SEARCH

SEARCH BY CITATION

Keywords:

  • Arabidopsis thaliana;
  • ABC transporters;
  • AtMRP;
  • cadmium;
  • glutathione;
  • heavy metal transport;
  • phytochelatins

ABSTRACT

  1. Top of page
  2. ABSTRACT
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. ACKNOWLEDGMENTS
  8. REFERENCES

In yeasts, the ABC-type transporters are involved in vacuolar sequestration of cadmium. In plants, transport experiments with isolated vacuoles indicate that this is also true. In order to know more about the response of AtMRPs, a subclass of Arabidopsis ABC transporters, to cadmium, their expression pattern was analysed using the microchip technology and semi-quantitative reverse transcriptase-polymerase chain reaction. From 15 putative sequences coding for AtMRPs, transcript levels were detected for 14. All were expressed in the roots as well as in the shoots, although at a different level. In 4-week-old Arabidopsis, transcript levels of four AtMRPs were up-regulated after cadmium treatment. In all cases up-regulation was exclusively observed in the roots. The increase of transcript levels was most pronounced for AtMRP3. A more detailed analysis revealed that induction of AtMRP3 could also be observed in the shoot when leaves were cut and cadmium allowed to be taken up in the shoot. In young plantlets, a far higher portion of Cd2+ was translocated in the aerial part compared with adult plants. Consequently, AtMRP3 transcript levels increased in both root and shoot of young plants. This suggests that 7-day-old seedlings do not exhibit such a strict root–shoot barrier as 4-week-old plants. Expression analysis with mutant plants for glutathione and phytochelatin synthesis as well as with compounds producing oxidative stress indicate that induction of AtMRP3 is likely due to the heavy metal itself.


INTRODUCTION

  1. Top of page
  2. ABSTRACT
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. ACKNOWLEDGMENTS
  8. REFERENCES

Due to industrialization Cd2+, one of the most toxic heavy metals, can now be considered to be one of the major environmental pollutant (Alloway & Steinnes 1999). As a non-essential heavy metal, cadmium affects general metabolism in plants such as photosynthesis and respiration, thereby reducing growth and development (Prasad & Hagemeyer 1999). Cd2+ is suggested to be transported in the roots via divalent cation transporters for Fe2+ and Zn2+ and possibly Ca2+ channels (Korshunova et al. 1999; Rogers, Eide & Guerinot 2000; Pence et al. 2000). Within the cell, it has been shown that the vacuolar Ca2+/H+ antiporter CAX2 also exchanges cadmium with protons (Hirschi et al. 2000). In most plants, such as pea (Prasad & Hagemeyer 1999), wheat (Keltjens & Beusichem 1998) or Sinapis alba (Fargašová 2001), Cd2+ is mostly retained in the roots. Contrarily, plants known to accumulate large amounts of heavy metals, so-called hyperaccumulators, translocate a large part of heavy metals from the root to the shoot. The translocation mechanism remains to be elucidated, but it is known that transport of cadmium to the aerial part of the plant is influenced by factors such as transpiration, root uptake and xylem loading (Salt et al. 1995; Raskin, Smith & Salt 1997; Prasad & Hagemeyer 1999).

All plants described so far have evolved mechanisms to cope at least with low amounts of heavy metals. It is generally accepted that phytochelatins (PCs), also classified as class III of metallothioneins (MTs) and constituted by (γglu-cys)ngly, play a major role in heavy metal detoxification. Indeed, PCs form complexes with thio-reactive toxic metals such as Cd(II) or Hg(II), which are then likely to be transported into vacuoles (Rauser 1995; Salt & Rauser 1995; Cobbett 1999; Cobbett 2000a). Until very recently, PCs had been described only in plants and some fungi. The observation that Caenorhabditis elegans contains a gene for PC-synthesis and that a knockout of this gene strongly affects the heavy-metal tolerance of C. elegans indicates that PCs may be found in more organisms than originally postulated (Vatamaniuk et al. 2001; Clemens, Schroeder & Degenkolb 2001). On the other hand, class I and II MTs, which in contrast to PC are proteins, have been mainly shown to play a role in the detoxification of heavy metals in fungi and animals, but their role as detoxifiers in plants remains controversial. Indeed, although MTI and II complemented an MT-deficient (cup1 delta) mutant of yeast (Zhou & Goldsbrough 1994), their transcripts have not been reported to be markedly induced after heavy metal treatments (Schäfer et al. 1997; García-Hernández, Murphy & Taiz 1998). In comparison, light stress (Dunaeva & Adamska 2001) and natural senescence (Miller, Arteca & Pell 1999) have been shown to stimulate the expression of MTI and MTII.

Glutathione, which is the major source of non-protein thiols in plants and the precursor for PC synthesis, could also itself play a role in protection against cadmium by forming Cd-GS2 complexes (Li et al. 1997; Xiang & Oliver 1998). Altering glutathione levels by antisensing γ-ECS results in cadmium hypersensitive Arabidopsis plants (Xiang et al. 2001).

The export of Cd2+ from the cytoplasm can occur either into internal (vacuoles) or apoplastic compartments. For this purpose, specific transporters are involved. Data obtained with yeast and fission yeast suggest that ABC transporters are involved in vacuolar transport of Cd-complexes. In Saccharomyces cerevisiae, which is not able to synthesize PCs, the MRP homologue YCF1 transports glutathione complexes (Li et al. 1997). In contrast, HMT1 mediates apo-phytochelatins and phytochelatin-Cd2+ transport in Schizosaccharomyces pombe (Ortiz et al. 1995). Other ATP-dependent transporters, found in procaryotes and eucaryotes, such as P-type ATPase, have been demonstrated to confer resistance to toxic concentrations of divalent metals in Escherichia coli (Sharma et al. 2000). In plants, the ABC transporter(s) involved in cadmium transport has not been identified, but AtMRP3 is able to partially complement the cadmium sensitivity of the ΔYCF1 mutant (Tommasini et al. 1998). However, their mode of action remains to be elucidated. Recent data support the idea that other classes of transporters, maintaining metal (cation?) homeostasis in plants (Lombi et al. 2002), and which can also transport Cd2+ such as CAX2 (Hirschi et al. 2000), AtNramps (Thomine et al. 2000), IRT1 (Rogers et al. 2000), and ZNT1 (Pence et al. 2000), are involved in Cd2+ distribution within plants.

