SEARCH

SEARCH BY CITATION

Keywords:

  • TGA transcription factors;
  • trans-dominant negative mutant;
  • systemic acquired resistance;
  • salicylic acid;
  • stress responses;
  • GSTs

Summary

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

Salicylic acid (SA) is a key regulator for the induction of systemic acquired resistance (SAR), and NPR1 is a critical mediator for the biological effects of SA. Physical interactions between NPR1 and TGA factors, a conserved family of basic-leucine-zipper (bZip) proteins in plants, have suggested a role for these transcription factors in mediating SAR induction via the regulation of defense genes. To elucidate this function, we constructed a trans-dominant mutant that specifically eliminates DNA-binding activities of this class of bZip proteins in transgenic tobacco plants. Our results demonstrate that the loss of TGA DNA-binding activities is correlated with suppression of two xenobiotic-responsive genes, GNT35 and STR246, and enhanced induction of pathogenesis-related (PR) genes by SA. In addition, these TGA-suppressed plants exhibited higher levels of PR gene induction by pathogen challenge and an enhanced SAR. These results suggest that TGA transcription factors serve both negative and positive regulatory roles in mediating plant defense responses.


Introduction

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

Systemic acquired resistance (SAR) is a general plant defense response that can be triggered after infection by necrotizing pathogens. Salicylic acid (SA) has been found to be a necessary and sufficient signal in SAR establishment, and the induction of this broad-range resistance is correlated with the activation of pathogenesis-related (PR) genes. One key player in this poorly understood pathway is the NPR1/NIM1/SAI1 gene (subsequently designated here as NPR1), identified through genetic screens as a mediator of SA- and pathogen-induced expression of PR genes as well as activation of SAR (Cao et al., 1997; Ryals et al., 1997; Shah et al., 1997). Recent studies based on the two-hybrid system and in vitro experiments have revealed physical interactions between tomato and Arabidopsis NPR1, and a conserved family of plant bZip proteins called TGA factors (Desprès et al., 2000; Zhang et al., 1999; Zhou et al., 2000). TGA factors were among the earliest transcription factors characterized in higher plants (Lam et al., 1989). cDNAs encoding these proteins were first isolated by South western screening techniques, using as probes TGACG motif-containing cis-elements that are related to the activating sequence-1 (as-1) site located at the −90 region of the 35S promoter from cauliflower mosaic virus (CaMV) (Katagiri et al., 1989). Using antisera specific for several TGA factors of Arabidopsis (Lam and Lam, 1995), supershift gel-retardation assays showed that these proteins probably contribute to activating sequence factor-1 (ASF-1) activity, first described as plant nuclear factors that bind specifically to the as-1 related elements (Lam et al., 1989). Although NPR1 does not appear to bind DNA, its interaction with a TGA factor in vitro was reported to increase the latter's DNA-binding activity in crude reticulocyte lysates (Desprès et al., 2000). This observation suggests that TGA factors may mediate at least some of the functions that are dependent on NPR1, and play a significant role in PR gene activation in response to SA treatment and pathogen infection. This hypothesis is reinforced by studies of the TGA target sequence as-1 and its related cis-elements that implicate TGA factors as mediators of plant responses to phytohormones such as auxins, SA and methyl jasmonate (MJ) (Xiang et al., 1996 and references therein). In addition, it is consistent with the demonstration that PR1 genes from Arabidopsis and tobacco indeed contain an as-1-related element in a region of their promoter involved in SA-activation (Lebel et al., 1998; Strompen et al., 1998). However, the SA-specific induction of PR1 genes suggests that the as-1-related elements found in their promoters are functioning in a more complex manner than providing a simple positive switch, as auxins and MJ do not activate PR1 expression.

Gaining direct evidence for the involvement of TGA factors in defense responses is complicated by the fact that they constitute a large multigene family comprising 10 members in Arabidopsis based on genome sequence analyses. cDNAs for seven members have been cloned and characterized in Arabidopsis, and four in tobacco (Chuang et al., 1999; Niggeweg et al., 2000b; Xiang et al., 1997). They share a high degree of sequence similarity (70–90% identities), mostly in the DNA-binding domain and in the leucine zipper implicated in homo- or heterodimerization. However, they appear to differ significantly in their activation potential, NPR1 affinity, DNA binding and heterodimerization preferences (Lam and Lam, 1995; Niggeweg et al., 2000b; Zhou et al., 2000). Nevertheless, given the ability of these different TGA factors to bind the same recognition site in vitro, and the high degree of sequence similarity among them, it is likely that at least some of these factors may serve redundant functions.

As a first step to test for the involvement of TGA factors in SAR induction, we wanted to determine the effects that removing all TGA activity may have on PR gene activation and SAR induction. In order to functionally ‘knock-out’ the activity of this whole family of factors, we used a trans-dominant negative mutant approach. This is particularly suitable for factors existing as dimers, as heterodimerization between a mutant defective in DNA binding and a wild-type partner is predicted to produce an inactive dimer (Fukasawa et al., 2000; Ransone et al., 1990). We designed and constructed a dominant negative mutant and expressed it in transgenic plants. These plants appeared to lack detectable ASF-1 gel mobility-shift activity, and chemical induction of two of the putative target genes for TGA factors was severely repressed. In contrast, SAR was apparently enhanced and PR genes were induced at higher levels by SA in those plants. In the light of these results, current models for the role of TGA factors in the induction of disease resistance will be discussed.

