SEARCH

SEARCH BY CITATION

Summary

  1. Top of page
  2. Summary
  3. Introduction
  4. Results and discussion
  5. Experimental procedures
  6. Acknowledgements
  7. References.

cDNA clones encoding a novel 3-ketoacyl-ACP synthase (KAS) have been isolated fromCuphea. The amino acid sequence of this enzyme is different from the previously characterized classes of KASs, designated KAS I and III, and similar to those designated as KAS II. To define the acyl chain specificity of this enzyme, we generated transgenicBrassicaplants over-expressing the cDNA encoded protein in a seed specific manner. Expression of this enzyme in transgenicBrassicaseeds which normally do not produce medium chain fatty acids does not result in any detectable modification of the fatty acid profile. However, co-expression of theCupheaKAS with medium chain specific thioesterases, capable of production of either 12:0 or 8:0/10:0 fatty acids in seed oil, strongly enhances the levels of these medium chain fatty acids as compared with seed oil of plants expressing the thioesterases alone. By contrast, co-expression of theCupheaKAS along with an 18:0/18:1-ACP thioesterase does not result in any detectable modification of the fatty acids. These data indicate that theCupheaKAS reported here has a different acyl-chain specificity to the previously characterized KAS I, II and III. Therefore, we designate this enzyme KAS IV, a medium chain specific condensing enzyme.


Introduction

  1. Top of page
  2. Summary
  3. Introduction
  4. Results and discussion
  5. Experimental procedures
  6. Acknowledgements
  7. References.

The 3-ketoacyl-ACP synthase (KAS) components of type II fatty acid synthase are present in plastid organelles as well as in many bacteria. These enzymes catalyze the stepwise condensation of an acyl group bound either to an acyl carrier protein (ACP) or a CoA with malonyl-ACP. Presently, three family members, KAS I, KAS II and KAS III, differing in substrate specificity and sensitivity to the KAS inhibitor, cerulenin, have been identified and their respective cDNAs (Kas1, 2 and 3) from several plant species have been cloned ( Genez et al. 1991 ;Kauppinen 1992;Tai & Jaworski 1993). Biochemical analyses of these plant enzymes indicate that 3-ketoacyl-ACP synthase I, an enzyme extremely sensitive to cerulenin (1 μm), catalyzes the majority of condensations using acyl-ACPs up to 14:0 as substrates, whereas KAS II, which is inhibited by higher levels of cerulenin (50 μm), functions primarily in stearic acid synthesis and is most active with 14:0–16:0 substrates ( Shimakata & Stumpf 1982). A body of evidence suggests that KAS III, which is insensitive to cerulenin, catalyses the initial reaction in fatty acid biosynthesis ( Clough et al. 1992 ;Tsay et al. 1992 ;Walsh et al. 1990 ). Furthermore, contrary to other condensing enzymes, KAS III is capable of utilizing acetyl-CoA as a primer rather than acetyl-ACP ( Jackowski et al. 1987 ; 1989).

The end products of plant fatty acid synthetase activities are usually 16- and 18-carbon fatty acids ( Hardwood 1988). However, certain plants, such as Cuphea, accumulate high levels of medium chain fatty acids in their seed oil. Cumulative evidence indicate that medium chain specific thioesterases are among the key enzymes involved in the biosynthesis of medium chain fatty acids, but are not the sole determinants of chain length and composition of these fatty acids ( Hardwood 1988;Voelker 1996). Involvement of a specific condensing enzyme in determining the composition of medium chain fatty acids has been proposed, and indirect biochemical evidence for their role in controlling fatty acid chain length has been provided ( Fuhrman & Heise 1993).

In our effort to identify the role of KAS enzymes in medium chain fatty acid synthesis, cDNAs were isolated from C. hookeriana, a plant species with 50% 8:0 and 25% 10:0, and from C. pulcherrima, a species with 95% 8:0. Among these clones, we have identified cDNAs encoding KAS I and KAS III type enzymes (K. Dehesh, unpublished results). In addition, we have also isolated a cDNA with sequence similarity to the castor cDNA, which was originally isolated using oligonucleotide primers corresponding to the amino acid sequence of a purified enzyme responsible for elongation of 16:0-ACP to 18:ACP ( Genez et al. 1991 ). The relationship, however, between the enzyme activity of the encoded product of the castor cDNA and that of the biochemically defined KAS II enzyme has still to be examined.

