SEARCH

SEARCH BY CITATION

Summary

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

We have produced 22 090 primary transgenic rice plants that carry a T-DNA insertion, which has resulted in 18 358 fertile lines. Genomic DNA gel-blot and PCR analyses have shown that approximately 65% of the population contains more than one copy of the inserted T-DNA. Hygromycin resistance tests revealed that transgenic plants contain an average of 1.4 loci of T-DNA inserts. Therefore, it can be estimated that approximately 25 700 taggings have been generated. The binary vector used in the insertion contained the promoterless β-glucuronidase (GUS) reporter gene with an intron and multiple splicing donors and acceptors immediately next to the right border. Therefore, this gene trap vector is able to detect a gene fusion between GUS and an endogenous gene, which is tagged by T-DNA. Histochemical GUS assays were carried out in the leaves and roots from 5353 lines, mature flowers from 7026 lines, and developing seeds from 1948 lines. The data revealed that 1.6–2.1% of tested organs were GUS-positive in the tested organs, and that their GUS expression patterns were organ- or tissue-specific or ubiquitous in all parts of the plant. The large population of T-DNA-tagged lines will be useful for identifying insertional mutants in various genes and for discovering new genes in rice.


Introduction

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

There has been much progress in the development of strategies to discover the function of plant genes. Development of the strategies has been largely based on genetic approaches such as mutant identification and map-based gene isolation (reviewed in Martin 1998). Gene inactivation by insertion of a transposon has been employed for functional studies in several plant species. The use of transfer DNA (T-DNA) as a mutagen has also been developed for tagging genes in Arabidopsis ( Babiychuk et al. 1997 ; Feldmann 1991; Krysan et al. 1999 ). It is believed that T-DNA insertion is a random event, and that the inserted genes are stable through multiple generations (reviewed in Azpiroz-Leehan & Feldmann 1997).

Insertional mutagenesis has become an attractive method for functional analysis due to the development of several strategies for screening T-DNA or transposon insertions in a known gene and recovering sequences flanking the insertions ( Cooley et al. 1996 ; Couteau et al. 1999 ; Frey et al. 1998 ; Koes et al. 1995 ; Krysan et al. 1999 ; Liu & Whittier 1995). Through sequencing PCR-amplified fragments adjacent to the inserted element, a flanking sequence database has been constructed in Arabidopsis ( Parinov et al. 1999 ; Tissier et al. 1999 ).

Reporter genes as insertional elements have been utilized to aid in the identification of insertions within functional genes ( Campisi et al. 1999 ; Kertbundit et al. 1991 ; Kertbundit et al. 1998 ; Sundaresan et al. 1995 ; Topping et al. 1991 ). An enhancer trap contains a weak minimal promoter fused to a reporter gene, and a gene trap contains multiple splicing sites fused to a reporter gene. The GUS gene is the most frequently used as a reporter gene because of the accurate detection of its gene products and the tolerance of N-terminal translational fusions in its enzyme activity ( Jefferson et al. 1987 ).

Rice is a model plant of cereal species because of its relatively small genome size, efficient tools for plant transformation, construction of physical maps, large-scale analysis of expressed sequence tags (ESTs) and international genome sequencing projects, as well as economic importance ( Hiei et al. 1994 ; Sasaki 1998). Therefore, development of insertional mutant lines will be extremely valuable for the functional genomics of rice. To this end, we are producing a large population of rice lines that are tagged with T-DNA. In this study, we report the generation of 18 358 independent fertile transgenic lines, which have been tagged with a gene trap system.

Results

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

Vector construction for insertional mutagenesis in rice

Two binary vectors were constructed for T-DNA insertional mutagenesis of rice ( Fig. 1a). The first plasmid pGA1633 contains the promoterless GUS gene immediately next to the right border and the cauliflower mosaic virus (CaMV) 35S promoter–hygromycin phosphotransferase (hph) chimeric gene as a selectable marker. The second plasmid, pGA2144, was constructed to increase the gene trap efficiency. In this plasmid, an intron carrying three putative splicing donors and acceptors was placed in front of GUS (see Experimental procedures). In pGA2144, we replaced the CaMV 35S with the strong promoter of the rice α-tubulin gene OsTubA1 along with its first intron (J.-S. Jeon, S. Lee, K.-H. Jung, S.-H. Jun, C. Kim and G. An, unpublished data) for expression of the selectable marker hph gene.

image

Figure 1. Maps of the T-DNA tagging vectors and analysis of T-DNA integration patterns.