Results

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

Construction of a dominant negative mutant form of TGA2 and introduction into transgenic tobacco plants

The feasibility of a dominant negative mutant strategy to suppress ASF-1 activity has been shown previously by the construction of deletion mutants derived from the tobacco TGA1a and potato PG13 proteins (Miao and Lam, 1995; Rieping et al., 1994). The co-expression of one of these mutants with TGA factors could inhibit their DNA-binding activity in vitro, but the suppression of ASF-1 activity in extracts from transgenic plants was not complete (Miao and Lam, 1995). Several possibilities may explain why these deletion mutants were not able completely to suppress the DNA-binding activity that is thought to consist of the TGA factors: (i) there may be additional DNA-binding proteins distinct from TGA factors that contribute to ASF-1 activity; (ii) TGA1a may be a poor dimerization partner for some of the TGA factors; and (iii) the deletion of the basic domain in TGA1a and its homolog PG13 may suppress their nuclear localization (van der Krool and Chua, 1991). Arabidopsis TGA2 (also known as AHBP-1b) was found to represent 33–50% of the ASF-1 activity in root and leaf extracts of mature plants (Lam and Lam, 1995), whereas no evidence was observed for stable expression of functional TGA1 or TGA3. Since the transcripts for all six TGA factors were readily detected in these tissues, these results suggest that post-transcriptional control probably regulates the abundance of different TGA factors. The results from our immunological studies thus indicate that TGA2 should be a good candidate for the construction of an efficient trans-dominant suppressor.

To create a mutant TGA2 that is defective in DNA-binding activity, but with minimal perturbation of protein–protein interactions or nuclear localization potential, we chose to introduce point mutations into two key amino acid residues of the basic region that are conserved among most of the known bZip proteins and are known to be crucial for DNA-binding activity (Figure 1a). We engineered lysines into these positions to ensure suppression of any DNA-binding activity without reducing the positive charge of the basic domain that may be important for nuclear localization. We also inserted an EVD tripeptide between the basic domain and leucine zipper of TGA2. The addition of this short linker should disrupt the scissors-grip structure of the bZip factor by introducing a kink between the DNA-binding domain and the leucine zipper (Pu and Struhl, 1991). When expressed in vitro, this TGA2 mutant protein, designated T2m, is not able to bind to the as-1 element (Figure 1b, left lane). When co-expressed with TGA2 in vitro, it works efficiently as a trans-dominant suppressor of DNA-binding activity in a dose-dependent manner (Figure 1b). Similar results were obtained with other TGA factors such as TGA1, TGA3 and TGA5 from Arabidopsis (Figure 1c), which are representative of the three subclasses of TGA factors based on homology considerations (Xiang et al., 1997).

image

Figure 1. Construction and characterization of a TGA2-based dominant negative mutant: TGA2m (T2m).

(a) Two non-basic amino acid residues highly conserved in the basic region of TGA bZip factors were mutated (N54K, E56Q). A third mutation was introduced in order to create a restriction site that would facilitate further cloning (R62K). Then an EVD tripeptide-coding sequence was inserted in order to create a kink between the basic domain and the leucine zipper whose first leucine is indicated by an asterisk.

(b) TGA2 and TGA2m proteins were co-expressed in rabbit reticulocyte lysates and used for gel mobility-shift assay using a 32P-labeled as-1 element as a probe or for SDS–PAGE analysis followed by autoradiography in order to visualize the 35S-methionine labeled proteins (bottom panel). Lanes 3–6 contained increasing amounts of TGA2m plasmid relative to that of TGA2 (1 : 1, 2 : 1, 5 : 1, 10 : 1) with the amount for that of TGA2 held constant.

(c) Expression plasmids for TGA1, TGA3 and TGA5 were used in the coupled transcription/translation system in the absence (–) or presence (+) of the TGA2m expression plasmid, added at 10-fold excess. Each extract was examined in a gel mobility-shift assay using a 32P-labeled as-1 element as a probe.

Download figure to PowerPoint

To test its in vivo effects, we overexpressed T2m in tobacco as an N-terminal fusion with the enhanced yellow fluorescent protein (EYFP, Clontech, Palo Alto, CA, USA) driven by the CaMV 35S promoter. Fusion of EYFP to either the N-terminus or C-terminus of TGA factors does not significantly affect their dimerization or DNA-binding activities in vitro (data not shown), while the presence of the EYFP tag should allow simple detection of the fusion protein in transgenic tissues. Fusion with EYFP also does not affect the interaction between TGA1, TGA2 or TGA3 factors with the NPR1 protein using a yeast two-hybrid assay system (Y. Trifa and D. Klessig, personal communication). Among 16 transgenic tobacco plants transformed with the EYFP-T2m construct, two were found to express the fusion protein at high levels, as confirmed by Western blotting using an anti-GFP antibody (data not shown). When grown on soil, these plants do not display any obvious morphological phenotypes and are as fertile as wild-type tobacco. When examined by fluorescence microscopy, the EYFP-T2m fusion protein is localized mostly in nuclei which is consistent with the localization of wild-type TGA factors (data not shown).

In order to test the effect of T2m overexpression on TGA factors in vivo, as-1 binding activity was compared between whole cell extracts prepared from wild-type or EYFP-T2m-expressing transgenic plants (Figure 2, left panel). A complex corresponding to ASF-1 is present in wild-type extracts and is competed by cold as-1 tetramer but not by a mutated as-1 tetramer called as-3 (Katagiri et al., 1989; Lam et al., 1989; Liu and Lam, 1994). In contrast, no ASF-1 activity is detected with EYFP-T2m extracts, despite the use of a larger quantity of proteins in the gel-shift assay (see the corresponding Coomassie blue-stained gel shown in Figure 2, right panel). The capacity of this extract to give a complex when using a G-box as a probe (Figure 2, middle panel) shows the comparable quality of the extracts and the specificity of action of EYFP-T2m expression on TGA factors. As the G-box is known to be recognized by a subfamily of plant bZip factors distinct from the TGA proteins (Williams et al., 1992), these results demonstrate that expression of the T2m mutant protein can dramatically reduce the DNA-binding activities for one subclass of bZIP transcription factors in transgenic tobacco. They also indicate that the majority, if not all, of the ASF-1 activity in plant extracts is probably composed of dimeric TGA factors, and that the majority of ASF-1 activity is dispensable for housekeeping functions during plant development.

image

Figure 2. Effect of the expression of EYFP-T2m on as-1-binding activity in plant extracts.

