 nm and 470 nm was calculated after background subtraction, and was used to calibrate pHc. The pH titrations were performed in situ at the end of each experiment, using media containing 0·5× Murashige and Skoog basal salt mix (MS) salts, 0·005% digitonin, 50 mM HEPES or 50 mM 2-(N-Morpholino)ethanesulfonic acid (MES), adjusted to a pH of between 5 and 8.

RESULTS AND DISCUSSION

  1. Top of page
  2. ABSTRACT
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS AND DISCUSSION
  6. ACKNOWLEDGMENTS
  7. REFERENCES

Expression of phGFP in plants

In order to develop a plant pH-sensitive gene reporter system we modified the ratiometric pHluorin gene as described in the ‘Gene construction’ section of the Ma-terials and Methods. For transient expression of the modified gene, phGFP, in plant cells, the phGFP gene was placed under the control of the strong constitutive plant promoter CaMV35S (Fig. 1b). The resulting plasmid, pHGFP-TR, was used for bombardment-mediated transformation of leaf and root cells of A. thaliana and tobacco plants. The phGFP was detectable after 8–24 h, and, using laser confocal scanning microscopy, was found to be distributed throughout the cytoplasm (Fig. 4a). As expected for cytoplasmically expressed GFP, it apparently could penetrate the nuclear membrane and accumulated within the nucleoplasm.

image

Figure 4. Visualizing pHc in an intact Arabidopsis thaliana root using ratiometric pH-sensitive GFP. (a) Transient expression of phGFP in a root epidermal cell. The image was acquired using a Zeiss confocal laser scanning microscope LSM 510 at 488 nm excitation and 525 nm emission wavelengths. phGFP accumulates in the peripheral cytoplasm regions close to the plasma membrane and within the nucleoplasm (except nucleolus). (b–g) Stable transformation: (b) image of the root tip was acquired at 470 nm wavelength using conventional wide-field fluorescence microscopy; (c) calibrated 410 nm/470 nm ratio image of the same root tip. phGFP shows the existence of pH gradients between different developmental regions: root cap cells have acidified cytoplasm (pH 6·5–7·0), cells of the distal elongation zone have relatively alkaline pHc (7·3–7·6), and meristem cells have intermediate pHc (7–7·3); (d–g) images of the root tip with non-uniform phGFP expression patterns; (d, e) strong fluorescence in the mature and elongation zone of the root, weak fluorescence in the root tip; (f, g) strong fluorescence in the root tip, weak fluorescence in the rest of the root.

Download figure to PowerPoint

For stable expression of ratiometric pH-sensitive GFP in plants we constructed two binary plasmid vectors, pHGFP-35S and pHGFP-SP (Fig. 1c & d, respectively). The pHGFP-35S vector was constructed by cloning the phGFP gene into the pBI121 under the control of the CaMV35S promoter. To maximize the fluorescent signal for ratio imaging of pHc we also constructed the plasmid pHGFP-SP containing the phGFP gene under the control of the chimeric (ocs)3mas promoter (Ni et al. 1995). To our knowledge, the (ocs)3mas promoter is the strongest available promoter for expression of foreign genes in plants (Ni et al. 1995).

Transgenic A. thaliana and N. benthamiana plants expressing ratiometric pH-sensitive GFP were produced using an agrobacterial transformation with pHGFP-35S and pHGFP-SP binary vectors. Transgenic lines that expressed phGFP at sufficient levels were selected for further ratio imaging experiments. On average, the plants transformed with the phGFP gene under the control of the chimeric (ocs)3mas promoter show brighter fluorescence in comparison with plants transformed with this gene under the control of the CaMV35S (data not shown). As a rule, fluorescence is readily detectable in roots and hypocotyls, and to a lesser extent in other tissues such as leaves and stems.