To determine directly the enzyme activity encoded by these Cuphea cDNAs, soluble affinity purified recombinant proteins were produced and analyzed in an in vitro KAS assay using a range of saturated substrates, 6:0–16:0-ACP and 16:1-ACP. Unfortunately, for yet unknown reasons, both these enzymes were inactive, and hence transgenic Brassica plants over-expressing the Cuphea KAS II-related cDNA, alone or together with thioesterases of different chain length specificity, were employed to determine the acyl chain specificity of the Cuphea enzyme. The results of these experiments indicate that the Cuphea KAS, despite its sequence homology with the putative castor KAS II, is a condensing enzyme specific for medium chain acyl groups and is therefore designated here as KAS IV. The amplified expression of this gene (Kas4) in Cuphea seeds implies that this enzyme provides the condensing activity that in synergy with the corresponding hydrolytic enzyme results in accumulation of high levels of medium chain fatty acids in seed oil. The details of these studies are presented in this paper.

Results and discussion

  1. Top of page
  2. Summary
  3. Introduction
  4. Results and discussion
  5. Experimental procedures
  6. Acknowledgements
  7. References.

Isolation and sequence analyses of Kas4 cDNAS from Cuphea species

Screening of both C. hookeriana and C. pulcherrima developing seed cDNA libraries with the castor bean probe led to detection of a large number (300) of hybridizing signals, suggesting that these are highly abundant message(s) in both Cuphea species. Several clones from each library were plaque purified, sequenced and found to belong to a class of KASs designated Kas4. Both the Cpu and the Ch Kas4 clones contain the complete coding region, as defined by the presence of a stop codon on the 5′-end of the polypeptide sequence. Cpu Kas4 encodes a polypeptide of 545 amino acids with a molecular mass of 58.9 kDa and pI of 9.3, whereas Ch Kas4 encodes a predicted polypeptide of 533 amino acids with a molecular mass of 57.2 kDa and pI of 9.05. The size of the presumptive mature polypeptide of Ch KAS IV was defined by sequence homology with the castor cDNA ( Genez et al. 1991 ). Comparison of the relative mobility of the polypeptide from transgenic seeds with the affinity purified recombinant enzyme (encoded by the corresponding portion of cDNA) and the endogenous C. hookeriana KAS on SDS gel electrophoresis provided further evidence as to the size of the mature polypeptide (section 3, Fig. 2). Amino acid sequence comparison of Ch KAS IV and Cpu KAS IV indicate that both polypeptides have a long transit peptide of 114 and 126 amino acids, respectively. Their putative mature regions are 98% identical to each other and with the corresponding region of a C. wrightii (U67317) polypeptide. The comparison also indicates that both Ch and Cpu KAS IV putative mature polypeptides are 85% identical to the putative KAS II amino acid sequences from Ricinus communis (L13241) and from barley (Z34269), and 60% identical to KAS I amino acid sequences from Ricinus communis (l13242) and barley (M60410). There is little homology between the deduced amino acid sequences of KAS IV and that of the spinach ( Tai & Jaworski 1993) or the Cuphea wrightii ( Slabaugh et al. 1995 ) KAS III. These data indicate that KAS IV amino acid sequences are different from the previously characterized classes of KASs, designated KAS I and III, but are similar to the putative KAS II amino acid sequences.

image

Figure 2. Western blot analyses of KAS IV from C. hookeriana, wild-type and transgenic Brassica seed extracts as well as the affinity purified recombinant Ch KAS IV mature protein.

Proteins were blotted onto nitrocellulose paper and probed with polyclonanl antibody directed to C. wrightii KAS A1, a homologue of KAS IV protein.

Download figure to PowerPoint

Kas4 is predominantly expressed in seeds

Northern blot analyses were carried out on total RNA isolated from seed, embryo, flower, root and leaf of C. hookeriana and C. pulcherrima. Loading of equal amounts of RNA from all tissues enabled us to compare directly the relative levels of Kas4 expression between the two species as well as between different tissues. The results of the Northern blot analyses indicate that the levels and the pattern of Kas4 expression in both Cuphea species are similar and therefore only the result of the Northern performed on C. hookerina is presented here ( Fig. 1). The results in Fig. 1 show that two strong hybridization signals of different sizes (2.3 and 1.7 Kb) and different abundances are detected only in seed and embryo tissues. The size of the cDNA clone corresponds to the larger message. The nature of the smaller hybridizing band, which is detected despite the high stringency conditions used throughout the procedure, has still to be determined. The results from subsequent hybridization of this blot with a constutitively expressed KAS I clone isolated from Cuphea hookeriana (K. Dehesh, unpublished results), verified that equal amounts of RNA were bound to the filter (data not shown). The amplified expression of Kas4 in the embryo could provide the condensing enzyme activity that, together with the corresponding hydrolytic enzyme, results in the accumulation of high levels of medium chain fatty acids in Cuphea seed oil.

image

Figure 1. Northern blot analyses of Kas4 mRNA levels in different tissues of C. hookeriana.