Total cellular proteins were extracted from leaves of a wild-type or a transgenic tobacco plant expressing the fusion protein EYFP-T2m. Around 40 µg protein per sample was used in gel mobility-shift assay using a 32P-labeled as-1 element (left panel) or a G-box element (middle panel) as a probe, or for SDS–PAGE analysis followed by Coomassie blue staining (right panel). The specificity of binding is demonstrated by the addition of competitor DNA at 40-fold excess which is, respectively, an as-1 tetramer (as-1), a tetramer of a mutant as-1 element (as-3), or the G-box element (G).

Download figure to PowerPoint

The expression of two GSTs is affected by the dominant negative mutant

In order to analyze the effects that drastic suppression of ASF-1 activity may have in planta, we first examined the behavior of two genes: GNT35 and STR246 (Droog et al., 1993; Gough et al., 1995). These genes encode glutathione-S-transferases (GSTs) and contain as-1-like elements in their promoters that are probably involved in their induction by auxins, SA and MJ (Droog et al., 1995; Gough et al., 1995; Liu and Lam, 1994; Sakai et al., 1998; Xiang et al., 1996). Thus they represent good candidates as activation targets for TGA factors, and are predicted to be affected by the expression of T2m. Induction of GNT35 and STR246 expression was compared between leaf discs from wild-type and EYFP-T2m transgenic plants after treatment with auxin, SA or MJ (Figure 3). The strong activation of GNT35 after auxin or MJ treatment of leaf discs was almost completely abolished by EYFP-T2m expression, as was the rapid and transient induction by SA. Induction of STR246 by these treatments is also significantly lower in EYFP-T2m-expressing plant tissues, especially the rapid induction time point at 3 h post-treatment, although suppression by EYFP-T2m expression was less dramatic at the 9 h time point. This observation suggests the existence of other hormone-responsive elements in the STR246 promoter in addition to the as-1-like element (Gough et al., 1995). Together, these data indicate that GNT35 and, to a lesser extent STR246, are target genes for TGA factors in their activation by certain phytohormones and xenobiotics. They also provide evidence for the efficacy of the T2m transgene as a trans-dominant suppressor of TGA functions in vivo.

image

Figure 3. Gene expression in EYFP-T2m-expressing tobacco plants following hormone treatment.

10 mm leaf disks from wild-type or EYFP-T2m transgenic tobacco plants were floated on incubation buffer (20 mm Hepes–NaOH pH 7.0, 0.1% Tween 20) containing 0.1% dimethyl sulfoxide (Buffer control lanes), 0.1 mm 2,4 dichloro-phenoxyacetic acid (Aux), 1 mm methyl jasmonate (MJ) or 1 mm salicylic acid (SA). All three hormones were prepared in DMSO and diluted at their final concentration corresponding to 0.1% DMSO. Four leaf disks were harvested after 0, 3, 9 or 24 h and total RNA was extracted. 20 µg RNA was separated on an agarose gel and hybridized with GNT35, STR246 and 18S probes, as indicated on the left.

Download figure to PowerPoint

Expression of the TGA2 dominant negative mutant enhanced the induction of PR genes by SA

To test if TGA factors function as positive mediators for SA-dependent induction of PR gene expression, we studied the expression of PR1, PR2 and PR3 in wild-type and EYFP-T2m transgenic tobacco leaf discs after treatment with SA. Surprisingly, Northern blots (Figure 4) revealed that all three PR genes tested are twofold (for PR1) to sixfold (for PR3) more induced in response to SA treatment of transgenic plants compared to wild-type tobacco, while their kinetics of induction are quite similar. No induction of PR genes was observed after auxin treatment in either wild-type or transgenic plants (data not shown). These results suggest that the promoters of GSTs and PRs differ in their dependence on TGA factors as transcriptional regulators. Furthermore, the increase in SA-induced PR gene expression when ASF-1 activity has been largely suppressed suggests that these transcription factors can exert a negative effect on the induction of PR genes.

image

Figure 4. Expression of PR genes in EYFP-T2m-expressing tobacco plants following SA treatment.

10 mm leaf disks from wild-type or EYFP-T2m transgenic tobacco plants were floated on incubation buffer (20 mm Hepes–NaOH pH 7.0, 0.1% Tween 20) containing 0.1% DMSO (Buffer) or 1 mm SA prepared in DMSO. Four leaf disks were harvested after 0, 3, 9 or 24 h and total RNA was extracted. 20 µg RNA was separated on an agarose gel and hybridized with PR1, PR2, PR3 and 18S probes, as indicated on the left.