Monitoring intracellular pH changes using phGFP

It should be noted that although ratio ion imaging measurements are considered to be much more accurate in comparison with single-wavelength, non-ratiometric measurements, nonetheless, they also suffer from a number of optical artifacts. In our system, some of the optical artifacts originated from using wide-field fluorescence microscopy, from subcellular localization, and from different expression levels of phGFP in a particular cell type or whole plant tissue. On the other hand, relative pHc changes in response to various environmental and internal factors can be readily and reliably detected.

As wide-field (not confocal) fluorescence microscopy was used the 410 nm/470 nm ratio could significantly change depending on the microscope objectives used, depth of field, camera binning and phGFP expression level. Thus, in vitro calibration could give erroneous data and so calibration was routinely performed in situ at the end of an experiment. We found in our experimental system that a commonly used method of in situ pHc calibration with nigericin, a proton ionophore, severely damaged the cells and led to increased background fluorescence at 410 nm (data not shown). To calibrate pHc, we applied appropriate buffers with pH between 5 and 8, and containing 0·005% digitonin (as described by Kneen et al. 1998). Digitonin was used to permeabilize the plasma membrane, and to equilibrate the pH of the external calibration buffers and pHc. Digitonin appeared to be less toxic to cells compared to nigericin and did not inhibit cytoplasmic streaming. Figure 2 shows a typical calibration curve. phGFP has a reversible 410 nm/470 nm excitation ratio and optimal dynamic range for pH measurements between pH 5·5 and 7·5.

image

Figure 2. Standard calibration curve. Calibration was performed in situ at the end of an experiment using appropriate buffers with pH between 5 and 8, and containing 0·005% digitonin. Epidermal root cells of Arabidopsis thaliana were used.

Download figure to PowerPoint

Next, we examined responsiveness of phGFP to intracellular pH changes using treatment of transgenic plants with weak membrane-permeable acids and bases. Treatment of Arabidopsis thaliana roots with 20 mM propionic or butyric acid caused rapid acidification of the cytoplasm, resulting in a 0·3–0·5 pH units downshift from pH 7·2 within 15–20 min of beginning an experiment (Fig. 3a). On the other hand, treatment with 10 mM trimethylamine or ammonium chloride, which are weak membrane-permeable bases, leads to alkalization of the cytoplasm, increasing the pH between 0·5 and 1 units within a 60 min time frame (Fig. 3a). It was concluded that phGFP reliably reflected cytoplasmic pH changes.

image

Figure 3. Monitoring cytoplasmic pH changes in epidermal cells of the root elongation zone of Arabidopsis thaliana using phGFP. (a) Cells were challenged with weak membrane-permeable acid and base, 20 mM propionic acid, pH adjusted to 5·0 using 0·1 M KOH (—▪—), and 10 mM NH4Cl pH adjusted to 9 using 0·1 HCl (—bsl00046—). (b) pHc changes following treatment of Arabidopsis roots with (i) 10 mM fusicoccin (—bsl00046—); (ii) hydrochloric acid, pH adjusted to 3·8 using 0·1 M KOH (—▪—); (iii) 3 mM aluminium and hydrochloric acid, pH adjusted to 3·8 using 0·1 M KOH (—bsl00066—). Data are averages of five independent experiments ± SE (standard error).

Download figure to PowerPoint

In order to demonstrate the suitability of phGFP for monitoring intracellular pH changes in response to various physiological stimuli, Arabidopsis roots were challenged with 10 mM fusicoccin, a fungal phytotoxin produced by Fusicoccum amygdali, which is known to stimulate plasma membrane H+-ATPase of higher plants (Marré 1979). Fusicoccin treatment caused cytoplasm acidification in epidermal cells of the root elongation zone, with the most pronounced change, 0·1–0·3 pH units, occurring within the first 15 min (Fig. 3b). The observed cytoplasm acidification in response to fusicoccin was consistent with earlier data obtained on Zea mays cells using pH-sensitive microelectrodes and fluorescent dyes (Brummer et al. 1985; Felle et al. 1986).

