SEARCH

SEARCH BY CITATION

Keywords:

  • Drosophila serrata;
  • microsatellite;
  • montium subgroup;
  • ND5;
  • sibling species

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Laboratory stocks
  6. Crosses
  7. Microsatellite variation
  8. ND5 sequence data
  9. Distribution
  10. Development time, viability, size and shape
  11. Results
  12. Crosses
  13. Reproductive isolation
  14. Microsatellite variation
  15. ND5 sequence data
  16. Distribution
  17. Development time, viability, size and shape
  18. Discussion
  19. Acknowledgments
  20. References

The Drosophila serrata species complex from Australia and New Guinea has been widely used in evolutionary studies of speciation and climatic adaptation. It is believed to consist of D. serrata, D. birchii and D. dominicana, although knowledge of the latter is limited. Here we present evidence for a previously undescribed cryptic member of the D. serrata species complex. This new cryptic species is widespread in far north Queensland, Australia and is likely to have been previously mistaken for D. serrata. It shows complete reproductive isolation when crossed with both D. serrata and D. birchii. The cryptic species can be easily distinguished from D. serrata and D. birchii using either microsatellite loci or visual techniques. Although it occurs sympatrically with both D. serrata and D. birchii, it differs from these species in development time, viability, wing size and wing morphology. Its discovery explains patterns of recently described mitochondrial DNA divergence within D. serrata, and may also help to clarify some ambiguities evident in early evolutionary literature on reproductive incompatibility within the D. serrata species complex.


Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Laboratory stocks
  6. Crosses
  7. Microsatellite variation
  8. ND5 sequence data
  9. Distribution
  10. Development time, viability, size and shape
  11. Results
  12. Crosses
  13. Reproductive isolation
  14. Microsatellite variation
  15. ND5 sequence data
  16. Distribution
  17. Development time, viability, size and shape
  18. Discussion
  19. Acknowledgments
  20. References

Drosophila serrata Malloch is an endemic of Australia, Papua New Guinea and some surrounding islands (Bock, 1982). It was first described in 1927 (Malloch, 1927) and later re-described by Mather (1955), when it was assigned to the montium subgroup. Throughout the next decade the status of D. serrata was unclear due primarily to its morphological similarity with the not yet described D. birchii Dobzhansky and Mather. Originally, D. serrata was considered to be a single species with a distribution encompassing locations throughout Queensland (Mather, 1955). However, extensive sampling by Dobzhansky and Mather in Australia and Papua New Guinea revealed the existence of what was thought to be ‘two clear-cut subspecies’, which were briefly designated as D. serrata serrata and D. serrata birchii (Dobzhansky & Mather, 1961). D. serrata serrata was classified as the southern subspecies, with a distribution from Proserpine, Queensland extending southwards to just above Sydney in New South Wales. Drosophila serrata birchii was referred to as the northern species, its distribution starting just south of Cairns and extending up to the north coast of Australia and into New Guinea and surrounding islands. However, subsequent work by Ayala (1965a) clearly demonstrated that these two subspecies were in fact two reproductively isolated sibling species, D. serrata and D. birchii. At the same time, Ayala (1965b) documented the existence of a third sibling species, D. dominicana Ayala. Current knowledge of this species is based on a single collection from Madang, Papua New Guinea, although Mather is reported to have collected D. dominicana from three locations in Sabah (Mather, 1968). According to Ayala, D. dominicana exhibited complete reproductive isolation when crossed with either D. serrata or D. birchii (Ayala, 1965a). Together, the three species form the D. serrata species complex (Bock & Wheeler, 1972).

As sibling species, D. serrata and D. birchii differ most notably in their habitat preferences (Bock, 1977), and as a result their distributions only partially overlap. Drosophila birchii is a strict wet, tropical rainforest dweller confined to patches of suitable habitat distributed throughout Australia and Papua New Guinea. Drosophila serrata tends more towards a generalist species occupying a range of habitats, and as such encompasses a wider and more continuous distribution than D. birchii (see Fig. 1 for D. serrata distribution and Fig. 2 for D. birchii distribution). This disparity in geographic range and associated physiological differences make the sibling pair an ideal candidate for a range of evolutionary studies. Indeed since the 1960s, scientists worldwide have employed D. serrata and D. birchii as an evolutionary tool. Early research focused on competitive interactions and fitness (Birch et al., 1963; Ayala, 1965c; Ayala, 1966), and continued in the 1990s and beyond with a series of papers on physiological adaptation (Hoffmann, 1991; Blows, 1993; Berrigan & Hoffmann, 1998; Hercus & Hoffmann, 1999; Hallas et al., 2002) and studies on speciation and the evolution of mate preference (Blows, 1998; Blows & Allan, 1998; Higgie et al., 2000).

image

Figure 1. Distribution of Drosophila serrata on Australian mainland showing collection sites for massbred populations (black) and two major cities (grey).