In this study, cDNA-microarray analyses indicate that transcript levels of some members of the AtMRP subfamily are increased after Cd2+ treatment. Reverse transcriptase (RT)-polymerase chain reaction (PCR) data show that AtMRP3 exhibits the strongest induction and therefore we analysed the transcript pattern of this ABC transporter in more detail.

MATERIALS AND METHODS

  1. Top of page
  2. ABSTRACT
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. ACKNOWLEDGMENTS
  8. REFERENCES

Plant material

Plants used in this study were: Arabidopsis thaliana (columbia) as wild-type, two EMS-mutants of Arabidopsis thaliana, cad2 and cad1-3 (Howden et al. 1995a,b) and mutants overexpressing sense and antisense γ-ECS (Xiang et al. 2001). All mutants have columbia as background.

Hydroponic culture

Seeds (Arabidopsis thaliana, columbia) were placed on small plastic pots containing sterilized clay beads (Migros, Marin, Switzerland). The pots were placed at room temperature under 100% humidity and soaked for 7 d in water to allow seed germination. The bottom of the pots were then soaked in the following culture medium: 1·5 mm Ca(NO3)2 4H2O, 1 mm KNO3, 1 mm KH2PO4, 0·75 mm MgSO4 7H2O, 30 µm Fe3+ethylenediaminetetraacetic acid, 1 µm MnCl2, 5 µm H3BO3, 0·175 µm ZnSO4 7H2O, 0·125 µm CuSO4 and 0·2 µm MoO3. Plants were transferred weekly to fresh medium to prevent the development of micro-organisms or other contaminants. After 4 weeks, plants were subjected to stress (see figure legends and text). Roots were carefully removed from beads using distilled water and finally separated from leaves. Both organs were rapidly immersed in liquid nitrogen. When RNA extraction was not carried out immediately, plant material was stored at −80 °C for not more than 1 week to prevent any RNA degradation. The cadmium concentrations (from 10 to 60 µm CdCl2) that were used in our study had no visible toxic effect during the experiments. However, prolonged exposure affected plant growth at different levels according to the concentrations applied.

Bactoagar culture

Seeds (Arabidopsis thaliana, columbia) were sterilized by immersion in a saturated water solution of calcium hypochlorite (CaCl2O2) for 10 min. After a quick centrifugation at 3000 × g, seeds were first washed with 70% ethanol and then four times with sterile distilled water. The seeds were maintained overnight at 4 °C, before laying on 0·4–0·6% (w/v) bactoagar plates. The bactoagar was solubilized in the following nutrient solution (1 L): myo-inositol 0·099 g, 2·5 mm MES-KOH pH 5·7, 10 g sucrose, 0·132 g (NH4)2HPO4 and 0·163 g Hoaglands (H-2395; Sigma, Buchs, Switzerland), before sterilization. After 7 d in the phytotron (25 °C, 16 h light and 70% humidity), whole plants or roots and leaves were collected and immersed in liquid nitrogen before RNA extraction.

Polymerase chain reaction

The specific sense (S) and antisense (AS) primers (5′-3′) were designed using Primer3 (http:www-genome.wi.mit.educgi-binprimerprimer3http:www.cgi) and used to amplify the different AtMRPs by RT-PCR. The nomenclature of AtMRPs was according to Martinoia et al. (2002): (AC025295, T4K22.12, AtMRP1) AtMRP1-S, ccgc agaaatcctcttggtcttgatg and AtMRP1-AS, gtgaatcatcaccgt tagcttctctgg; (AC003096, T29F13, AtMRP2) AtMRP2-S, ccgcagaaatcctcttggtcttgatg and AtMRP2-AS, ccttgtaagtggt gtgagtcatctttgg; (AP000375, MJG19.3, AtMRP3) AtMRP3-S, ccactgcttctgttgacactg and AtMRP3-AS, gaggtgtactcagcc acaagc; (AC005309, F17A22.19, AtMRP4) AtMRP-4S, ctgg aacggtgtcaactcaaggatgttg and AtMRP4-AS, attccggcagatcg gagagcgtactctt; (AC002411, F20D22.11, AtMRP5) AtMRP-5S, cacttggacgagcattactga and AtMRP5-AS, tcttctaatagccgt gcagga; (AP000375, MJG19.4, AtMRP6) AtMRP6-S, ggtca gagacaattggtgtgc and AtMRP6-AS, accttggtctaggagcaggac; (AP000375, MJG19.5, AtMRP7) AtMRP-7S, aactggtgtgtct tggacgag and AtMRP7-AS, tcttgaatccgaacttgctgt; (AB023045, MXL8.11, AtMRP8) AtMRP-8S, ctctgcaagg gagctgattaggatca and AtMRP8-AS, tggagctatgtagcccttgg gaataa; (AL138658, T209.140, AtMRP9) AtMRP9-S, gccactgcttctgttgattct and AtMRP9-AS, gagccggcaaagtgat tagat; (AL163527, F17J16.190, AtMRP10) AtMRP10-S, ccacggcatcgatagataatg, and AtMRP10-AS; gccgagttgtaat gagaccaa; (AC025295, T4K22.1, AtMRP11) AtMRP-11S, tcgctcacagattgaatacca and AtMRP11-AS, ccaccttgactcattc cattc; (AC025295, T4K22.13, AtMRP12) AtMRP12-S, attcgcgaggaattcaagtct and AtMRP12-AS, cacccacactcattc cattct; (AC006225, T5E7.1, AtMRP13) AtMRP13-S, tca gagcccttttctgtttca and AtMRP13-AS, tcgtgttgtggagtagg gaag; (AL162651, F26K9.130, AtMRP14) AtMRP14-S, cgagcgatgtcaacttaagga and AtMRP14-AS, gcaaacaacgact gtctctcc. For this study, the selected housekeeping genes were S16 (At5g18380, this 40S ribosomal protein of Arabidopsis thaliana belongs to the S9P family of ribosomal proteins) and actin2 (At3g18780), the primers were S16-S: ggcgactcaaccagctactga; S16-AS: cggtaactcttctggtaacga; actin2-S, tggaatccacgagacaaccta; actin2-AS, ttctgtgaacgattc ctggac, respectively. The primers for PR1 (M90508) were, respectively, PR1-S: ggccttacggggaaaacttag; PR1-AS: cgttcacataattcccacgag. The PCR reactions were performed in a final volume of 25 µL containing the following mixture: PCR buffer, 0·2 mm dNTPs, 1 µm of both 5′- and 3′- primers, 1 U Taq DNA polymerase (Promega, Catalys, Wallisellen, Switzerland) and adjusted amounts of cDNA. Total RNA was purified from plants using the RNeasy Plant Mini Kit (Qiagen, Basel, Switerland) and stored at −80 °C after quantification by spectrophotometry. After DNAse treatment (DNase, RQ1, RNase free, Promega, Catalys), cDNAs were prepared using M-MLV reverse transcriptase, RNase H minus, point mutant (Promega, Catalys) as indicated by the manufacturer and stored at −20 °C. The cDNAs used in the PCR reaction were between a 1/10 and 1/100 dilution. After 2 min denaturation at 95 °C, 35 PCR cycles (94 °C for 45 s, 58 °C for 45 s and 72 °C for 1 min) were run. The PCR products for all 14 AtMRPs were sequenced to confirm that they corresponded to the right amplified fragments.