We also investigated cytoplasmic pH changes in response to low extracellular pH and aluminium. Aluminium toxicity is one the most important limitation factors for plant growth on acidic soils (Horst 1995). It has been recently demonstrated that low external pH decreases cytoplasmic pH in Arabidopsis roots; the roots respond to low external pH by a sustained elevation in [Ca2+]c; and aluminium ions inhibit this elevation in [Ca2+]c, preventing any potential calcium-mediated protection against low pH (Plieth et al. 1999). To mimic root growth conditions on very acidic soils, the pH of the growth media was adjusted to 3·8 with hydrochloric acid. Proton pumps of epidermal root cells of A. thaliana apparently are not able to buffer such a pH drop of the external growth media, and cytoplasmic pH downshifts 0·5–0·8 pH units within 60 min of an experiment (Fig. 3b). The addition of 3 mM aluminium chloride had an additive effect on cytoplasmic pH; when mixed with the growth media, it caused an additional 0·1–0·2 pH unit drop in cytoplasmic pH in comparison with hydrochloric acid alone (Fig. 3b). The mechanism of aluminium-induced cytoplasmic acidification is not known. A possible explanation is that aluminium ions inhibit plasma membrane H+-ATPases at low extracellular pH via inhibition of calcium-mediated signalling. The observed additive effect of aluminium ions on cytoplasmic acidification at low extracellular pH deserves further investigation.

phGFP reports the existence of pH gradients between different developmental regions in roots of Arabidopsis thaliana

An obvious advantage of the application of pH-sensitive GFP in plants is that it allows one to visualize pHc changes in many cells and even whole plant tissues simultaneously. Figure 4c shows the pHc pattern in an intact A. thaliana root tip. In this transgenic line phGFP is relatively uniformly expressed throughout the whole root (Fig. 4b). Therefore, optical artifacts due to uneven pH sensor distribution should be minimal (except the edges of the root where the edge-artifacts are clearly pronounced; Fig. 4c). Ratio imaging of the pHc using pH-sensitive GFP revealed the existence of a distinct pHc gradient between root tip cells.

As the developmental activities of roots are separated into distinct regions or zones (e.g. the terminal root cap where gravity is sensed; a region predominantly of mitosis; and a region predominantly of cell elongation), roots have recently attracted considerable attention (Evans & Ishikawa 1997; Van Den Berg et al. 1997; Blancaflor, Fasano & Gilroy 1998; Scott & Allen 1999). Here we demonstrate for the first time a gradient in pHc between the various developmental compartments of the root. This gradient is present in at least 50% of vertically growing transgenic Arabidopsis roots. Although the root cap cells have acidified cytoplasm (pH 6·5–7·0; Fig. 4c), cells of the distal elongation zone are characterized by relatively alkaline pHc (7·3–7·6), and cells of the root meristem have intermediate pHc (7–7·3). The observed pH gradient is consistent with electrophysiological data obtained earlier on corn roots (Mulkey & Evans 1981; Pilet 1991). In growing maize roots, proton efflux occurs in the elongation zone and proton influx occurs at the root cap and meristem. These proton fluxes correspond to cytoplasmic alkalization of cells of the elongation zone, and acidification of cells of the cap and meristem. Interestingly, growing pollen tubes possess a constitutive alkaline band in the clear zone and a growth-dependent acidic tip (Feijo et al. 1999). It seems plausible that intracellular pH and proton fluxes might play similar roles in the growth of single plant cells such as pollen and multicellular organs such as roots.

As optical artifacts due to non-uniform phGFP expression patterns might affect the accuracy of pH measurements, we also examined the pH gradients in transgenic Arabidopsis plants with strong fluorescence in the elongation zone and weak fluorescence in the root tip (Fig. 4d & e), and these results were compared with plants with the opposite phGFP expression pattern (Fig. 4f & g) (weak fluorescence in the root tip and strong fluorescence in the elongation zone). Even though the phGFP expression patterns differed in these two roots – the pH patterns (acidified root tip) were the same. Therefore, the observed pH gradients in Arabidopsis roots cannot be explained by optical artifacts due to uneven pH sensor distribution. A role for pH gradients in root growth and development remains to be elucidated. By documenting pH gradients we are provided with another tool for investigating the distinct regional developmental events in roots.