Download figure to PowerPoint

image

Figure 2. Queensland distribution of Drosophila birchii, D. serrata and the cryptic species with locations of major collection sites.

Download figure to PowerPoint

Recently, a study by Kelemen & Moritz (1999) has renewed questions about genetic differentiation within the D. serrata species complex. Using a 398 bp segment of the mitochondrial ND5 gene they made comparisons within and between populations of D. birchii andD. serrata. Their data indicate two geographically differentiated and highly divergent lineages of D. serrata that are as distinct from each other as either is from D. birchii. One lineage comprises D. serrata from locations spanning Bulli (in Wollongong, south of Sydney, New South Wales) to Paluma (north of Townsville, Queensland), and is classified as ‘southern D. serrata’. The second lineage is defined using populations from Kirrama to Mossman Gorge (both in far north Queensland), and referred to as ‘northern D. serrata’. The authors offer two hypotheses to explain the divergence: (i) the two lineages represent distinct morphologically cryptic species, (ii) the two lineages represent range expansions from separate refugia. At the time of publication, neither hypothesis seemed entirely satisfactory. If there were two geographically distinct species, then this should be reflected with high to complete levels of reproductive isolation when crossing northern populations of D. serrata with southern populations of D. serrata. There are numerous examples in the literature where crosses between northern and southern populations have been performed with no indication of complete reproductive isolation (e.g. Ayala, 1965a; Blows, 1993), although there is one report of partial isolation (Ayala, 1965a). The second hypothesis also seemed unlikely as it is improbable for D. serrata to show such a high level of divergence when the patchily distributed habitat specialist, D. birchii, exhibited no divergence for the same ND5 fragment.

Here we describe evidence for the existence of a cryptic species from the D. serrata species complex, discovered unexpectedly while undertaking crosses among geographically divergent populations of D. serrata. Crosses between D. serrata and the cryptic species demonstrate complete reproductive isolation. We test for genetic divergence using microsatellite loci and develop a molecular marker to differentiate between D. serrata and the cryptic species. Using a segment of the ND5 gene, we show that the cryptic species is the ‘northern D. serrata’ described by Kelemen & Moritz (1999). We determine diagnostic morphological characters for accurate visual identification of D. serrata and the cryptic species. Both the molecular and morphological methods of identification are utilized to ascertain distributions for the two species. Finally, we compare development time and viability in D. birchii, D. serrata and the cryptic species and examine wing shape and size in an effort to clarify the findings of Hoffmann & Shirriffs (2002) who investigated clinal variation within D. serrata.

Laboratory stocks

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Laboratory stocks
  6. Crosses
  7. Microsatellite variation
  8. ND5 sequence data
  9. Distribution
  10. Development time, viability, size and shape
  11. Results
  12. Crosses
  13. Reproductive isolation
  14. Microsatellite variation
  15. ND5 sequence data
  16. Distribution
  17. Development time, viability, size and shape
  18. Discussion
  19. Acknowledgments
  20. References

Drosophila serrata massbred lines were established in May 2001 using the F1 progeny of field females collected from the east coast of Australia. Each massbred population was initiated using 10 male and 10 female progeny from 10 field females collected at the same location. In this way, six massbred populations were established representing six locations evenly distributed throughout the east coast range of D. serrata [from north to south: Lake Placid (Cairns, Qld), Eungella (Qld), Yeppoon (Qld), Rainbow Beach (Qld), Red Rock (NSW), Wollongong (NSW) – see Fig. 2]. Massbred cultures were maintained on a sugar (3.2%, w/v), agar (1.6%, w/v), yeast (3.2%, w/v) and dehydrated potato (1.6% w/v) medium (hereafter referred to as standard montium culture medium) at 19 ± 1 °C under a 12L : 12D photoperiod.