Analyses performed on total RNA (15 μg lane–1) prepared from developing seed, embryo, flower, leaf and root. Blots were hybridized with a 32P-labeled Ch Kas4 DNA fragment. The indicated size was estimated from molecular size markers.

Download figure to PowerPoint

Generation of transgenic plants and determination of acyl chain specificity of KAS IV

Transgenic Brassica plants, overexpressing Ch Kas4 alone or along with thioesterases of different chain length specificity, were generated to determine the acyl chain specificity of KAS IV. T2 seeds of 30 independent primary transformants overexpressing Kas4 alone were analyzed for total fatty acid composition. There were no detectable changes in the levels or profiles of the fatty acids of the transgenic seeds as compared to the wild-type (results not shown). Western blot analyses performed on proteins isolated from developing seeds revealed that the enzyme is detected only in transgenic and not wild-type seeds ( Fig. 2). A second band with an apparent mobility of 52 kDa also cross-reacts with the wild-type as well as transgenic Brassica seed protein extract. The detection of cross-reactive antigens other than KAS IV is not surprising since polyclonal antibodies were used in these studies. Despite the equal loading of proteins in all lanes, the KAS IV signal detected in some transgenic plants is severalfold higher than that observed in developing Cuphea seeds ( Fig. 2). Furthermore, the Ch KAS IV in transgenic seeds co-migrates with the native enzyme in Cuphea seeds as well as the affinity purified recombinant protein encoded by the mature portion of the cDNA. This suggests that the lack of phenotype in these transgenics is probably not due to the absence of a properly processed protein.

To examine the possible synergy between different TEs and the KAS IV, we either used a tandem binary construct containing both genes or crosses between a heterozygous transformant expressing high levels of KAS IV and homozygous lines expressing different TEs. Previously, we reported that overexpression of the Ch FatB2, a specific TE for 8:0/10:0-ACP in transgenic Brassica (4804) resulted in accumulation of high levels of 8:0 and 10:0 fatty acids in the seeds ( Dehesh et al. 1996b ). Homozygous 4804 lines were generated and crossed with a heterozygous line (5401–9-T1) overexpressing Ch KAS IV. The fatty acid composition of the segregating F1 seeds from this cross were analyzed. These results ( Fig. 3) show that the combined expression of Ch KAS IV and Ch FatB2 results in a 30–40% increase in the levels of medium chain fatty acids in these hemizygous transgenic seeds as compared with lines expressing Ch FatB2 alone. Similar results are obtained from co-expression of Ch Kas IV and Cp FatB1, a Cuphea palustris TE specific for 8:0-and 10:0-ACP. T2 seeds from a population of transgenic Brassica plants co-expressing the Cp FatB1 and the Ch Kas IV in a tandem construct (5413) contained on average 40% more 8:0 and 10:0 fatty acids than the population expressing the TE alone (results not shown). These data demonstrate that the presence of Ch KAS IV in addition to either Ch FatB2 or Cp FatB1 in the transgenic plants resulted in a substantial increase in total levels of medium chain fatty acids as compared to the levels accumulated in seeds expressing the TE alone.

image

Figure 3. Proportions of 8:0 and 10:0 fatty acids in transgenic Brassica seeds.

The F1 progenies were generated either by selfed 4804 lines (line overexpressing Ch FatB, a 8:0/10:0 specific TE), or its crosses with wild-type (4804 X WT) and with lines overexpressing Ch KAS IV (5401). The fatty acyl composition of half seeds were analyzed to determine the proportions of 8:0 and 10:0 (mol%).

Download figure to PowerPoint

With increasing proportions of medium chain fatty acids, there is a corresponding decline in the proportion of 18:2 and 18:3 fatty acyl groups, as was also observed in plants expressing either Ch FatB2 alone, or Cp FatB1 alone ( Dehesh et al. 1996b ; data not shown). Interestingly, co-ordinated expression of Ch KAS IV with either Ch FatB2 or Cp FatB1 also resulted in an alteration of the proportion of the 8:0 and 10:0 fatty acids relative to plants expressing TE alone. Plants over-expressing the Ch FatB2 alone accumulated 3–5 times more 10:0 than 8:0, whereas seeds expressing Cp FatB1 alone accumulated 3–4 times more 8:0 than 10:0 (result not shown). In the present experiment, co-expression of Ch KAS IV with either TE enzyme resulted in a dramatic increase in 10:0 and a decrease in 8:0 levels relative to each other. In some cases plants accumulated 20 times more 10:0 than 8:0 ( Fig. 4). These results demonstrate the impact of KAS IV on fatty acid composition of these transgenic seeds. The data imply that KAS IV increases the conversion of 8:0-ACP to 10:0-ACP and hence reduces the 8:0-ACP pool available for hydrolysis. Alternatively, the reduction in the relative levels of 8:0 could be explained by a phenomenon similar to that observed recently ( Eccleston & Ohlrogge 1998). These authors demonstrated that production of high relative levels (60 mol%) of 12:0 in transgenic seeds results in an induction of β-oxidation and the glyoxylate cycle pathway in developing tissue and hence loss of excess 12:0. It is possible that accumulation of other unusual fatty acids such as 8:0 and 10:0 also induces these or similar pathways. In this case, however, the induction of β-oxidation pathway would have to be triggered with much lower absolute levels of 8:0 than the values reported for 12:0. If this were to be true one may speculate that accumulation of low absolute levels of 8:0 in seeds co-expressing KAS IV and TE is due to preferential degradation of this fatty acid rather than the increase in 10:0-ACP pool size at the expense of 8:0-ACP.