Semi-quantitative RT-PCR

The RT reactions were conducted exactly as indicated above. However, PCR amplification were slightly modified, 0·5 MBq [γ33P]ATP (110 TBq mmol−1) were added to the PCR mixture using the following set of dNTPs (0·07 mm dATP, 0·2 mm dGTP, 0·2 mm dTTP and 0·2 mm dCTP). The number of PCR cycles was 20, to be in the exponential phase of PCR for both the housekeeping gene (S16, Actin2) and the genes of interest (AtMRP3, PR1). This point was determined by sampling aliquots during the PCR reaction after 16, 18 and 20 cycles (data not shown). The radioactive PCR products were then separated by gel electrophoresis in 2% agarose gels. After incubation in 0·25 m HCl for 10 min and two washes in 2× SSC, the gels were transferred onto nitrocellulose membranes (Porablot NY plus; Macherey Nagel, Oensingen, Switzerland) under vacuum for 2 h. The membranes were then subjected to overnight autoradiography (BIOMAX-MR, Kodak, Integra Biosciences, Wallisellen, Switzerland). The labelling intensities were finally quantified using phosphorimager (GS-250 Molecular Imager; Bio-Rad, Heinach, Switzerland). The expression of the gene of interest was the mean of phosphorimager data ± SD (n = 3), as the ratio between the gene of interest and the housekeeping gene. The addition of an artificial RNA within the total RNA preparation makes it possible to control the quality of the reverse transcription and to confirm the use of this technique as quantitative.

CDNA-microarray

In this experiment, plants were grown for 4 weeks in aerated hydroponic culture (8 h light) at 22 °C. Total RNA was prepared according to Verwoerd, Dekker & Hoekema (1989). The amplification of cDNA clones or the 3′- ends of the predicted transcribed sequences, selection of housekeeping genes, microarray preparation, mRNA isolation, preparation of fluorescent probes, hybridization reaction and microarray analysis were performed as described by Reymond et al. (2000). For more details, see http:www.unil.chibpv. For our purpose, a fluorescent-labelled cDNA probe was prepared from mRNA isolated from control Arabidopsis roots by reverse transcription in the presence of Cy3-dCTP. A second probe, labelled with Cy5-dCTP, was prepared from roots of plants treated with 50 µm CdCl2. After hybridization of both probes on a cDNA-microarray spotted with 50 ESTs containing gene fragments for ABC-transporters, The 3′- end PCR fragments for AtMRPs and miscellaneous genes, in duplicate, a computer image was generated following scanning.

Cadmium measurement by atomic absorption spectrometry

Dried plant samples were weighed and subsequently transferred into glass tubes. After adding 100 µL 1·8 m H2SO4 to each tube, the samples were kept for 8 h at 95 °C and afterwards for additional 8 h at 550 °C. After cooling, 100 µL 10 m HCl and, after mixing, 2 mL H2O were added to the samples. Cadmium was quantified after appropriate dilution with 0·1 m HCl by atomic absorption spectrometry (228·8 nm) in an air/acetylene flame (SpectrAA 220 FS, Varian, Mulgrave, Australia).

Uptake of 109Cd2+ and root : shoot ratio

Four-week-old plants were grown on clay beads. To prevent plant touching during the removal of the roots from the beads using deionized water, a nylon net was placed between beads and leaf materials before germination. A similar approach was used to avoid touching 7-day-old seedlings. In this case a rigid plastic net (1 cm2) was placed on the bactoagar solution, before sowing the sterilized seeds. A solution of 0·4% bactoagar allowed the removal of seedlings without damaging the roots. In both case the roots of plants were then soaked in 1/8 MS, 10 mm MES-KOH pH 6·0. After 30 min, the medium was replaced by 1/8 MS, 10 mm MES-KOH pH 6·0, 0·44 MBq carrier free 109CdCl2 (31·3 MBq mL−1) for 1 h. After four washings of 30 min in 1/8 MS, 10 mm MES-KOH pH 6·0, 1 mm CaCl2, the plants were removed from the net, gently sponged on a filter paper and the leaves were separated from the roots using small scissors. The plant material was finally immersed in 3 mL of scintillation cocktail (Irga safe plus) and subjected to liquid scintillation counting.

Root length measurements

After sterilization, seeds (approximately 20) were placed on 0·8% bactoagar plates. The plates were stored at 4 °C for 12 h (overnight) for synchronization of seed germination and then placed vertically in the phytotron (25 °C, 16 h light and 70% humidity). After 4 d, the position of the apex of the roots were pointed with a marker at the back of the plates and turned right at 90°, if necessary. Finally, the lengths of the roots were measured after another 24 h growth in the phytotron.