(a) Schematic diagrams of pGA1633 and pGA2144. The RB and LB in grey bars represent the right and left borders of T-DNA, respectively. E, EcoRI site; gus, β-glucuronidase; Tn, nopaline synthase (nos) terminator; p35S, cauliflower mosaic virus 35S promoter; hph, hygromycin phosphotransferase; T7, transcription termination region of gene 7 of the pTiA6; I, the OsTubA1 intron 3 carrying three putative splicing acceptor and donor sites; pOsTubA1, the promoter of the rice α-tubulin gene, OsTubA1; OsTubA1-1, the first intron of OsTubA1. The GUS probe (probe A) and hph probe (probe B) used for DNA blot analyses ( Fig. 2) are indicated. (b) Sequences at the junctions between two directly integrated T-DNA copies. The capitals indicate T-DNA sequences immediately next to the right (R) and left (L) border sequences (lower case). The length of filler sequences is depicted. (c) Sequences of T-DNA at the junction with plant DNA. The T-DNA sequences of pGA1633 and pGA2144 are shown in capitals and the right border (RB) sequences are shown in lower case. Asterisks signify any nucleotides presumed to originate from the rice genome.

Download figure to PowerPoint

Production of T-DNA-tagged transgenic rice plants

Scutellum-derived embryonic calli were co-cultivated with Agrobacterium tumefaciens LBA4404 carrying the binary tagging vector. Approximately 20–40% of the co-cultivated calli produced hygromycin-resistant cells. The frequency of plant regeneration from the calli ranged from 50–85% (data not shown). Agrobacterium-mediated rice transformation procedures have been developed using the system based on the super-virulent strain and super-binary vectors carrying the virulence region of pTiBo542 (reviewed in Hiei et al. 1997 ). Our result showed that the transformation efficiency of our system was as high as the super-binary vector system, indicating that the Agrobacterium strain LBA4404 and a common binary vector can be used for efficient transformation of rice. With this system, we have produced 1590 transgenic plants transformed with pGA1633 and 20 500 transgenic plants transformed with pGA2144.

The seed fertility of the primary transgenic plants varied significantly, ranging from complete sterility to full fertility. Of the 22 090 primary transgenic plants, 1338 lines (84%) of pGA1633 and 17 020 lines (83%) of pGA2144 produced fertile seeds. Seventeen per cent of the population was sterile, and 13% generated fewer than 10 seeds. About half of the population produced more than 100 seeds and 8% generated 50–100 seeds. The remaining plants generated 10–50 seeds. The pGA1633 lines were amplified, and the majority of the transgenic plants became fully fertile in the next generation. However, approximately one half of the transgenic plants, which showed partial sterility (fewer than 50 seeds) at the primary generation remained partially sterile, suggesting that the low fertility was due to genetic alteration by either T-DNA or other mutations. The pGA2144 lines are being amplified to produce enough seeds to be utilized for further studies.

Molecular characterization of T-DNA integration pattern in transgenic rice plants

The number of integrated T-DNA in each plant was estimated from randomly selected primary transformants ( Fig. 2). Table 1 is a summary of the genomic DNA gel-blot analysis using the GUS or hph coding region as a probe. Among the 34 transgenic lines examined, 11 lines carried a single copy of the GUS gene and 13 carried a single copy of the hph gene. The remaining lines carried two or more copies of GUS or hph. This result indicates that approximately 35% of the transgenic lines carry a single T-DNA insert. In several lines, the numbers of GUS and hph genes were different from each other, probably due to T-DNA re-arrangement during the transformation process ( Ohba et al. 1995 ; see below).

image

Figure 2. DNA blot analyses of the T-DNA tagged lines.

Genomic DNAs from the primary transgenic lines were digested with EcoRI and hybridized with the GUS probe (a) or hph probe (b). Lane 1, B1019; lane 2, B1024; lane 3, B1032; lane 4, B1031; lane 5, B1037; lane 6, B1071; lane 7, B1065; lane 8, B1064.

Download figure to PowerPoint

Table 1. . Estimation of T-DNA copy numbers
Copy numbers in T1 generation aHygromycin resistance in T2 generation
TransformantGUShphResistantSensitiveNumber of genetic loci bχ2
  • a

    The copy number was determined in the T1 generation by genomic DNA gel-blot analysis with the GUS or hph probe.

  • b

    The number of loci was determined by hygromycin-resistant ratios that give the smallest χ

  • 2

    2 values.

B492281420.35
B7131581411.19
B11111882211.47
B1122294720.08
B11353792210.56
B11611731910.93
B11711682510.18
B11822771811.86
B11932592912.97
B12011591411.32
B12122821023.35
B12323661611.32
B12611361812.00
B12832531012.80
B12942901022.40
B1203284820.94
B13111642210.02
B13211531710.02
B13434832011.71
B83522441910.89
B9143364230.92
B101911912510.74
B102435703111.75
B103111741911.04
B10324458130.01
B10372296820.37
B106234651910.25
B106411613113.71
B106511552010.11
B107121502010.48
B155832703312.72
B155932682911.24
B15604662822.65
B156124129720.28
Average2.22.1  1.4 