In summary, we have demonstrated that phGFP: (a) was expressed at a high level, sufficient for ratio imaging in A. thaliana and tobacco plants; (b) was suitable for cytoplasmic pH measurements in plants; (c) showed an additive effect of aluminium ions on cytoplasmic acidification at low extracellular pH; (d) could be applied for non-invasive monitoring of pHc dynamics in individual plant cells as well as in whole plant tissues; and (e) showed for the first time the existence of significant pH gradients between different developmental regions in roots of A. thaliana.

ACKNOWLEDGMENTS

  1. Top of page
  2. ABSTRACT
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS AND DISCUSSION
  6. ACKNOWLEDGMENTS
  7. REFERENCES

We thank Dr James E. Rothman of The Memorial Sloan-Kettering Cancer Center, New York, for the generous gift of the plasmid pGEX-2T containing a gene sequence of the ratiometric pHluorin. We also thank the Arabidopsis Biological Resource Center, Columbus, OH, for the plasmid psmGFP containing the smGFP gene. This work was supported by grants from the NASA (98-HEDS-02) and Novartis Agricultural Discovery Institute, Inc.

REFERENCES

  1. Top of page
  2. ABSTRACT
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS AND DISCUSSION
  6. ACKNOWLEDGMENTS
  7. REFERENCES
  • Blancaflor E.B., Fasano J.M., Gilroy S. (1998) Mapping the functional roles of cap cells in the response of Arabidopsis primary roots to gravity. Plant Physiology 115, 213222.DOI: 10.1104/pp.115.1.213
  • Briskin D.P. & Hanson J.B. (1992) How does the plant plasma membrane hydrogen-ATPase pump protons? Journal of Experimental Botany 43, 269289.
  • Brummer B., Bertl A., Potrykus I., Felle H., Parish R.W. (1985) Evidence that fusicoccin and indole-3-acetic acid induce cytosolic acidification of Zea mays cells. FEBS Letters 189, 109113.
  • Busa W.B. & Nuccitelli R. (1984) Metabolic regulation via intracellular pH. American Journal of Physiology 246, 409438.
  • Clough S.J. & Bent A.F. (1998) Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant Journal 16, 735743.DOI: 10.1046/j.1365-313x.1998.00343.x
  • Davis S.J. & Vierstra R.D. (1998) Soluble, highly fluorescent variants of green fluorescent protein (GFP) for use in higher plants. Plant Molecular Biology 36, 521528.
  • Evans M.L. & Ishikawa H. (1997) Cellular specificity of the gravitropic motor response in roots. Planta 203, S115S122.
  • Feijo J.A., Sainhas J., Hackett G.R., Kunkel J.G., Hepler P.K. (1999) Growing pollen tubes possess a constitutive alkaline band in the clear zone and a growth-dependent acidic tip. Journal of Cell Biology 144, 483496.
  • Felle H. (1989) pH as a second messenger in plants. In Messengers in Plant Growth and Development (eds W.F. Boss & D.J. Morre), pp. 145166. Liss, New York.
  • Felle H., Brummer B., Bertl A., Parish R.W. (1986) Indole-3-acetic acid and fusicoccin cause cytosolic acidification of corn coleoptile cells. Proceedings of the National Academy of Sciences USA 83, 89928995.
  • Fricker M.D., Plieth C., Knight H., Blancaflor E., Knight M.R., White N.S., Gilroy S. (1999) Fluorescence and luminescence techniques to probe ion activities in living plant cells. In Fluorescent and Luminescent Probes for Biological Activity (eds W.T. Mason), pp. 569596. Academic Press, San Diego, CA.