RESULTS

  1. Top of page
  2. ABSTRACT
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. ACKNOWLEDGMENTS
  8. REFERENCES

Up-regulation of AtMRPs after cadmium treatment

The analysis of the transcript levels by RT-PCR using specific primers revealed that 14 out of the 15 putative genes for AtMRPs are constitutively expressed in leaves and roots. The amplified PCR products were sequenced and confirmed to correspond to each respective AtMRP (data not shown). In order to identify specific AtMRPs induced or repressed by cadmium, total RNA from roots and leaves of plants previously treated with 20 µm CdCl2 for 24 h were isolated. A first, qualitative RT-PCR (35 PCR cycles) showed that cadmium treatment did not modify the transcript level in leaves of Arabidopsis thaliana. In contrast, these results suggested that AtMRP3, and at a lower level, AtMRP6, 7 and 14 were possibly induced in roots (Fig. 1). In parallel with these first RT-PCR analyses, the 14 AtMRPs were spotted together with other 50 stress-related or control genes with a robot onto glass slides. The hybridization of the slides was performed using Cy3 (control plants) and Cy5 (50 µm CdCl2 for 24 h) labelled cDNAs prepared from root mRNA isolated from 4-week-old plants (Fig. 2a). The data revealed that in the set of AtMRPs, the highest induction could be observed for AtMRP3 (2·4–2·5) (Fig. 2b). Some induction could also be observed for AtMRP4, AtMRP9, AtMRP12, AtMRP13 and AtMRP14, but with weaker signals. The results expressed in the first quadrant were similar to those found in the second, although the data of the first quadrant were slightly higher. Cy3 and Cy5 signals for housekeeping genes (actin-2, ubiquitin and ubiquitin-4) were superior to 20 000, whereas those for the AtMRPs did not exceed 10 000, demonstrating the relatively low expression levels of AtMRPs. The microarray data were confirmed by hybridization of a second microarray and by radioactive RT-PCR analysis for AtMRP3 (Fig. 2c). As observed in qualitative RT-PCR, no cadmium-dependent induction of the 14 AtMRPs was detected in leaf tissue using microarray analysis (data not shown).

image

Figure 1. Transcript levels of AtMRPs in roots and leaves of 4-week-old A. thaliana plants after treatment with 20 µm CdCl2 for 24 h. Non-quantitative two step RT-PCR (35 cycles) were performed as indicated in material and methods. Amplified DNA fragments were separated using a 1·5% agarose gel and stained with ethidium bromide. The nomenclature of the corresponding genes is according to Martinoia et al. (2002).

Download figure to PowerPoint

image

Figure 2. Transcript levels of AtMRPs in roots of plants treated with 50 µm CdCl2 for 24 h using cDNA-microarray. Genes induced or repressed after cadmium treatment are represented as red or green signals, respectively. Genes expressed at approximately equal levels between treatments appear as yellow spots. Control genes which were used for normalization of fluorescent signals in both channels are in the first row of the quadrant [panel (a) shows the first quadrant which contains only one copy of the genes]. Panel (b) shows the expression levels (duplicates on first and second quadrants) of five housekeeping genes (used for normalization of the signals) and the 14 AtMRP genes (3′- end amplified fragments by PCR using whole plant cDNAs and amplified EST inserts, as templates). EST numbers and MIPS code are also indicated. Panel (c) shows a two step semi-quantitative RT-PCR with the RNA used as for slide hybridization. The autoradiography of the nitrocellulose membrane (after agarose gel transfer) and histograms resulting from quantification of the phosphoimager data (n = 3) are presented.

Download figure to PowerPoint

AtMRP3 induction and 109Cd root : shoot ratio in adult plants

In order to learn more about the mechanisms of cadmium-dependent gene induction and why such a difference between roots and leaves can be observed, we investigated in more detail under which conditions the transcript levels of AtMRP3 increased. To perform appropriate experiments, the plants were grown hydroponically on clay beads. Raising Cd2+ concentrations from 20 to 60 µm in the culture medium shows that AtMRP3 induction in roots is saturated at 20 µm. In contrast, no induction could be observed in leaves up to 60 µm (Fig. 3a). A 48 h treatment with 20 µm CdCl2 resulted in similar expression levels as a 24 h treatment (data not shown). The fact that AtMRP3 induction is only observed in roots but not in leaves might suggest that Cd is efficiently retained in the root, and hence cannot affect AtMRP3 expression in leaves. To test this hypothesis, 30 individual 4-week-old plants were incubated with 109CdCl2 for 1 h. The data showed a high variability of radioactive cadmium distribution within the different plants (data for seven plants are shown here). Indeed, the root : shoot ratio varied from about 6 to 25 (Fig. 3b). However, values inferior to 4 were never found in the 30 plants tested. These results demonstrate that in 4-week-old plants Cd is mainly retained in the roots.

image

Figure 3. Effect of increasing Cd concentration on AtMRP3 transcript levels and 109Cd root : shoot ratio of 4-week-old plants. (a) Expression of AtMRP3 (semi-quantitative RT-PCR) in leaves (right) and roots (left) after addition of 0, 20, 40, 60 µm CdCl2 to the culture medium for 24 h. The 4-week-old plants were maintained in clay beads during the 24 h stress using freshly prepared nutrient solution. (b) 109Cd root/shoot distribution in seven individual plants, after 1 h exposure to 109CdCl2, as described in material and methods (the values obtained were comparable with two other independent experiments)

Download figure to PowerPoint

To determine whether the presence of Cd2+ within the leaves resulted in an increase of the AtMRP3 transcript levels, we fed cadmium directly to leaves. A net was placed between the plants and the beads before germination to prevent any contact between the plants and the research worker carrying out the experiment. Indeed, if the plants were touched by hand, increases in the transcript levels of stress-induced genes, which do not commonly respond to cadmium, were found to occur (data not shown). Thus, after carefully removing the beads from the roots with distilled water, the roots of the plants were cut, leaving only the first 0·5 cm of the primary root. These plants, as well as plants with intact roots, were exposed to 10 mm MES-KOH pH 6·0, 10 mm KNO3 in the presence or absence of 20 µm CdCl2 for 24 h. Under these conditions a 2·4-fold induction of AtMRP3 could be observed in leaves of plants, where the roots have been removed, suggesting that under those conditions cadmium concentration in the leaves was increased and resulted in AtMRP3 up-regulation (Fig. 4a). Indeed, measurement of cadmium in leaves of plants without roots and treated with CdCl2 showed that the cadmium content was nearly double in comparison with control plants (Fig. 4b).

image

Figure 4. Comparison of AtMRP3 transcript levels and cadmium contents in leaves of 4-week-old plants with or without cut roots. (a), Transcript levels in leaves of intact plants and plants with cut roots, after CdCl2 treatment for 24 h. As control, data obtained with plants which were not subjected to CdCl2 treatment are shown. Two-step semi-quantitative RT-PCR were performed as indicated in materials and methods. (b), Cadmium contents in plants corresponding to those shown in (a) are presented.