The number of T-DNA insertion loci was analysed by scoring hygromycin-resistant progeny (T2) of the primary transgenic plants (T1). Twenty-four of 34 lines appeared to carry T-DNA at one locus, while the remaining 10 lines contained unlinked T-DNA insertion ( Table 1). This indicates that transgenic plants contain an average of 1.4 loci of T-DNA inserts. These data are quite similar to the results observed in Arabidopsis indicating that T-DNA tagged plants contain an average of 1.4 inserts ( Feldmann 1991). The number of insertion loci that was estimated by hygromycin resistance was smaller than the number of T-DNA copies evaluated by the DNA gel-blot analysis ( Table 1). This result was probably due to tandem integration of two or more T-DNA copies into a single chromosome as observed previously in dicot plants ( Krizkova & Hrouda 1998). A PCR approach was undertaken to investigate T-DNA arrangement of the lines that carry multiple T-DNAs at a single chromosome. The result showed that T-DNA copies were arranged in direct or inverted repeats (data not shown). We carried out sequence analysis of the regions between the T-DNA borders from six lines that carry multiple T-DNA copies at a single locus. The results revealed that two lines did not contain any DNA sequences between the T-DNAs ( Fig. 1b). The remaining four lines carried 6–488 bp of filler DNA. Interestingly, the 488 bp of the longest filler DNA in the B1558 line was found be a portion of the GUS gene. A DNA gel-blot analysis confirmed that the B1558 line had one more copy of GUS than hph ( Table 1). Such a partial T-DNA was previously reported from dicots, such as tobacco ( Krizkova & Hrouda 1998). It may be explained by the suggestion that the formation of repeated T-DNA copies might result from co-integration of several intermediates into one target site.

It has previously been reported that a majority of the T-DNA insertions occur within the right border at a specific locus (reviewed in Tinland 1996). To examine whether the same was true for our tagging lines, the junction regions between rice genomic DNA and the T-DNA right border were sequenced ( Fig. 1c). The sequencing results revealed that the boundaries in most of the rice lines did not correspond to the T-DNA nicking position found in Arabidopsis and tobacco transgenic plants. In dicot species, most T-DNAs were nicked after the first or second base of the right border. In our tagging lines, five were similar to those of Arabidopsis and tobacco. However, the most frequent junction point (11 out of 32 lines) was after the third base of the right border. In seven lines, the junction was at the boundary between T-DNA and the right border. The remaining nine lines showed deletion of 1–12 bases of T-DNA. It was previously reported that two of three right boundaries in transgenic rice plants and four of ten in transgenic maize plants carried three bases originated from the right border ( Hiei et al. 1994 ; Ishida et al. 1996 ).

Expression of the GUS gene in transgenic rice plants

To evaluate the efficiency of the gene trap system, the GUS expression pattern was examined from various organs of primary transgenic plants transformed with pGA2144. We have analysed GUS activities in the leaves and roots from 5353 lines, mature flowers from 7026 lines, and developing seeds from 1948 lines. The results revealed that the efficiency of GUS staining was 2.0% (106/5353) for leaves, 2.1% (113/5353) for roots, 1.9% (133/7026) for flowers, and 1.6% (31/1948) for immature seeds ( Table 2). Among the 106 GUS-positive lines in leaves, 15 (14.2%) were leaf-specific. Likewise, 25 (22.1%) lines were root-specific among the 113 GUS-positive lines in roots. We also obtained data indicating that the efficiency of GUS expression in pGA1633 lines was 1.1% (8/750) for leaves and 0.9% (7/750) for roots. These values are lower than that of pGA2144, indicating that the modified OsTubA1 intron increased GUS tagging efficiency.

Table 2. . The frequency of GUS expression in leaves, roots, flowers and immature seeds of transgenic rice plants
OrgansNumber of lines testedGUS-positive lines
n%
Leaves53531062.0
Roots53531132.1
Flowers70261331.9
Immature seeds1948311.6

The staining patterns of the 106 lines that showed GUS activity in leaves were observed in detail ( Table 3). The vein-preferential GUS staining pattern was the most frequently observed (43.4%), and 14 (13.2%) lines were stained preferentially in mesophyll cells between veins ( Fig. 3). In most samples, GUS staining was observed strongly in boundary regions exposed by cutting. It is likely that a high concentration of cellulose, lignin, silica cells,and wax in rice leaves could have obstructed penetration of the GUS substrates. The GUS staining patterns in roots are summarized in Table 4. A majority of the lines showed GUS staining in the area of cell differentiation, and more than half of the lines exhibited GUS activity in the area of cell elongation or cell division. We also characterized the GUS staining patterns in transgenic flowers ( Table 5). Among the 133 lines that showed GUS activity in flowers, 50 (37.6%) displayed intense GUS staining primarily in the palea and lemma ( Fig. 4). One line exhibited GUS activity only in glumes ( Fig. 4h), eight lines showed GUS activity only in lodicules, and four lines only in a carpel ( Fig. 4j). of the 11 lines exhibiting stamen-specific GUS activity, seven showed pollen-specific GUS staining ( Fig. 4i). The developing seeds were also subjected to GUS staining 5–10 days after flowering. A large portion of these lines showed a tissue-preferential expression pattern. For example, line G930726 exhibited an aleurone layer-preferential GUS staining pattern ( Fig. 5a,b), indicating that the trapped gene might be involved in formation of the aleurone layer or in a specific function in the tissue.