Download figure to PowerPoint

SAR is enhanced in TGA-suppressed tobacco plants

As induction of PR expression is often associated with the induction of SAR, one prediction following the negative-function model for TGA factors is that their suppression should not affect the establishment of resistance to pathogens, and could even enhance it. To test this prediction, we compared the establishment of SAR in wild-type tobacco with EYFP-T2m-expressing transgenic plants that are devoid of any detectable ASF-1 activity. To assay for SAR, plants were first challenged on their bottom leaves with water (M, mock samples) or tobacco mosaic virus (TMV) (T, TMV samples) to induce SAR. One week later, upper leaves were challenged with Pseudomonas syringae pv. tabaci and the bacterial population was scored 2 days later (Figure 5a). The EYFP-T2m transgenic plants exhibited a resistance level that is significantly higher than that observed for the wild type, showing that the absence of ASF-1 activity does not impair the establishment of SAR, and actually enhances resistance. Northern blot analysis was performed on leaf tissue samples just before the bacterial challenge (time 0; Figure 5b), which is at 8 days after the TMV primary challenge, as well as from tissues isolated 2 days after the bacteria inoculation. Consistent with results obtained with direct SA treatments (Figure 4), we observed higher levels of systemic PR induction in the transgenic plants (compare 0 days, TMV-treated lanes) which correlated with an increase in resistance. This result further supports the hypothesis that the TGA factors have a repressor function in the pathway for PR induction, and suppression of TGA factors results in the enhancement of PR expression on pathogen challenge. No activation was detected for either GNT35 or STR246 in distal leaves in which SAR is taking place, whereas after local bacterial challenge, these genes are activated in both mock and TMV-treated (SAR induced) wild-type plants. In contrast, in the EYFP-T2m transgenic plants GNT35 and STR246 were induced only in the mock-treated plants and not in plant tissues with SAR. This unexpected result indicates that at least two distinct classes of factors control expression of these two GST genes in response to pathogen-associated signals. During SAR, a subset of these factors is inactivated and the TGA factors serve as a key positive activator for their induction. In the presence of EYFP-T2m, suppression of ASF-1 activity thus resulted in the effective repression of these GST genes under these conditions.

image

Figure 5. Systemic acquired resistance in EYFP-T2m transgenic plants.

Two fully expanded leaves near the bottom of wild-type and EYFP-T2m transgenic plants were inoculated with water or TMV using carborundum and maintained at room temperature under constant light. 8 days after this first challenge, two upper leaves were inoculated with Pseudomonas syringae pv. tabaci at a concentration of around 1000–5000 colony-forming units cm−2.

(a) Two days after the bacterial inoculation, leaf disks from inoculated areas were harvested and the bacterial population recovered from wild-type or transgenic plants that had been mock- or TMV-inoculated. The data presented are the mean and standard deviations from four individual leaves. This experiment has been repeated twice with similar results.

(b) During the course of the same experiment, leaf samples were harvested before challenge with Pseudomonas syringae pv. tabaci (time 0) on the upper leaves or 2 days after the bacterial challenge (2 days) in order to analyze the SAR level using molecular probes. Tissue samples from wild-type and two independent EYFP-T2m plants (1 and 2) that were mock- or TMV-challenged a week before (M and T, respectively) were also collected. Total RNA was extracted, and 20 µg of each sample separated on an agarose gel and hybridized with PR1, STR246, GNT35 and 18S as indicated on the left.

Download figure to PowerPoint

Altogether, these results reveal that the TGA factor family plays a complex role in plant–pathogen interactions, as TGA factors are involved in the activation of certain target genes (those encoding certain GSTs) in response to SA and local infection, but also have a repressor function in the pathway for PR gene induction and SAR establishment.

Discussion

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

We have succeeded in functionally suppressing the majority of the DNA-binding activity related to the TGA family of transcription factors by the expression of a trans-dominant negative mutant of Arabidopsis TGA2 in transgenic tobacco plants. Modified gene expression has been observed in the transgenic plants in response to hormones and pathogen challenge, as well as a heightened systemic resistance that is correlated with quantitative modifications of PR gene expression.

Functional study of a multigene family using a trans-dominant negative mutant approach

Like many bZip proteins, TGA factors belong to a large multigene family in Arabidopsis, tobacco and monocots (Chuang et al., 1999; Niggeweg et al., 2000b; Xiang et al., 1997). They share a high degree of sequence similarity (70–90% identity), and although they appear to differ significantly in their activation potential, NPR1 affinity, DNA binding and heterodimerization preferences (Lam and Lam, 1995; Niggeweg et al., 2000b; Zhou et al., 2000), they could be functionally redundant. This possible redundancy could hamper functional genomic approaches to identifying the role of this gene family by antisense strategies or loss-of-function mutations. It is necessary to create double- or triple-insertion mutants in order to shut down all the members of a family and obtain a first glimpse of the possible roles of the corresponding proteins, as a single loss-of-function mutation may not lead to any obvious phenotype. This has been recently illustrated by studies of the ethylene receptors (Hua and Meyerowitz, 1998) and of transcription regulators belonging to the MADS-box gene family in Arabidopsis (Kempin et al., 1995; Liljegren et al., 2000; Pelaz et al., 2000). An alternative approach consists of designing a trans-dominant negative mutant that would functionally knock out the activity of all the members in a gene family. It has been successfully applied in the use of trans-dominant mutants for bZip proteins Fos, Jun or Maf factors (Alam et al., 1999; Ransome et al., 1990) in animal systems, or RSG in plants (Fukazawa et al., 2000). Several attempts have been made to use this strategy to study TGA factors (Miao and Lam, 1995; Niggeweg et al., 2000a; Rieping et al., 1994), but none led to the complete disappearance of as-1 binding activity, suggesting that the mutants used were not able to dimerize efficiently with all TGA factors, or that ASF-1 activity in planta consists of factors distinct from TGA factors. In order to improve the efficiency of the trans-dominant negative mutant, we chose to use Arabidopsis TGA2 as a backbone for mutagenesis, as this TGA gene product has been shown to constitute at least 50% of the endogenous ASF-1 activity in mature Arabidopsis tissues. To preserve the nuclear localization signals and minimize any perturbations on the dimerization potentials of the mutant, we aimed to introduce as few changes as possible that will be predicted to suppress any residual DNA-binding activity in the resultant heterodimers. As shown in this study, this new TGA dominant negative mutant is extremely efficient as a repressor, as it is able to inhibit the binding activity on the as-1 site when co-expressed with all three different subclasses of TGA factors from Arabidopsis in vitro, and no ASF-1 activity was detected in transgenic tobacco expressing the EYFP-T2m fusion. Specificity of this suppression was demonstrated by the observation that G-box binding activity, which probably corresponds to another family of plant bZIP proteins, was not altered. However, the possibility that the conclusions from this dominant negative approach can be biased by potential indirect effects, such as titration of other regulatory factors, cannot be ruled out. Nevertheless, these TGA activity-depleted plants should provide excellent tools for studying the roles of these proteins in planta, especially as these transgenic plants did not display any obvious morphological phenotypes. They also provide the first evidence that ASF-1 activity is mostly, if not exclusively, composed of dimeric TGA factors in which previous studies have shown members of the TGA2 group to be one consistent component (Lam and Lam, 1995; Niggeweg et al., 2000a).

