Identification of novel cis-acting elements, IDE1 and IDE2, of the barley IDS2 gene promoter conferring iron-deficiency-inducible, root-specific expression in heterogeneous tobacco plants

Authors

  • Takanori Kobayashi,

    1. Laboratory of Plant Biotechnology, Graduate School of Agricultural and Life Sciences, The University of Tokyo, 1-1 Yayoi, Bunkyo-ku, Tokyo 113-8657, Japan,
    2. Bio-Science Department, Central Research Institute of Electric Power Industry, 1646 Abiko, Chiba 270-1194, Japan,
    3. Core Research for Evolutional Science and Technology (CREST), Japan Science and Technology Corporation, Japan
    Search for more papers by this author
  • Yuko Nakayama,

    1. Bio-Science Department, Central Research Institute of Electric Power Industry, 1646 Abiko, Chiba 270-1194, Japan,
    2. Laboratory of Plant Molecular Physiology, Graduate School of Agricultural and Life Sciences, The University of Tokyo, 1-1 Yayoi, Bunkyo-ku, Tokyo 113-8657, Japan, and
    Search for more papers by this author
  • Reiko Nakanishi Itai,

    1. Laboratory of Plant Biotechnology, Graduate School of Agricultural and Life Sciences, The University of Tokyo, 1-1 Yayoi, Bunkyo-ku, Tokyo 113-8657, Japan,
    2. Core Research for Evolutional Science and Technology (CREST), Japan Science and Technology Corporation, Japan
    Search for more papers by this author
  • Hiromi Nakanishi,

    1. Laboratory of Plant Molecular Physiology, Graduate School of Agricultural and Life Sciences, The University of Tokyo, 1-1 Yayoi, Bunkyo-ku, Tokyo 113-8657, Japan, and
    Search for more papers by this author
  • Toshihiro Yoshihara,

    Corresponding author
    1. Bio-Science Department, Central Research Institute of Electric Power Industry, 1646 Abiko, Chiba 270-1194, Japan,
    Search for more papers by this author
  • Satoshi Mori,

    1. Laboratory of Plant Molecular Physiology, Graduate School of Agricultural and Life Sciences, The University of Tokyo, 1-1 Yayoi, Bunkyo-ku, Tokyo 113-8657, Japan, and
    Search for more papers by this author
  • Naoko K. Nishizawa

    Corresponding author
    1. Laboratory of Plant Biotechnology, Graduate School of Agricultural and Life Sciences, The University of Tokyo, 1-1 Yayoi, Bunkyo-ku, Tokyo 113-8657, Japan,
    2. Core Research for Evolutional Science and Technology (CREST), Japan Science and Technology Corporation, Japan
    Search for more papers by this author

For correspondence (fax +81 3 5841 5236, +81 4 7182 1181; e-mail annaoko@mail.ecc.u-tokyo.ac.jp, yoshiha@criepi.denken.or.jp).

Summary

The molecular mechanisms of plant responses to iron (Fe) deficiency remain largely unknown. To identify the cis-acting elements responsible for Fe-deficiency-inducible expression in higher plants, the barley IDS2 (iron deficiency specific clone no. 2) gene promoter was analyzed using a transgenic tobacco system. Deletion analysis revealed that the sequence between −272 and −91 from the translational start site (−272/−91) was both sufficient and necessary for specific expression in tobacco roots. Further deletion and linker-scanning analysis of this region clearly identified two cis-acting elements: iron-deficiency-responsive element 1 (IDE1) at −153/−136 (ATCAAGCATGCTTCTTGC) and IDE2 at −262/−236 (TTGAACGGCAAGTTTCACGCTGTCACT). The co-existence of IDE1 and IDE2 was essential for specific expression when the −46/+8 region (relative to the transcriptional start site) of the CaMV 35S promoter was used as a minimal promoter. Expression occurred mainly in the root pericycle, endodermis, and cortex. When the −90/+8 region of the CaMV 35S promoter was fused, the −272/−227 region, which consists of IDE2 and an additional 19 bp, could drive Fe-deficiency-inducible expression without IDE1 throughout almost the entire root. The principal modules of IDE1 and IDE2 were homologous. Sequences homologous to IDE1 were also found in many other Fe-deficiency-inducible promoters, including: nicotianamine aminotransferase (HvNAAT)-A, HvNAAT-B, nicotianamine synthase (HvNAS1), HvIDS3, OsNAS1, OsNAS2, OsIRT1, AtIRT1, and AtFRO2, suggesting the conservation of cis-acting elements in various genes and species. The identification of novel cis-acting elements, IDE1 and IDE2, will provide powerful tools to clarify the molecular mechanisms regulating Fe homeostasis in higher plants.

Ancillary