Table 3. . GUS assay in leaves of transgenic rice plants a
GUS staining patternGUS-positive lines
n%
  • a

    5353 lines were tested.

Mesophyll1413.2
Spots1413.2
Veins4643.4
Veins, mesophyll2826.4
Veins, spots21.9
Mesophyll, spots21.9
Total106100
image

Figure 3. Analysis of GUS activity in vegetative tissues of transgenic rice plants.

(a) Line G006034 exhibits mesophyll cell-specific GUS staining in the leaf. (b) Line G006167 exhibits dispersed spots of GUS staining in the leaf. (c) Line B000071 exhibits preferential GUS activity in leaf veins. (d) Line G006006 exhibits GUS activity broadly in the stem. (e) A cross-section of line G006034. (f) A cross-section of the leaf sheath of line G006167 displaying strong GUS activity in a few cells of chlorenchyma tissue between the vascular bundle and surrounding cells. (g) A cross-section of line B000071 displaying phloem-specific GUS staining. (h) A cross-section of line G006006 showing that GUS activity was localized in most tissues except for vascular bundles. (i) Line G006063 exhibits GUS activity strongly in veins in the zone of cell division, elongation and differentiation. (j) Line G006023 exhibits GUS activity strongly in the zone of cell division and cell differentiation. (k) Line G006024 exhibits strong GUS activity in the cortex in the zone of cell differentiation. (l) Line G006060 exhibits GUS activity in spots. (m) Line G006044 exhibits GUS activity in root caps. (n) A cross-section at the zone of cell differentiation of line G006023. (o) A cross-section of line G006024. (p) A cross-section of the spotted region of line G006060. GUS activity under the dark field appeared as pink or red. Cor, cortex; Df, zone of cell differentiation; Di, zone of cell division; El, zone of cell elongation; End, endodermis; Exo, exodermis; M, mesophyll; Ph, phloem; RC, root cap; S, GUS spots; V, veins; Xy, xylem.

Download figure to PowerPoint

Table 4. . GUS assay in roots of transgenic rice plants
GUS staining patternGUS-positive lines
n%
  • a

    5353 lines were tested.

  • b

    Seventy-four of the GUS-positive lines were analysed by thin section.

GUS activity in various regions a
Cap10.9
Differentiation3631.9
Cap, division43.5
Cap, differentiation32.7
Division, differentiation21.8
Elongation, differentiation76.2
Differentiation, spots32.7
Cap, division, elongation21.8
Cap, division, differentiation21.8
Division, elongation, differentiation1614.2
Cap, division, elongation, differentiation3732.7
Total113100
GUS activity in various tissues b
Epidermis34.1
Vein1418.9
Epidermis, vein11.4
Exodermis, endodermis, vein45.4
Exodermis, cortex, endodermis1114.9
Exodermis, cortex, endodermis, vein3445.9
Epidermis, exodermis, cortex, endodermis, vein 79.4
Total74100
Table 5. . GUS assay in flowers of transgenic rice plants a
GUS staining patternGUS-positive lines
n%
  • a

    7026 lines were tested.

Palea/lemma5037.6
Lodicules86.0
Stamens118.3
Carpel43.0
Palea/lemma, lodicules96.8
Palea/lemma, stamens86.0
Palea/lemma, carpel53.8
Lodicules, stamens10.8
Lodicules, carpel32.3
Stamen, carpel96.8
Palea/lemma, lodicules, stamens43.0
Palea/lemma, lodicules, carpel21.5
Palea/lemma, stamens, carpel32.3
Lodicules, stamens, carpel10.8
Palea/lemma, lodicules, stamens, carpel86.0
Rachilla64.5
Glumes10.8
Total133100
image

Figure 4. Analysis of GUS activity in flowers of transgenic rice plants.