Target genes for TGA factors

Knowledge of plant genes whose expression may be regulated by TGA factors is limited. as-1-type elements confer root-preferential gene expression and enhance transcription in response to hormone and xenobiotic-stress cues (Liu and Lam, 1994; Xiang et al., 1996). Several studies have suggested their roles in regulated expression of certain GST-encoding genes (Droog et al., 1995; Liu and Lam, 1994; Xiang et al., 1996). In addition, some as-1-dependent genes have been shown to be spatially correlated in their expression with TGA1a transcripts in the root meristem (Klinedinst et al., 2000). The study of our TGA activity-depleted plants provides direct evidence that some GST-encoding genes (GNT35 and STR246) are positively regulated, at least in part, by TGA factors in their response to auxins, MJ and SA. This is consistent with the recent report by Niggeweg et al. (2000a), using a different dominant negative mutant. Our study also illustrated the complexity of signaling pathways that combine to control the expression of these genes in response to pathogen challenge. Specifically, their expression appears to be controlled by at least two distinct classes of factors. One of these corresponds to TGA factors and serves as key positive activators, while the other subset of factors mediates the local activation of these GST-encoding genes during pathogen challenge but is inactivated during SAR.

Another set of genes whose expression could be regulated by TGA factors are genes encoding for PR proteins, as PR1 genes from Arabidopsis and tobacco have been shown to contain an as-1-related TGACG element in a region of their promoter involved in SA-activation (Lebel et al., 1998; Strompen et al., 1998). Lebel et al. (1998) analyzed the Arabidopsis PR-1 promoter by linker-scanning mutagenesis and found two TGACG elements the mutation of which affected the INA (an SA analog) induction of a reporter gene. The promixal element (LS7) is required for optimal induction of the PR-1 promoter by INA, while the more distal element (LS5) appeared to function as a weak silencer, the mutation of which resulted in higher level of INA induction. These results are consistent with our current hypothesis of both negative and positive functions for TGA factors. In the study of Strompen et al. (1998), a positive element for SA induction was identified in the tobacco PR-1a promoter comprising a 139 bp region from −624 to −553. Two TGACG motifs were found within this region, and their mutation resulted in suppression of SA and TMV induction of the PR-1a promoter in transgenic tobacco. This study provided further evidence for a positive role of TGA factors in the regulation of PR genes. However, it is not known if there are additional sites in the PR-1a promoter which may bind to TGA factors but may be acting as negative elements. The relatively low-resolution deletion analysis of Strompen et al. (1998) may not be able to detect the presence of silencing elements that could be adjacent to positive-acting ones. In addition, the possibility of other factors distinct from TGA proteins that could interact with these elements in vivo cannot be ruled out at present.

In any case, the SA-specific induction of PR1 genes suggests strongly that the as-1-related elements found in their promoters are functioning in a more complex manner than providing a simple positive switch, as auxins and MJ do not activate PR1 expression. This hypothesis has been confirmed by this study, as TGA activity suppression in our transgenic plants led to an increase in PR gene expression in response to SA, suggesting a global negative role of some TGA factors on PR gene expression. At this point, the possibility that this negative role of TGA factors in PR gene regulation could be indirect cannot be ruled out. However, it is clear from the present study that TGA factors are not essential for PR gene activation or SAR induction.

Role of TGA factors during plant–pathogen interactions

The presence of as-1 elements in some PR gene promoters, and the recent discovery that NPR1, a key regulator of SAR, binds to TGA factors in vitro, have led to the suggestion that TGA proteins could play an important role in gene regulation during plant–pathogen interactions. Although the role of TGA factors remains to be clarified, recent trans-dominant negative approaches have revealed the complexity of the roles played by the TGA family in this process (Niggeweg et al., 2000a; this study). The expression of a trans-dominant negative mutant of tobacco TGA2.2 in transgenic plants resulted in decreased transcription (about four- to sixfold) from PR1 promoters in response to exogenous SA application (Niggeweg et al., 2000a). This result thus provides evidence for a direct positive role of TGA factors in PR expression. In contrast, the essentially complete functional suppression of TGA-binding activity in our transgenic tobacco plants revealed both enhanced SA- or pathogen-induced PR expression and SAR establishment, suggesting for the first time that TGA factors have a negative role in the induction of defense responses. One important distinction between these trans-dominant mutant expressors is that our transgenic plants are devoid of detectable ASF-1 activity in leaf tissues, while about half the normal level of ASF-1 activity remains in plants used in the former studies.