Download figure to PowerPoint

AtMRP3 induction and 109Cd root : shoot ratio in young seedlings

The situation was analysed for young seedlings treated with cadmium. When seedlings were cultivated for 7 d under sterile conditions on a 0·6% bactoagar medium supplemented with 10 µm CdCl2, roots exhibited a strongly reduced growth rate (Fig. 5a), whereas lowering the concentrations reduced the effects. By contrast, under higher CdCl2 concentration (>10 µm CdCl2) chlorophyll content strongly diminished in addition to reduced growth (data not shown). The AtMRP3 expression levels were analysed in 7-day-old seedlings treated either with 20 µm CdCl2 for 24 h (Fig. 5b) or from the outset of germination on bactoagar medium supplemented with 10 µm CdCl2 (Fig. 5c). In both cases, AtMRP3 was up-regulated in the root by a factor higher than 2 (Fig. 5b & c), as for 4-week-old plants (Figs 2 & 3). However, in contrast to the results presented above for mature plants, AtMRP3 was also strongly induced in the leaves of seedlings (about three times more, compare Fig. 3a with Fig. 5b & c). It should be noticed that a longer exposure to cadmium during germination (from 0 to 7 d), compared to a 24 h treatment, did not affect the AtMRP3 expression level in the leaves (about 3), but seemed to stimulate AtMRP3 induction in the roots (compare Fig. 5c with Fig. 5b). To demonstrate a possible correlation between Cd2+ distribution and AtMRP3 induction, 7-day-old plantlets were incubated with 109CdCl2. For this purpose, sterilized seeds were placed on 0·4% bactoagar medium covered by 1 cm2 plastic nets. After 7 d, the nets containing the seedlings were transferred into liquid medium. Uptake of radioactive cadmium was performed exactly as for 4-week-old plants (see above, Fig. 3b). Determination of the distribution of 109Cd between roots and shoots resulted in a much lower retention of Cd2+ in the roots (0·5–1·5) in comparison with the 4-week-old plants (compare Fig. 5d with Fig. 3b), indicating that the root–shoot barrier for cadmium is either not or only weakly established in young plantlets. Therefore higher cadmium concentrations are present in shoots and likely to be responsible for inducing AtMRP3 transcript levels.

image

Figure 5. Transcript level of AtMRP3 in roots and leaves of 7-day-old seedlings after Cd2+ treatment. The effect of 10 µm CdCl2 on roots grown from the outset of germination was analysed by measuring the root length (a). Semi-quantitative RT-PCRs were performed to analyse the transcript level of AtMRP3 in 7-day-old plants (6–10 seeds per plastic net, as described in the text). Plantlets were transferred from bactoagar to 10 mm MES-KOH, 10 mm KNO3 in the presence or absence of 20 µm CdCl2 for 24 h (b). Semi-quantitative RT-PCR were performed to analyse the transcript level of AtMRP3 in 7-day-old seedlings grown onto bactoagar medium supplemented with 10 µm CdCl2 from the outset of germination (c). 109Cd root : shoot distribution within seven groups of plantlets (approximately 6–10 seedlings per plastic net) after 1 h exposure to 109CdCl2, as described in material and methods (d).

Download figure to PowerPoint

AtMRP3 expression level in cad1, cad2 and γ -ECS transgenic plants

It has been reported that Cd2+ detoxification involves glutathione (GSH) and phytochelatins (PC), which form complexes with many heavy metals (Grill, Winnacker & Zenk 1985; Li et al. 1997; Cobbett 2000a). In vivo, Cd(GSH)2 and/or Cd-PCs are presumably transported into the vacuole via directly energized transporters (Salt & Rauser 1995; Li et al. 1996; Tommasini et al. 1996; Rea 1999; Cobbett 2000b). Two EMS-mutants of Arabidopsis thaliana, cad2 and cad1-3 (Howden et al. 1995a,b), knocked out in the first step of glutathione synthesis, γ-glutamyl-cys synthetase (γ-ECS) and phytochelatin synthetase (PCs) activities, respectively, as well as mutant plants overexpressing sense and antisense γ-ECS, were used to investigate whether the complexes play a role in AtMRP3 induction. All these plants, with the exception of those overexpressing the sense γ-ECS (Xiang et al. 2001), have been demonstrated to be less tolerant to Cd in comparison with wild-type plants. These mutants were used to determine whether a disruption in the glutathione or PC biosynthesis pathway affect the induction of AtMRP3. Both cad mutants, γ-ECS antisense and sense, as well as wild-type plants (columbia ecotype) were grown on bactoagar supplemented with 10 µm CdCl2 for 7 d. Root growth was strongly affected by Cd2+ in all mutants (data not shown). Interestingly, Cd2+ induced comparable AtMRP3 expression in wild-type and mutant plants (Fig. 6a). Treatment of wild-type plants with BSO (l-buthionine sulphoxime), an inhibitor of glutathione biosynthesis, gave similar results. Therefore, our results suggest that the induction of the AtMRP3 gene is not related to the biosynthesis or levels of GSH or PC and hence not mediated by a heavy metal-GS or heavy metal-PC complexes in Arabidopsis thaliana.

image

Figure 6. Induction of AtMRP3 in mutants affected in GSH or phytochelatin levels (cad2, γ-ECS sense and antisense plants, cad1) (a) and effect of oxidative stress on the expression of AtMRP3 (b). WT, cad1 (impaired phytochelatine synthesis), cad2 (reduced glutathione synthesis) and γ-ECS sense and antisense plants were grown for 7 d on 0·8% bactogar supplemented with or without 10 µm CdCl2. Transcription levels were determined using semi-quantitative RT-PCR (a). To measure the effect of oxidative stress on the expression of AtMRP3, total RNA was prepared from 7-day-old-seedlings, grown on bactoagar, which were sprayed with 1 mm H2O2 or 100 µm menadione and collected after 24 h. The expression levels of AtMRP3 and PR1 were estimated by semi-quantitative RT-PCR (b).