(a) Line E000261 exhibits trichome-specific GUS expression. (b) Line G904527 exhibits GUS activity preferentially in long trichomes on veins. (c) Line G915918 exhibits GUS activity in the inner epidermis of the palea/lemma. (d) A palea/lemma and a leaf in line G006034 exhibit GUS activity in the boundary regions of veins. (e) Line G010031 exhibits GUS activity in a pattern of spots in the leaf and palea/lemma. (f) Line B000071 exhibits GUS activity in veins specifically. (g) Line G008193 exhibits an overall GUS activity in palea/lemma with densely stained spots. A leaf also shows strong GUS activity in the same line. (h) Line G905901 exhibits GUS activity in glumes. (i) Line G906024 exhibits pollen-specific GUS expression. (j) Line G915417 exhibits carpel-specific GUS expression. (k) Line G915412 exhibits GUS activity strongly in the carpel and weakly in veins of the palea/lemma. (l) Line G919302 exhibits strong GUS activity in lodicules, pollens of anthers, and the base of a carpel. (m) Line G922021 exhibits GUS activity in veins of the palea/lemma and the connective tissues of anthers. (n) Line G915827 exhibits GUS activity in the apiculi of the palea/lemma, stamens, a carpel and rachilla. (o) Line G917211 exhibits GUS activity in pollen and an ovary. (p) Line G916433 exhibits GUS activity in all floral organs. Ap, apiculi of palea/lemma; C, carpel; Co, connective tissue; G, glumes; IE, inner epidermis of palea/lemma; F, flower; L, lemma; Le; leaf; Lo, lodicules; O, ovary; P, palea; Po, pollens; R, rachilla; S, GUS spots; T, trichome; V, veins.

Download figure to PowerPoint

image

Figure 5. Analysis of GUS activity in developing seeds of transgenic rice plants.

(a) Line G930726 exhibits GUS activity strongly in the aleurone layer. (b) A cross-section of line G930726. (c) Line G931910 exhibits GUS activity strongly in marginal regions of endosperm, aleurone layer, inner seed coats and veins. (d) A cross-section of line G931910. (e) Line G933524 exhibits GUS activity preferentially in the embryo. (f) A cross-section of line G933524. (g) Line G932817 exhibits GUS activity strongly in the cut region, and chalazal and micropylar ends. (h) A cross-section of the cut region in line G932817. (i) Line G932825 exhibits GUS activity in the aleurone layer and endosperm. (j) A cross-section of line G932825. (k) Line G928607 exhibits GUS activity in all tissues. (l) A cross-section of line G928607. All tissues including embryo, seed coat, and endosperm exhibit GUS activity. Samples were cut to allow an efficient penetration of substrates, and then subjected to GUS staining. AL, aleurone layer; CE, chalazal end; E, embryo; En, endosperm; ME, micropylar end; SC, seed coat; V, veins.

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

In this study, 18 358 fertile rice lines, which were tagged by T-DNA, were generated. DNA gel-blot analysis of randomly selected transgenic lines has indicated that they carry an average of 2.2 T-DNA copies. This value is lower than that observed from transgenic rice plants resulting from direct DNA transfer procedures ( Kohli et al. 1998 ). The low copy value of T-DNA insertion should facilitate characterization of mutants and isolation of the sequence flanking the T-DNA.

The number of T-DNA-tagged lines that would be required for saturating the rice genome can be estimated using the formula suggested in Krysan et al. (1999) . The following three facts determine the number. First, the mean size of rice genes can be deduced from the 1 766 754 bp of genomic sequence that has been published in the DDBJ/EMBL/GenBank databases (AB023482, AB026295, AP000391, AP000399, AP000492, AP000559, AP000616, AP157903, AP000815, AP000816, AP000836, AP000837). Within these reported sequences, there are 331 putative genes that have been identified functionally or by exon prediction algorithms. The mean size of the rice genomic DNAs between the start and stop codons including introns is 2.6 kb. Because the upstream and downstream sequences flanked by the start and stop codons were not included, an average length of rice genes should be at least 3.0 kb. Second, the mean number of T-DNA loci distributed among the transgenic rice population was 1.4. Third, the haploid genome size of rice is 4.3 × 108 bp ( Arumuganathan & Earle 1991). If we consider a 99% probability that a T-DNA is located within a given gene, we would require approximately 660 000 insertions or 471 000 tagging lines. Therefore, it would be difficult to generate a transgenic rice population in which every gene has been mutated. As the probability is lowered, the number of transgenic plants required becomes exponentially lower ( Krysan et al. 1999 ). It can be estimated that our current tagging lines would provide a 20% probability of finding a T-DNA insertion within a given gene of size 3 kb.

The GUS activation frequency ranged between 1.6 and 2.1% in various organs. Since GUS activity was observed from more than one organ in a number of lines, the GUS activation frequency of the T-DNA-tagged lines would be smaller than sum of the values obtained from each organ. Because we have not examined GUS activity after induction by certain environmental conditions or chemicals such as growth substances, the total GUS tagging efficiency will be higher. We have observed that around 7% of transgenic calli showed GUS staining (data not shown). Analysis of the reported 1 766 754 bp genomic sequence indicated that up to 50% of the genomic DNA is intragenic. Considering that insertion could occur in both orientations, the maximum GUS tagging efficiency would be 25% of the total population.