We propose a model (Figure 6) that can reconcile these apparently contradictory results pertaining to the involvement of TGA factors in PR gene induction and SAR activation. Two key features of this model are proposed: first, two functionally distinct pools of TGA factors (pTGAs and nTGAs for positive and negative TGAs, respectively) mediate the control of PR gene expression and SAR induction. In the absence of SA or NPR1, the nTGAs negatively regulate PR expression and are dominant over the pTGAs (as indicated by the thicker bar for suppression in Figure 6). When the SA level increases in wild-type plants, NPR1 is activated and the pTGAs are then mobilized through interaction with this regulator in concert with other NPR1-independent, SA-inducible effectors to overcome repression by nTGAs and activate PR expression. Second, to reconcile the data from the present work and data of Niggeweg et al. (2000a), we propose that the pTGA pool may be preferentially suppressed by expression of their dominant negative mutant TGA2.2trd. In this case, one of the positive elements for PR gene activation by SA will be suppressed, while the negative activity of the nTGA pool will remain. This situation will then lead to the decrease of PR gene induction, as observed. In the case of our EYFP-T2m-expressing plants, all TGA DNA-binding activities are suppressed, thus NPR1-dependent activation and nTGAs-dependent suppression of PR expression are removed. This leaves the SA-dependent, NPR1-independent pathway(s) to activate PR expression and SAR induction. The existence of such pathway(s) has been revealed by the characterization of a suppressor, called sni1, for the npr1 phenotype (Li et al., 1999). In the npr1/sni1 double-mutant background, PR gene expression and SAR are activated by SA in the absence of NPR1. The position of SNI1 relative to TGA factors remains uncertain, as it could act directly on the regulation of pTGAs and nTGAs downstream of SA, or SNI1 may function by repressing the SA-dependent, NPR1-independent pathway. The complexity of the roles of TGA factors in our proposed models, together with the fact that at least a subset of TGA factors are likely to serve redundant functions, could explain why these genes have been missed in forward genetic screens designed to identify mediators of the SA and pathogen-response pathway. Our approach of generating a ‘functional knockout’ for a specific subfamily of transcription factors could thus complement more classical approaches in the study of complex regulatory pathways.

image

Figure 6. Working model to integrate TGA factors in the SA-mediated PR gene induction and SAR activation during plant–pathogen interaction.

A key hypothesis in these models is the proposal of two functionally distinct pools of TGA transcription factors which can mediate the regulation of PR expression and SAR induction. These are denoted as positive-acting TGAs (pTGAs) and negative-acting TGAs (nTGAs). We propose a preferential suppression of the pTGA pool by TGA2.2trd (Niggeweg et al., 2000a), while T2m would suppress both pools. The suppression of the defense response by nTGAs is suggested to be dominant in the absence of SA, and is denoted by a thicker bar. As TGAs can physically interact with NPR1, they are likely to be in the same signaling pathway. One uncertainty in the model presented is whether NPR1 interacts with the nTGA pool of factors. As NPR1 differentially interact with homodimers of different TGA members in vitro, it is quite possible that there is selectivity in terms of which TGA factors NPR1 will interact with in vivo. Simultaneous activation of the NPR1-dependent and NPR1-independent positive functions downstream of SA may be required to overcome repression of the defense response by nTGAs.

Download figure to PowerPoint

Experimental procedures

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

Generation of the dominant negative TGA2 mutant.

Three site-specific mutations have been introduced into the TGA2 sequence with synthetic oligonucleotides and PCR using standard molecular techniques. EL318 (5′-CGGATCCATGGCTGATACCAGT CCGAG-3′) and EL467 (5′-TCCTAAGCTTGCTTTTCCTTGCTGCCTG ACGCTTTTG-3′) were used to amplify the 5′ part of T2m on a TGA2-pGEM-T template (Lam and Lam, 1995). EL321 (5′-CGTC GACTCAAGATCTCTCTCTGGGTCGAGCAAG-3′) and EL468 (5′-AA GCAAGCTTAGGAAGAAGGAGGTGGATGCTTATGTTCAGCA G-3′) were used to amplify the 3′ part. A three-part ligation using a BamH1–SphI-digested TGA2-pGem-T plasmid (Promega, Madison, WI, USA) and the two PCR products gave rise to T2m-pGem-T plasmid, introducing the three mutations affecting the asparagine located 18 residues upstream, the glutamic acid located 16 residues upstream, and the arginine located 10 residues upstream of the first leucine in the bZip region (Figure 1a). The EVD linker is also introduced between the basic domain and leucine zipper of the TGA2 coding sequence via the EL468 oligonucleotide primer.

Generation of transgenic tobacco plants

The EYFP encoding region was amplified from pEYFP-C1 (Clontech) using the oligonucleotides EL874 (5′-GGATCCTCT AGAATGGGTGAGCAAGGGC-3′) and EL875 (5′-GAGCTCAGATCT TGTACAGCTCGTC-3′) and subcloned in the EcoRV site of pBluescript SK II vector to give pEYFP/SK. To create the EYFP-T2m fusion, a BamHI–SalI fragment from T2m-pGem-T plasmid was introduced into a BglII–SalI-digested EYFP-SK vector. The BamHI–SalI fragment from the obtained EYFP-T2m fusion was introduced into a BamHI–SstI-digested binary vector EL103 (derived from pBI121; Mittler et al., 1995) using the oligonucleotide adaptor EL309 (5′-TCGAAGCT-3′). The construct was then transferred into the Samsun NN cultivar of tobacco via Agrobacterium tumefaciens by the leaf-disk transformation procedure.

Gel mobility-shift experiments

TGA proteins were produced by using the TNT system of coupled in vitro transcription/translation according to the manufacturer's instructions (Promega). The amount of protein synthesized was quantified by polyacrylamide gel electrophoresis and phosphoimaging (Molecular Dynamics, Sunnyvale, CA, USA). Total cellular proteins were extracted from tobacco leaves following a modified procedure (Foster et al., 1992). After grinding and homogenization, debris was removed by 5 min centrifugation at 5000 g. 4 m ammonium sulfate were added dropwise (1/10, V/V) while stirring at 4°C, then 0.33 g ml−1 powdered ammonium sulfate was added slowly while stirring. Total cellular proteins were then pelleted by 25 min centrifugation at 17 000 g and resuspended in dialysis buffer before 3 h dialysis according to the protocol.

The conditions for the gel mobility-shift assay were as described previously (Xiang et al., 1997). as-1 related probes were as previously described (Xiang et al., 1997); the type A G-box probe was made by annealing two oligonucleotides: 5′-AGCTTATCCACGTGGAAC-3′ and 5′-TCGAGTTCCACGTGGATA-3′ (Williams et al., 1992). The specificity of binding is demonstrated by the addition of competitor DNA at 40-fold excess which is, respectively, an as-1 tetramer (as-1), a tetramer of a mutant as-1 element (as-3), or the G-box element (G) (Liu and Lam, 1994).