image

Figure 4. Relative levels of 8:0 and 10:0 in transformants over-expressing Ch FatB1 either alone or concomitantly with Ch KAS IV.

The fatty acyl composition of half seeds from transformants, expressing Ch FatB1 alone (4804) or along with Ch KAS IV (4804 X 5401) were analyzed to determine the relative proportions of 8:0 and 10:0 fatty acids.

Download figure to PowerPoint

KAS IV also increases the levels of 12:0 fatty acids as demonstrated by its co-expression with Uc FatB1, a California bay (Umbellularia californica) 12:0 specific TE. The fatty acid composition from these plants ( Fig. 5a) shows that selfed homozygous dihaploid lines (LA86DH168) accumulate up to 52 mol% laurate in their seed oil. As expected, F1 progeny of crosses between LA86DH186 and wild-type resulted in a decrease in 12:0 levels. However, crosses between LA86DH186 and 5401–9 hemizygous lines led to an accumulation of up to 57 mol% 12:0 in the F1 seeds. Interestingly, levels of the 14:0 fatty acyl group in F1 seeds of LA86DH168 X WT or X Ch KAS IV crosses decreased to half the level detected in homozygous LA86DH168 lines ( Fig. 5b). A similar shift in the oil profile is observed in Arabidopsis seeds overexpressing a C. wrightii KAS (Cw KAS A1) along with a medium chain thioesterase ( Leonard et al. 1998 ). Furthermore, increases in the proportion of 12:0 fatty acid resulted in a substantial decline in the proportions of all the other long chain fatty acyl groups (16:0, 18:0, 18:2 and 18:3). These results imply that Ch KAS IV is a medium chain specific condensing enzyme.

image

Figure 5. Proportions of 12:0 fatty acid in transgenic Brassica seeds.

The F1 progenies were generated either by selfed LA86DH168 lines (homozygous dihaploid lines overexpressing a 12:0 specific TE), or its crosses with wild-type (X WT) and with lines overexpressing Ch KAS IV (X 5401). The fatty acyl composition of half seeds were analyzed to determine the proportion of 12:0 (mol%).

(a) Proportion of 12:0 (mol%).

(b) Relative proportions of 12:0 and 14:0 fatty acids in the transgenic seeds.

Further evidence in support of the chain length specificity of KAS IV was obtained by performing crosses between the 5401–9-T1 line and homozygous lines overexpressing Garm FatA1, an 18:1/18:0 specific TE cloned from Garcinia mangostana ( Hawkins & Kridl 1998). Data in Fig. 6 show that up to 24 mol% 18:0 is detected in the selfed homozygous seeds overexpressing Garm FatA1 (5266) alone. However, levels of 18:0 fatty acyl group in F1 seeds generated as the result of crosses between 5266 line with the wild-type or the Ch KAS IV plant (5401–9-T1) has dropped to almost half the levels detected in 5266 lines. Furthermore, the proportion of 16:0 in seeds generated from these crosses was similar to the levels detected in the non-transgenic seeds (results not shown). These results in combination with the decline in the levels of 14:0 in seeds obtained from the LA86DH168 line crossed to 5401–9-T1 plants suggest that Ch KAS IV has no impact on pool size for longer chain fatty acids.

image

Figure 6. Proportions of 18:0 fatty acid in transgenic Brassica seeds.

The F1 progenies were generated either by selfed 5266 lines (homozygous line overexpressing 18:0/18:1 specific TE), or its crosses with the wild-type (X WT) and with lines overexpressing Ch KAS IV (X 5401). The fatty acyl composition of half seeds were analyzed to determine the proportion of 18:0 (mol%).