A variety of GUS staining patterns was observed from the tagged lines. Some were tissue- or organ-specific, while others were expressed ubiquitously. This observation supports the fact that T-DNA insertion is a random event. We are currently isolating the flanking sequences of the GUS-positive lines. We will study in the next generation whether these lines display any mutant phenotypes in the organs where the GUS gene was activated, and whether the phenotypes co-segregate with the T-DNA.

Insertional lines that exhibit a particular GUS staining pattern should facilitate identification of genes that are regulated spatially and temporally for plant development. The Arabidopsis LRP1 (lateral root primordium 1) gene, which may play a role in lateral root development, was identified by expression of promoterless GUS expression in tagging plants ( Smith & Fedoroff 1995). The Arabidopsis PROLIFERA gene, which is related to the MCM2-3-5 family of yeast genes, was also cloned by gene trap transposon mutagenesis ( Springer et al. 1995 ).

The progeny phenotypes of the pGA1633 transgenic lines were examined. Some of the tagged lines showed mutant phenotypes, including early flowering, tallness, dwarfism, spotted leaves, chlorophyll deficiency, depressed palea, filamentous flowers, extra glumes, long sterile glumes, zebra coloration (transverse green and chlotic bands in leaves), etc. (data not shown). Whether any of these mutant phenotypes are due to the T-DNA insertion is under investigation.

It is expected that the genome sequence of rice will be completed in the near future. This will produce a large number of genes whose function is unknown. One of the most efficient ways to obtain information on the function of a gene is to create a loss-of-function mutation and to study the phenotype of the resulting mutant. If a large population of mutagenized plants is available, it is possible to detect an insertion within the gene of interest by PCR using oligonucleotide primers from the insertional element and the gene of interest ( Couteau et al. 1999 ; Krysan et al. 1999 ; Sato et al. 1999 ). Identification of the desired mutant could be accomplished efficiently using a super-pooling strategy as suggested by Krysan et al. (1999) . They estimated that the maximum useful pool size is 2350 lines in Arabidopsis based upon the sensitivity for detecting a specific T-DNA insert and the total amount of template DNA. We are performing experiments to determine the upper size limit on DNA pools of the rice tagged lines.

Our T-DNA tagging lines will be useful in analysing the function of a number of valuable genes by various approaches. With the increasing availability of rice genome sequences from public databases, it would be valuable to construct a database for the flanking sequences. The development of effective methods for amplification of sequences adjoining the insertion would enable us to construct the database effectively.

Experimental procedures

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

Construction of vectors

The pGA1633 vector was constructed by insertion of the GUS gene derived from pBI101.1 into the BamHI site of pGA1605 ( Lee et al. 1999 ), which contains multi-cloning sites, BamHI, HindIII, XbaI, SacI, HpaI, Asp718 and ClaI, and 35S–hph. There is no translation initiation or stop codon between the right border of the T-DNA and BamHI site in pGA1633.

Another binary vector pGA2144 was constructed by inserting the modified intron 3 of OsTubA1 (accession number AF182523) in front of the GUS gene. The OsTubA1 intron 3 was used as a template. The PCR primers used were 5′GGGTCGACGAGG-TACAAGGTACAAGGTACAGACTTGTATCCTT3 ′ and 5′CG-GGTACCACCTGCATATAACCTGCATATAACCTGCACATTAGCAATAAA3′. The underlined sequences correspond to SalI and Asp718 sites. The primers were designed according to the splicing donor and acceptor sites of Sundaresan et al. (1995) . The amplified fragment was digested with SalI and Asp718, and then cloned between XhoI and Asp718 in front of GUS in pGA1942, which contains multi-cloning sites (SacI, XhoI, Asp718 and ClaI) and 0.5 kb of OsTubA1 promoter–OsTubA1 intron 1–hph. The resulting plasmid was named pGA2020. Finally, the GA2144plasmid was constructed from pGA2020 by replacing the 0.5 kb OsTubA1 promoter fragment with the 1.0 kb OsTubA1 promoter.

Production and growth of transgenic rice plants

Rice transformation was performed by Agrobacterium-mediated co-cultivation methods as previously described ( Jeon et al. 1999 ; Lee et al. 1999 ). All transgenic rice plants were generated on a 40 mg l−1 hygromycin B-containing medium. The regenerated plants were grown in a greenhouse of typically 30°C during the day and 20°C at night. The light/dark cycle in the greenhouse was 14/10 h.

Test of the progeny for hygromycin resistance

Sterilized seeds were sown on a 70 mg l−1 hygromycin B-containing MS medium and cultured under continuous illumination. Hygromycin resistance was scored 14 days after germination.

DNA gel-blot analysis

Genomic DNA was isolated from mature leaves at the heading stage as described previously ( Dellaporta et al. 1983 ). Genomic DNA (5 μg) was digested with EcoRI, separated on a 0.7% agarose gel, blotted onto a nylon membrane, and hybridized with a 32P-labelled probe. The GUS probe was prepared from the 1.8 kb BamHI–EcoRI fragment and the hph probe was from the 0.7 kb EcoRI fragment. All blot analysis procedures were carried out as described previously ( Kang et al. 1998 ).