RNA isolation and analysis

RNA was extracted as described (Nagy et al., 1987) and subjected to RNA blot analysis. RNA blot hybridization and membrane washing were performed using Duralose-UV membranes (Stratagene, La Jolla, CA, USA) and ExpressHyb solution (Clontech) as suggested by the manufacturers. The GNT35 probe is derived from the GNT35 gene encoding a tobacco glutathione S-transferase (Xiang et al., 1996). STR246, PR1, PR2 and PR3 transcripts were detected with the corresponding tobacco cDNAs as probes (gift of D. Roby, Castanet-Tolosan, France and D. Klessig, Rutgers University, NJ, USA).

Pathogen challenge

Fully expanded leaves were infected with equal amount of TMV strain U1 in water, or mock-infected with water by gently rubbing the leaves with carborundum. Plants were kept at 22°C under continuous light. HR lesions appeared on TMV-inoculated leaves around 48 h after infection and no lesion appeared on the mock-inoculated leaves. Eight days after this infection, two upper leaves were challenged with Pseudomonas syringae pv. tabaci (ATCC 11528). Two leaves per plant were infiltrated at four different locations using a 1 ml syringe without a needle containing the bacterial suspension (OD at 600 nm = 0.002 in sterile water). Two days after inoculation, three 10 mm diameter leaf disks per plant were surface-sterilized with 20% bleach−0.1% Tween 20 for 3 min and washed twice in sterile water. They were ground and diluted in liquid nutrient and plated on nutrient agar plates for bacteria titer determination.

Acknowledgements

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

Special thanks to Jane Glazebrook and Nilgun Tumer for critical reading of our manuscript, and D. Klessig for probes and fruitful discussions. We also thank D. Roby for the STR246 probe, G. Ho and A. Bronzino for excellent technical assistance, and T. Lagrange for comments and helpful discussions. This work was supported by grants from the NIH (GM45574) and the Commission of Science and Technology of New Jersey to E.L.