Download figure to PowerPoint

Ch KAS IV augments 6:0-extending activity in vitro

The expression of Ch KAS IV by itself had no detectable impact on the content and composition of fatty acids in the transgenic seeds and yet there was a substantial increase in medium chain fatty acids when expressed together with medium chain thioesterases. We therefore sought biochemical evidence for the role of Ch KAS IV in the fatty acid extension assay. Fatty acid biosynthesis was measured in developing seed extracts from wild-type or transgenic Brassica overexpressing KAS IV (5401–9) presented with [1–14C]acetyl-CoA and malonyl-ACP, generated in situ from malonyl-CoA and exogenously supplied spinach ACP. Where indicated, reactions were treated with the KAS inhibitor, cerulenin ( Fig. 7). The fatty acid synthesis capabilities of transgenic Brassica seed extracts (5401–9) was greater than that observed in the wild-type seed extract as measured by the relative abundance of 8:0-and 10:0-ACP at all time points. As expected, treatment of the extract with cerulenin markedly reduced synthesis of longer chain fatty acids in both wild-type and 5401 lines. The extension of 6:0-ACP was, however, much less inhibited in the 5401 extract than the wild-type extracts. As determined by quantitation of radioactivity in acyl-ACP bands, the Ch KAS IV containing extract extended 6:0-ACP 2.5 and 10-fold more efficiently than the wild-type in samples pretreated with 10 and 100 μm cerulenin, respectively. Similar data were obtained using transgenic seed extract from wild-type or transgenic Arabidopsis seeds overexpressing a C. wrightti KAS (Cw KAS A1) enzyme ( Leonard et al. 1998 ). These data, together with our findings, support the conclusion that Ch KAS IV is a condensing enzyme active on medium chain acyl-ACPs, and that overexpression of this enzyme results in enlarged substrate pools to be hydrolyzed by medium chain specific thioesterses. Furthermore, these data show that the Brassica wild-type extract also has cerulenin-resistant condensing activity, which suggests that KAS IV activity may be present in all plants. It is predicted that a KAS IV type activity responsible for production of the 8:0 precursors of lipoic acid may be present in the plant mitochondria ( Siggaard-Andersen et al. 1994 ).

image

Figure 7. The in vitro synthesis of acyl-ACPs from [1–14C]acetyl-CoA and malonyl-ACP.

Extract prepared from developing seeds of wild-type Brassica or transgenic Brassica seeds overexpressing Ch KAS IV (5401) were pretreated with the indicated concentrations of cerulenin. For each time point, a 20 μl aliquot was TCA precipitated and analyzed on an acrylamide/2.25 m urea gel. 12:0–18:0 fatty acids co-migrated and are contained in the band labeled as 12:0+-ACP.

Download figure to PowerPoint

The study of transgenic plants has provided us with a body of evidence suggesting that Ch KAS IV is a plastid localized enzyme, specific for 6:0–10:0 acyl chains, that, only in synergy with a medium chain specific TE, is capable of producing very high levels of medium chain fatty acids.

Medium chain fatty acids are important constituents of many industrial, nutritional and pharmaceutical products, and are minor components of tropical oils, which are presently the main source of these compounds. Our results suggest that KAS IV is another key enzyme determining the levels and composition of medium chain fatty acids in seed oil, thus providing the opportunity to produce economically viable levels of these compounds which in turn will greatly expand their applications.

Experimental procedures

  1. Top of page
  2. Summary
  3. Introduction
  4. Results and discussion
  5. Experimental procedures
  6. Acknowledgements
  7. References.

Plant material

Cuphea hookeriana and pulcherrima plants were propagated from seeds obtained from the U.S. Department of Agriculture (Ames, IA, USA) and the laboratory of Dr Steve Knapp, Oregon State University, respectively. Plants were grown under similar conditions as described previously ( Dehesh et al. 1996b ). Tissues for RNA isolation were frozen in liquid nitrogen and kept at –70°C.

RNA isolation and cDNA library construction

Total cellular RNA was isolated from C. hookeriana and C. pulcherrima developing seeds as described previously ( Dehesh et al. 1996a ) and used in a commercial kit to prepare cDNA libraries (λZip-Lox, Gibco-BRL). Approximately 500 000 unamplified recombinant phage were plated and the plaques were transferred onto nitrocellulose. Filters were prehybridized, hybridized and washed as reported previously ( Dehesh et al. 1996a ). The mature portion of castor cDNA clone (L13241), encoding the presumptive KAS II class of enzymes, was amplified in a standard PCR reaction using synthetic oligonucleotide primers (castor 5′, GGTACCATGGCAGTGGCTGTGCAACCT; castor 3′, GTCGACGAAGTACCCTTATTTCACTT) and subsequently used as the probe for cloning of Cuphea Kas4.

DNA sequencing and sequence analysis

The cDNAs were sequenced completely in both directions using an automated ABI 373 A sequencer (Applied Biosystem). DNA and deduced protein sequence analyses were carried out using the program of Intelligenetics, Version 5.3 (Intelligentics, Inc., Mountain View, CA, USA).