Isolation of the sequence flanking T-DNA and the junction sequence between two integrated T-DNAs

The sequence flanking T-DNA was isolated by thermal asymmetric interlaced PCR as previously described ( Liu & Whittier 1995). The specific primer for the first cycle was 5′GCCGTAATGAGTGACCGCATCG3′ (Gus1); the second was 5′ATCTGCATCGGCGAACTGATCG3′ (Gus2); and the third was 5′CACGGGTTGGGGTTTCTACAGG3′ (Gus3). The junction between two integrated T-DNAs was amplified by PCR using primers Gus3 and 5′GCTTGGACTATAATACCTGAC3′ (T7). PCR products were sequenced using the BigDye Terminator Cycle Sequencing Ready Reaction Kit (PE Applied Biosystems, Foster City, CA ,USA).

GUS assay

Histochemical GUS staining was performed according to Dai et al. (1996) , except for addition of 20% methanol to the staining solution. After staining, tissues were fixed in a solution containing 50% ethanol, 5% acetic acid and 3.7% formaldehyde, and embedded in a Paraplast (Sigma). The samples were sectioned to 10 μm thickness and observed under a microscope using dark-field illumination.

Acknowledgements

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

We thank Gi-Hwan Yi for sharing us with the Dongjin seeds, Steve Goffs, Bob Dietrich, Lili Chen, Shiping Zhang and Hong Gil Nam for helpful discussions, and Chahm An for critical reading of the manuscript. This work was supported in part by grants from Novartis Crop Protection Inc., and from the NRL Program from Korea Institute of Science and Technology Evaluation and Planning (KISTEP).