References

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References
  • Alam, J., Stewart, E., Touchard, C., Boinapally, S., Choi, A.M.K., Cook, J.L. (1999) Nrf2, a Cap'n'collar transcription factor, regulates induction of the heme oxygenase-1 gene. J. Biol. Chem. 274, 2607126078.
  • Cao, H., Glazebrook, J., Clarke, J.D., Volko, S., Dong, X. (1997) The Arabidopsis NPR1 gene that controls systemic acquired resistance encodes a novel protein containing ankyrin repeats. Cell, 88, 5763.
  • Chuang, C.F., Running, M.P., Williams, R.W., Meyerowitz, E.M. (1999) The PERIANTHIA gene encodes a bZip protein involved in the determination of floral organ number in Arabidopsis thaliana. Genes Dev. 13, 334344.
  • Desprès, C., Delong, C., Glaze, S., Liu, E., Fobert, P.R. (2000) The Arabidopsis NPR1/NIM1 protein enhances the DNA binding activity of a subgroup of the TGA family of bZip transcription factors. Plant Cell, 12, 279290.
  • Droog, F.N.J., Hooykaas, P.J.J., Libbenga, K.R., Van Der Zaal, E.J. (1993) Proteins encoded by an auxin-regulated gene family of tobacco share limited but significant homology with glutathione S-transferases and one member indeed shows in vitro GST activity. Plant Mol. Biol. 21, 965972.
  • Droog, F., Spek, A., Van Der Kooy, A., De Ruyter, A., Hoge, H., Libbenga, K., Hooykaas, P., Van Der Zaal, B. (1995) Promoter analysis of the auxin-regulated tobacco glutathione S-transferase genes Nt103-1 and Nt103-35. Plant Mol. Biol. 29, 413429.
  • Foster, R., Gash, A., Kay, S., Chua, N.H. (1992) Analysis of protein/DNA interactions. In Methods in Arabidopsis Research (Koncz, C., Chua, N.H. and Schell, J., eds). Singapore: World Scientific Publishing, pp. 378392.
  • Fukazawa, J., Sakai, T., Ishida, S., Yamaguchi, I., Kamiya, Y., Takahashi, Y. (2000) REPRESSION OF SHOOT GROWTH, a bZip transcriptional activator, regulates cell elongation by controlling the level of gibberellins. Plant Cell, 12, 901915.
  • Gough, C., Hémon, P., Tronchet, M., Lacomme, C., Marco, Y., Roby, D. (1995) Developmental and pathogen-induced activation of an msr gene, str246, from tobacco involves multiple regulatory elements. Mol. Gen. Genet. 247, 323337.
  • Hua, J. & Meyerowitz, E.M. (1998) Ethylene responses are negatively regulated by a receptor gene family in Arabidopsis thaliana. Cell, 94, 261271.
  • Katagiri, F., Lam, E., Chua, N.-H. (1989) Two tobacco DNA-binding proteins with homology to the nuclear factor CREB. Nature, 340, 727730.
  • Kempin, S.A., Savidge, B., Yanofsky, M.F. (1995) Molecular basis of the cauliflower phenotype in Arabidopsis. Science, 267, 522525.
  • Klinedinst, S., Pascuzzi, P., Redman, J., Desai, M., Arias, J. (2000) A xenobiotic-stress-activated transcription factor and its cognate target genes are preferentially expressed in root tip meristems. Plant Mol. Biol. 42, 679688.
  • Van Der Krool, A.R. & Chua, N.-H. (1991) The basic domain of plant b-Zip proteins facilitates import of a reporter protein into plant nuclei. Plant Cell, 3, 667675.
  • Lam, E. & Lam, Y.K. (1995) Binding site requirements and differential representation of TGA factors in nuclear ASF-1 activity. Nucl. Acids Res. 23, 37783785.
  • Lam, E., Benfey, P.N., Gilmartin, P.M., Fang, R.X., Chua, N.H. (1989) Site-specific mutations alter in vitro factor binding and change promoter expression pattern in transgenic plants. Proc. Natl Acad. Sci. USA, 86, 78907894.
  • Lebel, E., Heifetz, P., Thorne, L., Uknes, S., Ryals, J., Ward, E. (1998) Functional analysis of regulatory sequences controlling PR-1 gene expression in Arabidopsis. Plant J. 16, 223233.DOI: 10.1046/j.1365-313x.1998.00288.x
  • Li, X., Zhang, Y., Clarke, J.D., Li, Y., Dong, X. (1999) Identification and cloning of a negative regulator of systemic acquired resistance, SNI1, through a screen for suppressors of Npr1-1. Cell, 98, 329339.
  • Liljegren, S.J., Ditta, G.S., Eshed, Y., Savidge, B., Bowman, J.L., Yanofsky, M.F. (2000) SHATTERPROOF MADS-box genes control seed dispersal in Arabidopsis. Nature, 404, 766770.DOI: 10.1038/35008089
  • Liu, X. & Lam, E. (1994) Two binding sites for the plant transcription factor ASF-1 can respond to auxin treatments in transgenic tobacco. J. Biol. Chem. 269, 668675.
  • Miao, Z.H. & Lam, E. (1995) Construction of a trans-dominant inhibitor for members of the TGA family of transcription factors conserved in higher plants. Plant J. 7, 887896.
  • Mittler, R., Shulaev, V., Lam, E. (1995) Coordinated activation of programmed cell death and defense mechanisms in transgenic tobacco plants expressing a bacterial proton pump. Plant Cell, 7, 2942.
  • Nagy, F., Boutry, M., Hsu, M.Y., Wong, M., Chua, N.H. (1987) The 5′ proximal region of the wheat cab1 gene contains a 268 bp enhancer-like sequence for phytochrome response. EMBO J. 6, 25372542.
  • Niggeweg, R., Thurow, C., Kegler, C., Gatz, C. (2000a) Tobacco transcription factor TGA2.2 is the main component of ASF-1/SARP and is involved in salicylic acid- and auxin-inducible expression of as-1-containing target promoters. J. Biol. Chem. 275, 1989719905.
  • Niggeweg, R., Thurow, C., Weigel, R., Pfitzner, U., Gatz, C. (2000b) Tobacco TGA factors differ with respect to interaction with NPR1, activation potential and DNA-binding properties. Plant Mol. Biol. 42, 775788.
  • Pelaz, S., Ditta, G.S., Baumann, E., Wisman, E., Yanofsky, M.F. (2000) B and C floral organ identity functions require SEPALLATA MADS-box genes. Nature, 405, 200203.DOI: 10.1038/35012103
  • Pu, W.T. & Struhl, K. (1991) The leucine zipper symmetrically positions the adjacent basic regions for specific DNA binding. Proc. Natl Acad. USA, 88, 69016905.
  • Ransone, L.J., Visvader, J., Wamsley, P., Verma, I.M. (1990) Trans-dominant negative mutants of Fos and Jun. Proc. Natl Acad. Sci. USA, 88, 38063810.
  • Rieping, M., Fritz, M., Prat, S., Gatz, C. (1994) A dominant negative mutant of PG13 suppresses transcription from a cauliflower mosaic virus 35S truncated promoter in transgenic tobacco plants. Plant Cell, 6, 10871098.
  • Ryals, J., Weymann, K., Lawton, K. et al. (1997) The Arabidopsis NIM1 protein shows homology to the mammalian transcription factor inhibitor IκB. Plant Cell, 9, 425439.
  • Sakai, T., Takahashi, Y., Nagata, T. (1998) The identification of DNA binding factors specific for as-1-like sequences in auxin-responsive regions of parA, parB and parC. Plant Cell Physiol. 39, 731739.
  • Shah, J., Tsui, F., Klessig, D.F. (1997) Characterization of a salicylic acid-insensitive mutant (sai1) of Arabidopsis thaliana, identified in a selective screen utilizing the SA-inducible expression of the tms2 gene. Mol. Plant–Microbe Interact. 10, 6978.
  • Strompen, G., Grüner, R., Pfitzner, U. (1998) An as-1-like motif controls the level of expression of the gene for the pathogenesis-related protein 1a from tobacco. Plant Mol. Biol. 37, 871883.
  • Williams, M.E., Foster, R., Chua, N.H. (1992) Sequences flanking the hexameric G-box core CACGTG affect the specificity of protein binding. Plant Cell, 4, 485496.
  • Xiang, C., Miao, Z.H., Lam, E. (1996) Coordinated activation of as-1-type elements and a tobacco glutathione S-transferase gene by auxins, salicylic acid, methyl jasmonate and hydrogen peroxide. Plant Mol. Biol. 32, 415426.
  • Xiang, C., Miao, Z., Lam, E. (1997) DNA-binding properties, genomic organization and expression pattern of TGA6, a new member of the TGA family of bZip transcription factors in Arabidopsis thaliana. Plant Mol. Biol. 34, 403415.
  • Zhang, Y., Fan, W., Kinkema, M., Li, X., Dong, X. (1999) Interaction of NPR1 with basic leucine zipper protein transcription factors that bind sequences required for salicylic acid induction of the PR-1 gene. Proc. Natl Acad. Sci. USA, 96, 65236528.
  • Zhou, J.M., Trifa, Y., Silva, H., Pontier, D., Lam, E., Klessig, D.F. (2000) NPR1 differentially interacts with members of the TGA/OBF family of transcription factors that bind an element of the PR-1 gene required for induction by salicylic acid. Mol. Plant–Microbe Interact. 13, 191201.