Download figure to PowerPoint

Effect of oxidative stress on the AtMRP3 expression level

The induction of AtMRP3 could therefore result either from oxidative stress generated by Cd2+ (Prasad & Hagemeyer 1999, references herein) or to the heavy metal itself. To answer this question, 7-day-old seedlings were subjected to two different oxidative stress, H2O2 (1 mm) and menadione (100 µm). The transcript levels of AtMRP3 and PR1, a gene known to be induced by oxidative stress (Chamnongpol et al. 1998), were compared for their capacity to be induced by Cd2+ (similar experimental set up as in Fig. 5). The data show that AtMRP3 is not induced by menadione and only very slightly by H2O2 compared to Cd (Fig. 6b). On the other hand, PR1[as well as other oxidative stress-dependent genes like GST6 and GST11 (Xiang & Oliver 1998, data not shown)], were not induced by Cd2+, but strongly expressed after menadione or H2O2 exposure (Fig. 6b). These results strongly suggest that neither oxidative stress (generated by H2O2 or menadione), nor GSH and PC levels or complexes are responsible for inducing AtMRP3. Interestingly, copper appears to induce AtMRP3 to a similar level as cadmium in agar plates. In contrast only a slight effect was observed for zinc (data not shown).

DISCUSSION

  1. Top of page
  2. ABSTRACT
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. ACKNOWLEDGMENTS
  8. REFERENCES

In Saccharomyces cerevisiae (Li et al. 1997), Schizosaccharomyces pombe (Ortiz et al. 1995; Cobbett 2000b) and Leishmania tarentolae (Legare et al. 2001) it has been demonstrated that ABC transporters play a central role in transport of heavy metals into the vacuole and hence in the final step of heavy metal detoxification. In Saccharomyces, YCF1 (yeast cadmium factor 1), the ABC transporter responsible for heavy metal tolerance, belongs to the subfamily of the MRPs. MRPs are full length ABC transporters containing two cytosolic, two transmembrane regions and a N-terminal extension. YCF1 is able to transport glutathione conjugates (Li et al. 1996, Tommasini et al. 1996), as well as bis glutathione-cadmium complexes (Li et al. 1997). In contrast, HMT1, the ABC transporter responsible for cadmium tolerance in fission yeast, is a half size transporter consisted of only one cytosolic and one transmembrane region. In this case, the substrates transported are phytochelatins (PC), both as apo-PC and as PC-Cd complexes (Ortiz et al. 1995). In plants, transport experiments using isolated vacuoles indicate that an ABC-type transporter is involved in vacuolar uptake of PC (Rauser 1995; Salt & Rauser 1995). However no plant transporter for GS2Cd or PC has been presently identified. In A. thaliana it has been shown that AtMRP3 can partially restore the heavy metal hypersensitive phenotype ycf1, however, the mechanisms involved have not yet been elucidated.

In Arabidopsis grown in phytotron for 4 weeks, 14 AtMRPs are expressed. To analyse whether one of these AtMRPs responds to Cd2+ treatment and might be involved in Cd detoxification, RT-PCR and cDNA microarray were performed. Similar results were obtained with the two methods. Indeed, in both cases, AtMRP3 was the most strongly induced MRP. A few other AtMRPs (see Fig. 2) also exhibited increased transcript levels after cadmium treatment, but to a lower extent. In every case AtMRP3 induction was detected only in the roots. This result can be explained by the observations made in different plant species (pea, sugar beet) showing that the bulk of heavy metals is stored in the root, whereas only a minor portion is transferred into the shoot (Prasad & Hagemeyer 1999; Cakmak et al. 2000; Fargašová 2001; Vitória, Lea & Azevedo 2001). The expression level of AtMRP3 in the roots of 4-week-old plants was saturated at 20 µm Cd2+ and did not more increase when the cadmium concentrations raised up to 60 µm CdCl2 (Fig. 3). It is worth mentioning that, under our conditions, induction of AtMRP3 was negligible at 10 µm Cd2+ for adult plants. This is probably due to a partial adsorption to the clay beads, depletion in the solution or interaction with compounds present in the culture medium, which both are likely to reduce the free cadmium concentration. In a similar experiment using cell cultures of A. thaliana treated with 20 µm CdSO4 for 1 to 4 h, Sanchez-Fernandez et al. (1998) did not find any induction of AtMRP3. Three reasons may explain this observation: (i) cell cultures are not suitable to follow transcript levels of AtMRP3 exposed to Cd2+ (ii) the time of exposure (4 h) was too short; and (iii) the MS medium efficiently interacts with Cd2+, thereby reducing the free heavy metal concentration.

To verify our hypothesis that the absence of AtMRP3 induction in leaves is due to the low cadmium concentrations accumulated within the leaves and not to a root-specific promoter element, we cut the roots of Arabidopsis and exposed the base of the root to a cadmium solution. Under these conditions an increase of transcript levels was observed and was correlated with the uptake of cadmium to the aerial part of the plants (Fig. 4). The fact that AtMRP3 induction can also occur in leaves of 7-day-old seedlings (Fig. 5b & c) confirms this hypothesis, because at this stage Cd2+ translocation from the root to the shoot is much higher compared to 4-week-old plants (Figs 3b & 5d). Apparently, the establishment of the root–shoot barrier for cadmium and hence the transport of heavy metals to the shoot depends on the developmental stage of the plant. Furthermore, our results demonstrate that it is not always possible to extrapolate data obtained from seedlings to mature plants.

In addition to heavy metal sequestration, GSH may also play a role in protecting plants against oxidative stress, which can originate from heavy metal uptake (Noctor et al. 1998; Dixit, Pandey & Shyam 2001). However, under our experimental conditions, AtMRP3 was not induced by oxidative stress (100 µm menadione or 1 mm H2O2), an observation also made by Sanchez-Fernandez et al. (1998), except for aminotriazole which induces mild oxidative stress through inhibition of catalases, thus indicating that redox status does probably not influence AtMRP3 expression levels. Results with mutants having reduced levels of GSH and PCs, as well as with plants having reduced or elevated level of GSH after antisensing or overexpressing γ-ECS (Xiang et al. 2001), show that it is likely not PC-Cd and also not GS2Cd which influences AtMRP3 induction. These results strongly indicate that the promoter of AtMRP3 is either inducible directly by free Cd2+ or via a cadmium-inducible transcription factor. However, it cannot be excluded that very low levels of Cd-complexes (Cd-GSH2) may also play a role in gene expression. Recent data obtained with S. cerevisiae showed that Cu and Zn homeostasis are controlled by specific genes, Ace1, Mac1 and Zap1 coding for transcription factors, respectively (Bird et al. 2000; Gross et al. 2000). Although only Zap1 has a homologous gene in A. thaliana, which likely play a role in zinc homeostasis (De Pater et al. 1996), it is tempting to speculate that transcriptional activators can be activated by other heavy metal divalent cations, including Cd2+.