Northern blot analysis

Northern blot analyses were performed as previously reported ( Dehesh et al. 1996a ), using total RNA isolated from developing seed, embryo, root, flower and leaf tissues. Blots were prehybridized and hybridized under identical conditions to those used in library screening. The mature protein encoding portions of C. hookeriana or C. pulcherrima Kas4 was used as the hybridizing probe. The mature regions of both clones were amplified in a standard PCR reaction using the synthetic oligonucleotide primers representing the 5′ end sequence (Cpu Kas4, GCGGCCGCGCATGCTCCGCTCCCAAGCG;Ch Kas 4, GGTACCAAGAAACCTGCTACCAAGCAA) and 3′ end sequence (Cpu Kas4, GCGGCCGCAAGC- TTAAATGGGTAATCATGGC;Ch Kas4, GTCGACCCACAGACTCTTTTCTAGTTG). Blots were washed for 1 h at 55°C in 0.1× wash solution (high stringency conditions). Autoradiography was performed at –70°C with an intensifying screen.

Construction of binary vectors and plant transformation

cDNAs used for production of transgenic Brassica were cloned into the seed specific expression cassette (pCGN 3223), driven by a napin gene promoter ( Kridl et al. 1991 ). In order to clone Cp FatB1, an 8:0 and 10:0 specific TE ( Dehesh et al. 1996a ), into the 3223 expression cassette, a PCR fragment using the following oligonucleotide was generated:

CpFatB1 5′: ATCTAGAGTCGACAACAATG, CpFatB1 3′: GAATTCAGATCTCTAAGAGA. This fragment was then digested with SalI and BglII and inserted into the respective sites of the 3223 expression vector. The new construct (pCGN 4494) was then digested with KpnI and the resulting fragment was cloned into the KpnI site of the plant binary vector pCGN 1558 ( McBride & Summerfelt 1990) producing pCGN 5400. Cloning of Ch Kas4 into the plant binary vector was achieved by producing a PCR fragment using the following oligonucleotides: Ch Kas4 5′: AGCGGCCGCGTCGACAACAA and Ch Kas4 3′: TCTAGAAGATCTCTAGTTGC. This fragment was then digested with SalI and BglII and inserted in the respective sites of 3223 resulting in construction of the clone designated as pCGN 4495. The KpnI fragment of pCGN 4495 was isolated and inserted into the binary vector pCGN 1558 either as a single fragment (pCGN 5401) or in tandem with pCGN 4494 producing the clone designated as pCGN 5413. All binary constructs were used to transform Brassica napus cultivar Quantum ( Radke et al. 1988 ). For each construct, a total of 30 independent plants were generated and grown in a greenhouse. Pools of mature seeds derived from each of the primary transformants (T2 seeds) were analyzed for fatty acid composition.

Generation of plants co-expressing Ch Kas4 with different thioesterases

F1 populations were generated by crossing 5401–9-T1, a transformant overexpressing Ch Kas4 at high levels, with homozygous lines overexpressing Ch FatB2, an 8:0/10:0 TE ( Dehesh et al. 1996b ), Uc FatB1, a 12:0 TE ( Voelker et al. 1992 ) and GarmFatA1, an 18:1/18:0 TE ( Hawkins & Kridl 1998). Based on segregation of kanamycin resistance 5401–9 has three transgenic loci. All the parent lines overexpressing TEs were homozygous, and lines with 12:0 TE (LA86DH186) were dihaploids derived from microspores ( Voelker et al. 1996 ). In addition to the TE X KAS crosses, TE parents were also selfed or crossed with the wild-type Brassica as controls. Seeds generated from all crosses were used for half seed analyses.

Triglyceride analyses of half seeds

Single seeds were germinated for 24 h on a wet filter paper. Upon the removal of the seed coat, the outer cotyledons were excised and used for triglyceride analyses and the inner cotyledon with the embryonic axes attached were grown in soil. The quantities and composition of triglyceride fractions from reverse-phase HPLC were determined by acidic methanolysis and capillary GC of the resulting fatty acid methyl esters essentially according to the method of Browse and co-workers ( Browse et al. 1986 ). Tri-17:0 triglyceride was included as an internal standard.

Immunoblot analysis

Immunoblot analyses were performed on developing seeds using the basic procedure of Towbin et al. (1979) . Preparation of total protein extracts followed by immunoblot analysis using polyclonal antiserum raised against Cuphea wrightii KAS protein ( Slabaugh et al. 1998 ), a KAS IV homologue, and alkaline phosphatase labeled secondary antibody, were carried out according to Dehesh et al. (1992) . Protein extracts were separated electrophoretically on a 12% polyacrylamide SDS gel.