  • Haseloff J., Siemering K.R., Prasher D., Hodge S. (1997) Removal of a cryptic intron and subcellular localization of green fluorescent protein are required to mark transgenic Arabidopsis plants brightly. Proceedings of the National Academy of Sciences USA 94, 21222127.
  • Horsch R.B., Fry J.E., Hoffmann N.L., Eichholtz D., Rogers S.G., Fraley R.T. (1985) A simple and general method for transferring genes into plants. Science 227, 12291231.
  • Horst W.J. (1995) The role of the apoplast in aluminium toxicity and resistance of higher plants: a review. Zeitschrift Fuer Pflanzenernaehrung und Bodenkunde 158, 419428.
  • Kneen M., Farinas J., Li Y., Verkman A.S. (1998) Green fluorescent protein as a noninvasive intracellular pH indicator. Biophysical Journal 74, 15911599.
  • Llopis J., McCaffery M., Miyawaki A., Farquhar M.G., Tsien R.Y. (1998) Measurement of cytosolic, mitochondrial, and Golgi pH in single living cells with green fluorescent proteins. Proceedings of the National Academy of Sciences USA 95, 68036808.
  • Marré E. (1979) Fusicoccin: a tool in plant physiology. Annual Review of Plant Physiology 30, 273288.
  • Miesenbock G., Angelis D.A.D., Rothman J.E. (1998) Visualizing secretion and synaptic transmission with pH-sensitive green fluorescent proteins. Nature 394, 192195.DOI: 10.1038/28190
  • Mulkey T.G. & Evans M.L. (1981) Geotropism in corn roots: Evidence for its mediation by differential acid efflux. Science 212, 7071.
  • Ni M., Cui D., Einstein J., Narasimhulu S., Vergara C.E., Gelvin S.B. (1995) Strength and tissue specificity of chimeric promoters derived from the octopine and mannopine synthase genes. Plant Journal 7, 661676.
  • Odell J.T., Nagy F., Chua N.H. (1985) Identification of DNA sequences required for activity of the cauliflower mosaic virus 35S promoter. Nature 313, 810812.
  • Pilet P.E. (1991) Root growth and gravireaction. Implications of hormones and other regulators. In Plant Roots. The Hidden Half (eds Y. Waisel, A. Eshel & U. Kafkafi), pp. 179204. Dekker, New York.
  • Plieth C., Sattelmacher B., Hansen U.-P., Knight M.R. (1999) Low-pH-mediated elevations in cytosolic calcium are inhibited by aluminium: a potential mechanism for aluminium toxicity. Plant Journal 18, 643650.DOI: 10.1046/j.1365-313x.1999.00492.x
  • Putnam R. (1998) Intracellular pH regulation. In Cell Physiology Source Book (eds N. Sperelakis), pp. 293305. Academic Press, San Diego, CA.
  • Seki M., Komeda Y., Iida A., Yamada Y., Morikawa H. (1991) Transient expression of beta-glucuronidase in Arabidopsis thaliana leaves and roots and Brassica napus stems using a pneumatic particle gun. Plant Molecular Biology 17, 259263.
  • Scott A.C. & Allen N.S. (1999) Changes in cytosolic pH within Arabidopsis root columella cells play a key role in the early signaling pathway for root gravitropism. Plant Physiology 121, 12911298.DOI: 10.1104/pp.121.4.1291
  • Sze H. (1985) Proton-translocating ATPase advances using membrane vesicles. Annual Review of Plant Physiology 36, 175208.
  • Van Den Berg C., Willemsen V., Hendriks G., Weisbeek P., Scheres B. (1997) Short-range control of cell differentiation in the Arabidopsis root meristem. Nature 390, 287289.DOI: 10.1038/36856
  • Zimmermann S., Ehrhardt T., Plesch G., Mueller-Roeber B. (1999) Ion channels in plant signaling. Cellular and Molecular Life Sciences 55, 183203.DOI: 10.1007/s000180050284