In conclusion, our results show that transcript levels of genes coding for ABC-type transporters might be modulated directly by heavy metals and not through oxidative stress. A direct correlation between heavy metals and the plant ABC transporter transcripts suggest that in plant, as in yeasts, ABC transporters are involved in heavy metal fluxes. However, to date we have no results demonstrating that AtMRP3 is really involved in cadmium transport.

ACKNOWLEDGMENTS

  1. Top of page
  2. ABSTRACT
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. ACKNOWLEDGMENTS
  8. REFERENCES

This project was supported by the Swiss National Foundation within the project 31–63708.00 and the NCCR Plant Survival as well as by the Bundesamt für Bildung und Wissenschaft (BBW C990060 and BBW 00·0413/EU proposal Metallophytes, QLRT-2001-02894). The authors are grateful to Dr Xiang for providing us with γ-ECS transgenic plants.

REFERENCES

  1. Top of page
  2. ABSTRACT
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. ACKNOWLEDGMENTS
  8. REFERENCES
  • Alloway B.J. & Steinnes E. (1999) Anthropogenic additions of cadmium to soils. In Cadmium in Soils and Plants (eds M.J.McLaughlin & B.R.Singh), pp. 97123. Kluwer Academic Publishers, Dordrecht, The Netherlands.
  • Bird A.J., Zhao H., Luo H., Jensen L.T., Srinivasan C., Evans-Galea M., Winge D.R. & Eide D.J. (2000) A dual role for zinc fingers in both DNA binding and zinc sensing by the Zap1 transcriptional activator. EMBO Journal 19, 37043713.
  • Cakmak I., Welch R.M., Hart J., Norvell W.A., Ozturk L. & Kochian L.V. (2000) Uptake and retranslocation of leaf-applied cadmium (109Cd) in diploid, tetraploid and hexaploid wheats. Journal of Experimental Botany 51, 221226.
  • Chamnongpol S., Willekens H., Moeder W., Langebartels C., Sandermann H., Van Montagu M., Inze D. & Van Camp W. (1998) Defense activation and enhanced pathogen tolerance induced by H2O2 in transgenic tobacco. Proceedings of the National Academy of Science of the United States of America 95, 58185823.
  • Clemens S., Schroeder J.I. & Degenkolb T. (2001) Caenorhabditis elegans expresses a functional phytochelatin synthase. European Journal of Biochemistry 268, 36403643.
  • Cobbett C.S. (1999) A family of phytochelatin synthase genes from plant, fungal and animal species. Trends in Plant Science 9, 335337.
  • Cobbett C.S. (2000a) Phytochelatins and their roles in heavy metal detoxification. Plant Physiology 123, 825832.
  • Cobbett C.S. (2000b) Phytochelatin biosynthesis and function in heavy-metal detoxification. Current Opinion in Plant Biology 3, 211216.
  • De Pater S., Greco V., Pham K., Memelink J. & Kijne J. (1996) Characterization of a zinc-dependent transcriptional activator from Arabidopsis. Nucleic Acids Research 24, 46244631.
  • Dixit V., Pandey V. & Shyam R. (2001) Differential antioxidative responses to cadmium in roots and leaves of pea (Pisum sativum L. cv. Azad). Journal of Experimental Botany 52, 11011109.
  • Dunaeva M. & Adamska I. (2001) Identification of genes expressed in response to light stress in leaves of Arabidopsis thaliana using RNA differential display and natural senescence. European Journal of Biochemistry 268, 55215528.
  • Fargašová A. (2001) Phytotoxic effects of Cd, Zn, Pb, Cu and Fe on Sinapis alba L. seedlings and their accumulation in roots and shoots. Biologia Plantarum 44, 471473.
  • García-Hernández M., Murphy A. & Taiz L. (1998) Metallothioneins 1 and 2 have distinct but overlapping expression patterns in Arabidopsis. Plant Physiology 118, 387397.
  • Grill E., Winnacker E.L. & Zenk M.H. (1985) Phytochelatins: the principal heavy-metal complexing peptides of higher plants. Science 230, 674676.
  • Gross C., Kelleher M., Lyer V.R., Brown P.O. & Winge D.R. (2000) Identification of the copper regulon in Saccharomyces cerevisiae by DNA microarrays. Journal of Biological Chemistry 275, 3231032316.
  • Hirschi K.D., Korenkov V.D., Wilganowski N.L. & Wagner G.J. (2000) Expression of Arabidopsis CAX2 in tobacco. Altered metal accumulation and increased manganese tolerance. Plant Physiology 124, 125133.
  • Howden R., Andersen C.R., Goldsbrough P.B. & Cobbett C.S. (1995b) A cadmium-sensitive, glutathione-deficient mutant of Arabidopsis thaliana. Plant Physiology 107, 10671073.
  • Howden R., Goldsbrough P.B., Andersen C.R. & Cobbett C.S. (1995a) Cadmium-sensitive, cad1 mutants of Arabidopsis thaliana are phytochelatin deficient. Plant Physiology 107, 10591066.
  • Keltjens W.G. & Van Beusichem M.L. (1998) Phytochelatins as biomarkers for heavy metal stress in maize (Zea mays L.) and wheat (Triticum aestivum L.): combined effects of copper and cadmium. Plant and Soil 203, 119126.
  • Korshunova Y.O., Eide D., Clark W.G., Guerinot M.L. & Pakrasi H.B. (1999) The IRT1 protein from Arabidopsis thaliana is a metal transporter with a broad substrate range. Plant Molecular Biology 40, 3744.
  • Legare D., Richard D., Mukhopadhyay R., Stierhof Y.D., Rosen B.P., Haimeur A., Papadopoulou B. & Ouellette M. (2001) The Leishmania ATP-binding cassette protein PGPA is an intracellular metal-thiol transporter ATPase. Journal of Biological Chemistry 276, 2630126307.
  • Li Z.S., Lu Y.P., Zhen R.G., Szczypka M., Thiele D.J. & Rea P.A. (1997) A new pathway for vacuolar cadmium sequestration in Saccharomyces cerevisiae: YCF1-catalyzed transport of bis (glutathionato) cadmium. Proceedings of the National Academy of Science of the United States of America 94, 4247.