Fatty acid synthesis assays

Extracts were prepared from developing Brassica seeds as described ( Leonard et al. 1998 ;Slabaugh et al. 1998 ) and in vitro fatty acid synthesis assays were performed and analyzed as previously described ( Post-Beittenmiller et al. 1991 ). Extracts were concentrated by ammonium sulfate precipitation and desalted using P-6 spin columns (Bio-Rad, Hercules, CA, USA). Reactions (65 μl) contained 0.1 m Tris/HCl (pH 8.0), 1 m m dithiothreitol, 25 m m recombinant spinach ACP1, 1 m m NADH, 2 m m NADPH, 50 μm malonyl-CoA, 10 μm [1–14C]acetyl-CoA (50 mCi mmol–1), 1 mg ml–1 BSA, and 0.25 mg ml–1 seed protein. Where indicated, seed extracts were pre-incubated with cerulenin at 23°C for 10 min. Reaction products were separated on 18% acrylamide gel containing 2.25 m urea, electroblotted onto nitrocellulose and quantitated by phosphorimaging using Image QuaNT software (Molecular Dynamics, Sunnyvale, CA, USA). Authentic acyl-ACPs were run in parallel, immunoblotted and finally detected by anti-ACP serum to confirm fatty acid chain lengths.

Acknowledgements

  1. Top of page
  2. Summary
  3. Introduction
  4. Results and discussion
  5. Experimental procedures
  6. Acknowledgements
  7. References.

We are grateful to Dr S. Knapp, Oregon State University, for providing us with the C. pulcherrima seeds. We would like to thank N. Wagner, T. Hayes, T.Hickman, J. Turner, K. Williams, B. Reed, and J. Lee for their support and assistance in performing Western blot analyses, oil analyses, plant transformation and greenhouse care. We would like to extend our thanks to G. Thompson, J. Metz, V. Knauf and L. Yuan for commenting on the manuscript.

References.