References

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References
  • Arumuganathan, K. & Earle, E.D. 1991 Nuclear DNA contents of some important plant species. Plant Mol. Biol. Report , 9, 208 218.
  • Azpiroz-Leehan, R. & Feldmann, K.A. 1997 T-DNA insertion mutagenesis in Arabidopsis: going back and forth . Trends Genet., 13, 152 156.
  • Babiychuk, E., Fuangthong, M., Van Montagu, M., Inze, D., Kushnir, S. 1997 Efficient gene tagging in Arabidopsis thaliana using a gene trap approach. Proc. Natl Acad. Sci. USA , 94, 12722 12727.
  • Campisi, L., Yang, Y., Yi, Y., Heilig, E., Herman, B., Cassista, A.J., Allen, D.W., Xiang, H., Jack, T. 1999 Generation of enhancer trap lines in Arabidopsis and characterization of expression patterns in the inflorescence. Plant J., 17, 699 707.
  • Cooley, M.B., Goldsbrough, A.P., Still, D.W., Yoder, J.I. 1996 Site-selected insertional mutagenesis of tomato with maize Ac and Ds elements. Mol. Gen. Genet., 252, 184 194.
  • Couteau, F., Belzile, F., Horlow, C., Grandjean, O., Vezon, D., Doutriaux, M.-P. 1999 Random chromosome segregation without meiotic arrest in both male and female meiocytes of a dmc1 mutant of Arabidopsis. Plant Cell, 11, 1623 1634.
  • Dai, Z., Gao, J., An, K., Lee, J.M., Edwards, G.E., An, G. 1996 Promoter elements controlling developmental and environmental regulation of a tobacco ribosomal protein gene. L34. Plant Mol. Biol., 32, 1055 1065.
  • Dellaporta, S.L., Wood, J., Hicks, J.B. 1983 A plant DNA minipreparation: version 2. Plant Mol. Biol. Report , 1, 19 22.
  • Feldmann, K.A. 1991 T-DNA insertion mutagenesis in Arabidopsis: mutational spectrum . Plant J., 1, 71 82.
  • Frey, M., Stettner, C., Gierl, A. 1998 A general method for gene isolation in tagging approaches: amplification of insertion mutagenized sites (AIMS). Plant J., 13, 717 721.
  • Hiei, Y., Komari, T., Kubo, T. 1997 Transformation of rice mediated by Agrobacterium tumefaciens. Plant Mol. Biol., 35, 205 218.
  • Hiei, Y., Ohta, S., Komari, T., Kumashiro, T. 1994 Efficient transformation of rice (Oryza sativa L.) mediated by Agrobacterium and sequence analysis of the boundaries of the T-DNA. Plant J., 6, 271 282.
  • Ishida, Y., Saito, H., Ohta, S., Hiei, Y., Komari, T., Kumashiro, T. 1996 High efficiency transformation of maize (Zea mays L.) mediated by Agrobacterium tumefaciens. Nature Biotech., 14, 745 750.
  • Jefferson, R.A., Kavanagh, T.A., Bevan, M.W. 1987 GUS fusions: β-glucuronidase as a sensitive and versatile gene fusion marker in higher plants. EMBO J., 6, 3901 3907.
  • Jeon, J.-S., Chung, Y.-Y., Lee, S., Yi, G.-H., Oh, B.-G., An, G. 1999 Isolation and characterization of an anther-specific gene, RA8, from rice (Oryza sativa L.). Plant Mol. Biol., 39, 35 44.
  • Kang, H.-G., Jeon, J.-S., Lee, S., An, G. 1998 Identification of class B and class C floral organ identity genes from rice plants. Plant Mol. Biol., 38, 1021 1029.
  • Kertbundit, S., De Greve, H., Deboeck, F., Van Montagu, M., Hernalsteens, J.-P. 1991 In vivo random β-glucuronidase gene fusions in Arabidopsis thaliana . Proc. Natl Acad. Sci. USA , 88, 5212 5216.
  • Kertbundit, S., Linacero, R., Rouze, P., Galis, I., Macas, J., Deboeck, F., Renckens, S., Hernalsteens, J.-P., De Greve, H. 1998 Analysis of T-DNA-mediated translational β-glucuronidase gene fusions. Plant Mol. Biol., 36, 205 217.
  • Koes, R., Souer, E., Van Houwelingen, A. et al. 1995 Targeted gene inactivation in petunia by PCR-based selection of transposon insertion mutants. Proc. Natl Acad. Sci. USA , 92, 8149 8153.
  • Kohli, A., Leech, M., Vain, P., Laurie, D.A., Christou, P. 1998 Transgene organization in rice engineered through direct DNA transfer supports a two-phase integration mechanism mediated by the establishment of integration hotspots. Proc. Natl Acad. Sci. USA , 95, 7203 7208.
  • Krizkova, L. & Hrouda, M. 1998 Direct repeats of T-DNA integrated in tobacco chromosome: characterization of junction regions. Plant J., 16, 673 680.
  • Krysan, P.J., Young, J.C., Sussman, M.R. 1999 T-DNA as an insertional mutagen in Arabidopsis. Plant Cell, 11, 2283 2290.
  • Lee, S., Jeon, J.-S., Jung, K.-H., An, G. 1999 Binary vectors for efficient transformation of rice. J. Plant Biol., 42, 310 316.
  • Liu, Y.-G. & Whittier, R.F. 1995 Thermal asymmetric interlaced PCR: automatable amplification and sequencing of insert end fragments from P1 and YAC clones for chromosome walking. Genomics, 25, 674 681.
  • Martin, G.B. 1998 Gene discovery for crop improvement. Curr. Opin. Biotech., 9, 220 226.
  • Ohba, T., Yoshioka, Y., Machida, C., Machida, Y. 1995 DNA rearrangement associated with the integration of T-DNA in tobacco: an example for multiple duplications of DNA around the integration target. Plant J., 7, 157 164.
  • Parinov, S., Sevugan, M., Ye, D., Yang, W.-C., Kumaran, M., Sundaresan, V. 1999 Analysis of flanking sequences from Dissociation insertion lines: a database for reverse genetics in Arabidopsis. Plant Cell, 11, 2263 2270.
  • Sasaki, T. 1998 The rice genome project in Japan. Proc. Natl Acad. Sci. USA , 95, 2027 2028.
  • Sato, Y., Sentoku, N., Miura, Y., Hirochika, H., Kitano, H., Matsuoka, M. 1999 Loss-of-function mutations in the rice homeobox gene OSH15 affect the architecture of internodes resulting in dwarf plants. EMBO J., 18, 992 1002.
  • Smith, D.L. & Fedoroff, N.V. 1995 LRP1, a gene expressed in lateral and adventitious root primordia of Arabidopsis . Plant Cell, 7, 735 745.
  • Springer, P.S., McCombie, W.R., Sundaresan, V., Martienssen, R.A. 1995 Gene trap tagging of PROLIFERA, an essential MCM2-3–5-like gene in Arabidopsis. Science, 268, 877 880.
  • Sundaresan, V., Springer, P., Volpe, T., Haward, S., Jones, J.D.G., Dean, C., Ma, H., Martienssen, R. 1995 Patterns of gene action in plant development revealed by enhancer trap and gene trap transposable elements. Genes Dev., 9, 1797 1810.
  • Tinland, B. 1996 The integration of T-DNA into plant genomes. Trends Plant Sci., 1, 178 184.
  • Tissier, A.F., Marillonnet, S., Klimyuk, V., Patel, K., Torres, M.A., Murphy, G., Jones, J.D.G. 1999 Multiple independent defective Suppressor-mutator transposon insertions in Arabidopsis: a tool for functional genomics. Plant Cell, 11, 1841 1852.
  • Topping, J.F., Wei, W., Lindsey, K. 1991 Functional tagging of regulatory elements in the plant genome. Development, 112, 1009 1019.