  • Li Z.S., Szczypka M., Lu Y.P., Thiele D.J. & Rea P.A. (1996) The Yeast Cadmium Factor Protein (YCF1) is a vacuolar glutathione S-conjugate pump. Journal of Biological Chemistry 271, 65096517.
  • Lombi E., Tearall K.L., Howarth J.R., Zhao F.J., Hawkesford M.J. & McGrath S.P. (2002) Influence of iron status on cadmium and zinc uptake by different ecotypes of the hyperaccumulator Thlaspi caerulescens. Plant Physiology 128, 13591367.
  • Miller J.D., Arteca R.N. & Pell E.J. (1999) Senescence-associated gene expression during ozone-induced leaf senescence in Arabidopsis. Plant Physiology 120, 10151024.
  • Martinoia E., Klein M., Geisler M., Bovet L., Forestier C., Kolukisaoglu U., Muller-Rober B. & Schulz B. (2002) Multifunctionality of plant ABC transporters – more than just detoxifiers. Planta 214, 345355.
  • Noctor G., Arisi A., Jouanin J., Kunert K., Rennenberg H. & Foyer C. (1998) Glutathione: biosynthesis, metabolism and relationship to stress tolerance explored in transformed plants. Journal of Experimental Botany 49, 623647.
  • Ortiz D.F., Ruscini T., McCue K.F. & Ow D.W. (1995) Transport of metal-binding peptides by HMT1, a fission yeast ABC-type vacuolar membrane protein. Journal of Biological Chemistry 270, 47214728.
  • Pence N.S., Larsen P.B., Ebbs S.D., Letham D.L., Lasat M.M., Garvin D.F., Eide D. & Kochian L.V. (2000) The molecular physiology of heavy metal transport in the Zn/Cd hyperaccumulator Thlaspi caerulescens. Proceedings of the National Academy of Science of the United States of America 97, 49564960.
  • Prasad M.N. & Hagemeyer J. (1999) Heavy Metal Stress in Plants (eds M.N.Prasad & J.Hagemeyer). Springer, Berlin, Germany.
  • Raskin I., Smith R.D. & Salt D.E. (1997) Phytoremediation of metals: using plants to remove pollutants from the environment. Current Opinion in Biotechnology 8, 221226.
  • Rauser W.E. (1995) Phytochelatins and related peptides. structure, biosynthesis, and function. Plant Physiology 109, 11411149.
  • Rea P. (1999) MRP subfamily ABC transporters from plants and yeast. Journal of Experimental Botany 50, 895913.
  • Reymond P., Weber H., Damond M. & Farmer E. (2000) Differential gene expression in response to mechanical wounding and insect feeding in Arabidopsis. Plant Cell 12, 707720.
  • Rogers E.E., Eide D.J. & Guerinot M.L. (2000) Altered selectivity in an Arabidopsis metal transporter. Proceedings of the National Academy of Science of the United States of America 97, 1235612360.
  • Salt D.E., Blaylock M., Kumar N.P., Dushenkov V., Ensley B.D., Chet I. & Raskin I. (1995) Phytoremediation: a novel strategy for the removal of toxic metals from the environment using plants. Biotechnology (N Y) 13, 468474.
  • Salt D.E. & Rauser W.E. (1995) MgATP-dependent transport of phytochelatins across the tonoplast of the oat roots. Plant Physiology 107, 12931301.
  • Sanchez-Fernandez R., Ardiles-Diaz W., Van Montagu M., Inze D. & May M.J. (1998) Cloning and expression analyses of AtMRP4, a novel MRP-like gene from Arabidopsis thaliana. Molecular and General Genetics 258, 655662.
  • Schäfer H.J., Greiner S., Rausch T. & Haag-Kerwer A. (1997) In seedlings of the heavy metal accumulator Brassica juncea Cu2+differentially affects transcript amounts for -glutamylcysteine synthetase (-ECS) and metallothionein (MT2). FEBS Letters 404, 216220.
  • Sharma R., Rensing C., Rosen B.P. & Mitra B. (2000) The ATP hydrolytic activity of purified ZntA, a Pb (II) /Cd (II) /Zn (II) -translocating ATPase from Escherichia coli. Journal of Biological Chemistry 275, 38733878.
  • Thomine S., Wang R., Ward J.M., Crawford N.M. & Schroeder J.I. (2000) Cadmium and iron transport by members of a plant metal transporter family in Arabidopsis with homology to Nramp genes. Proceedings of the National Academy of Science of the United States of America 97, 49914996.
  • Tommasini R., Evers R., Vogt E., Mornet C., Zaman G.J., Schinkel A.H., Borst P. & Martinoia E. (1996) The human multidrug resistance-associated protein functionally complements the yeast cadmium resistance factor 1. Proceedings of the National Academy of Science of the United States of America 93, 674367478.
  • Tommasini R., Vogt E., Fromenteau M., Hortensteiner S., Matile P., Amrhein N. & Martinoia E. (1998) An ABC-transporter of Arabidopsis thaliana has both glutathione-conjugate and chlorophyll catabolite transport activity. Plant Journal 13, 773780.
  • Vatamaniuk O.K., Bucher E.A., Ward J.T. & Rea P.A. (2001) A new pathway for heavy metal detoxification in animals. phytochelatin synthase is required for cadmium tolerance in Caenorhabditis elegans. Journal of Biological Chemistry 276, 2081720820.
  • Verwoerd T.C., Dekker B.M. & Hoekema A. (1989) A small-scale procedure for the rapid isolation of plant RNAs. Nucleic Acids Research 17, 2362.
  • Vitória A.P., Lea P.J. & Azevedo R.A. (2001) Antioxidant enzymes responses to cadmium in radish tissues. Phytochemistry 57, 701710.
  • Xiang C. & Oliver D.J. (1998) Glutathione metabolic genes coordinately respond to heavy metals and jasmonic acid in Arabidopsis. Plant Cell 10, 15391550.
  • Xiang C., Werner B.L., Christensen E.M. & Oliver D.J. (2001) The biological functions of glutathione revisited in Arabidopsis transgenic plants with altered glutathione levels. Plant Physiology 126, 564574.
  • Zhou J. & Goldsbrough P.B. (1994) Functional homologs of fungal metallothionein genes from Arabidopsis. Plant Cell 6, 875884.

Received 21 May 2002; received in revised form 22 August 2002; accepted for publication 26 August 2002