  1. Top of page
  2. Summary
  3. Introduction
  4. Results and discussion
  5. Experimental procedures
  6. Acknowledgements
  7. References.
  • Browse, J., McCourt, P.J., Somerville, C.R. 1986 Fatty acid composition of leaf lipids determined after combined digestion and fatty acid methyl ester formation from fresh tissue. Anal. Biochem., 152, 141 152.
  • Clough, R.C., Mattis, A.L., Barnum, S.R., Jaworski, J.G. 1992 Purification and characterization of β-ketoacyl- acyl carrier protein synthase III from spinach. J. Biol. Chem., 267, 20992 20998.
  • Dehesh, K., Edwards, P., Hayes, T., Cranmer, A.M., Fillatti, J. 1996a Two novel thioesterases are key determinants of the bimodal distribution of acyl chain length in Cuphea palustris seed oil. Plant Physiol., 110, 203 210.
  • Dehesh, K., Hung, H., Tepperman, J.M., Quail, P.H. 1992 GT-2: a transcription factor with twin autonomous DNA-binding domains of closely related but different target sequence specificity. Embo. J., 11, 4131 4144.
  • Dehesh, K., Jones, A., Knutzon, D.S., Voelker, T.A. 1996b Production of high levels of 8: 0 and 10, 0 fatty acids in transgenic canola by overexpression of Ch FatB2, a thioesterase cDNA from Cuphea hookeriana. Plant J. 9, 167–172.
  • Eccleston, V.S. & Ohlrogge, J.B. 1998 Expression of lauroyl-acyl carrier protein thioesterase in Brassica napus seeds induces pathways for both fatty acid oxidation and biosynthesis and implies a set point for triacylglycerol. accumulation. Plant Cell., 10, 613 622.
  • Fuhrman, J. & Heise, K.P. 1993 Factors controlling medium-chain fatty acid synthesis in plastids from maturing Cuphea embryos. Z. Naturforsch., 48C, 616 622.
  • Genez, A., McCarter, D., Nelsen, J., Bleibaum, J., Thompson, G.A., Knauf, V.C., Stalker, D. 1991 Cloning and molecular characteization of β-ketoacyl ACP synthase cDNAs from endosperm of Ricinus communis. Abstract, presented at the Third International Congress on Plant and Molecular Biol. Tucson, AZ.
  • Hardwood, J.L. 1988 Fatty acid metabolism. Annu. Rev. Plant Physiol. Plant Mol. Biol., 39, 101 138.
  • Hawkins, D.J. & Kridl, J.C. 1998 Characterization of acyl-ACP thioesterases of mangosteen (Garcinia mangostana) seed and high levels of stearate production in transgenic canola. Plant J., 13, 743 752.
  • Jackowski, S., Murphy, C.M., Cronan, J.E., Rock, C.O. 1987 Acetoacetyl-acyl carrier protein synthase, a target for the antibiotic thiolactomycin. J. Biol. Chem., 264, 7624 7629.
  • Jaworski, J.G., Clough, R., Barnum, S.R. 1989 A cerulenin insensetive short chain β-ketoacyl- acyl carrier protein synthase from Spinacia oleracea leaves. Plant Physiol., 90, 41 44.
  • Kauppinen, S.K. 1992 Structure and expression of the Kas12 gene encoding a β-ketoacyl- acyl carrier protein synthase I isozyme from barley. J. Biol. Chem., 267, 23999 24006.
  • Kridl, J.C., McCarter, D.W., Rose, R.E., Scherer, D.E., Knutzon, D.S., Radke, S.E., Knauf, V.C. 1991 Isolation and characterization of an expressed napin gene from Brassica rapa. Seed Sci. Res., 1, 209 219.
  • Leonard, J.M., Knapp, S.J., Slabaugh, M.B. 1998 A Cupheaβ-ketoacyl- ACP synthase shifts the synthesis of fatty acids towards shorter chains in Arabidopsis seeds expressing Cuphea FatB thioesterases. Plant J., 13, 621 628.
  • McBride, K. & Summerfelt, K.R. 1990 Improved binary vectors for Agrobacterium-mediated plant transformation. Plant Mol. Biol., 14, 269 276.
  • Post-Beittenmiller, D., Jaworski, J., Ohlrogge, J. 1991 In vivo pools of free and acylated acyl carrier proteins in spinach. J. Biol. Chem., 266, 1858 1865.
  • Radke, S.E., Andrews, B.M., Moloney, M.M., Crouch, M.L., Kridl, J.C., Knauf, V.C. 1988 Transformation of Brassica napus L. using Agrobacterium tumefaciens: Developmentally regulated expression of a reintroduced napin gene. Theor. Appl. Genet., 75, 685 694.
  • Shimakata, T. & Stumpf, P.K. 1982 Isolation and function of spinach leaf β-ketoacyl-[acyl carrier protein] synthases. Proceedings Natl Acad. Sci. USA., 79, 5808.
  • Siggaard-Andersen, M., Wissenbach, M., Chuck, J.A., Svendsen, I.B., Olsen, J.G., Von Wettstein-Knowles, P. 1994 The fabJ-encoded β-ketoacyl-[acyl carrier protein] synthase IV from Escherichia coli is sensetive to cerulenin and specific for short-chain substrates. Proceedings Natl Acad. Sci. USA., 91, 11027 11031.
  • Slabaugh, M.B., Leonard, J.M., Knapp, S.J. 1998 Condensing enzymes from Cuphea wrightii associated with medium chain fatty acid biosynthesis. Plant J., 13, 611 620.
  • Slabaugh, M.B., Tai, H., Jaworski, J., Knapp, S. 1995 cDNA clones encoding β-ketoacyl-acyl carrier protein synthase III from Cuphea wrightii. Plant Physiol., 108, 443 444.
  • Tai, H. & Jaworski, J.G. 1993 β-ketoacyl-acyl carrier protein synthase III from spinach (Spinacia oleracea) is not similar to other condensing enzymes of fatty acid synthesis. Plant Physiol., 103, 1361 1367.
  • Towbin, H., Staehelin, T., Gordon, J. 1979 Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications. Proceedings Natl Acad. Sci. USA, 76, 4350 4354.
  • Tsay, J.T., Oh, W., Larson, T.J., Jackowski, S., Rock, C.O. 1992 Isolation and characterization of the β-ketoacyl-acyl carrier protein synthase III gene (fabH) from Escherichia coli K-12. J. Biol. Chem., 267, 6807 6814.
  • Voelker, T.V. 1996 Plant acyl-ACP thiesterases: chain-length determining enzymes in plant fatty acid biosynthesis. In: Genetic Engineering Volume 18 (Setlow, J.K., Ed.). NY: Plenum Press, pp. 111 131.
  • Voelker, T.A., Hayes, T.R., Cranmer, A.M., Turner, J.C., Davies, H.M. 1996 Genetic engineering of a quantitative trait: metabolic and genetic parameters influencing the accumulation of laurate in rapeseed. Plant J., 9, 229 241.
  • Voelker, T.A., Worrell, A.C., Anderson, L., Bleibaum, J., Fan, C., Hawkins, D.H., Radke, S.E., Davies, H.M. 1992 Fatty acid biosynthesis redirected to medium chains in transgenic oilseed plants. Science, 257, 72 74.
  • Walsh, M.C., Klpfenstein, W.E., Hardwood, J.L. 1990 The short chain condensing enzyme has a widespread occurrence in the fatty acid synthetases from higher plants. Phytochemistry, 29, 3797 3799.

GenBank accession numbers AF060518 (Cpu Kas4) and AF060519 (Ch Kas4).