Forty pinned specimens (numbered 16474–16494 and 16537–16555) from the Lake Placid massbred population have been lodged as types in the Australian Museum, Sydney, the Queensland Museum, Brisbane and the Australian National Insect Collection, Canberra.

Many additional laboratory lines and field flies were accessed throughout our investigation as denoted in the text.

Crosses

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Laboratory stocks
  6. Crosses
  7. Microsatellite variation
  8. ND5 sequence data
  9. Distribution
  10. Development time, viability, size and shape
  11. Results
  12. Crosses
  13. Reproductive isolation
  14. Microsatellite variation
  15. ND5 sequence data
  16. Distribution
  17. Development time, viability, size and shape
  18. Discussion
  19. Acknowledgments
  20. References

We initially discovered evidence of reproductive incompatibility between the six massbred populations when setting up crosses in all possible combinations. Crosses were generated by isolating F6 virgin females and males under CO2, and allowing them to recover and age until they were approximately 1-week-old. All crosses were set up in 250 mL culture bottles using 50 females and 50 males (three repetitions were set up for each cross and the corresponding reciprocals), and left to mate for a period of 4 days before being transferred into fresh bottles with medium. This was repeated for a total of 16 days, with the adults being discarded 23 days post-eclosion. During this time it became apparent that the Lake Placid massbred population was behaving uncharacteristically and was likely to consist of a cryptic species rather than D. serrata. The six massbred populations were maintained in culture throughout this study and frequently used as reference strains.

To ascertain the status of additional resident ‘D. serrata’ laboratory stocks, we crossed all laboratory lines to the Lake Placid (cryptic species reference) and Yeppoon (D. serrata reference) massbred populations. Flies from all stocks were collected as virgins over a 1-week period and aged for a minimum of 3 days. Reciprocal crosses to both reference massbred populations were set up, comprising of 5–10 single pair matings per cross, 1460 crosses in total. We also included a subset of D. birchii in crosses to the cryptic species reference to test for reproductive isolation. In all crosses flies were left to mate for 2 weeks after which time vials were scored for larval activity. Concurrent species identification using the diagnostic microsatellite primer Dbir 7 (see below) was also performed on all flies.

To determine whether reproductive isolation was due to pre- or post-mating incompatibilities, we set up a series of inter- and intraspecific crosses. Virgins were collected from the Lake Placid and Yeppoon massbred populations and aged for a minimum of 3 days. Twenty single pair matings were set up in vials for each of the following crosses (where LP = Lake Placid and Y = Yeppoon): LP × LP, Y × Y, LP ♀ × Y♂ and Y♀ × LP♂. Crosses were monitored continuously for coupling over a 2 hour observation period and then left for 2 weeks prior to scoring presence of larvae/pupae.

Microsatellite variation

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Laboratory stocks
  6. Crosses
  7. Microsatellite variation
  8. ND5 sequence data
  9. Distribution
  10. Development time, viability, size and shape
  11. Results
  12. Crosses
  13. Reproductive isolation
  14. Microsatellite variation
  15. ND5 sequence data
  16. Distribution
  17. Development time, viability, size and shape
  18. Discussion
  19. Acknowledgments
  20. References

To examine genetic variation between the species and identify possible diagnostic markers, all six massbred populations were screened using 12 microsatellite loci (Table 1). Six of these loci have previously been characterized as described in Magiafoglou et al. (2002). Additional loci were isolated following the same procedure. Sequences of the microsatellite clones of unpublished loci were submitted to Genbank (accession numbers: AY34631923). Thirty flies from each massbred population were typed using DNA extraction (Chelex method) and microsatellite polymerase chain reaction (PCR) protocols as per Magiafoglou et al. (2002). Thermocycling was completed in an Applied Biosystem 9700 (Foster City, CA, USA) and was the same for all primer pairs with an initial denaturation at 94 °C for 3 min, followed by 35 cycles of 94 °C for 30 s, 47–57 °C (see Table 1 for annealing temperatures) for 30 s and 72 °C for 30 s. Radioactive PCR products were electrophoresed on 5% polyacrylamide denaturing gels and initially sized with a pUC19 sequence or previously sized alleles. Additionally, some loci were also amplified with fluorescently labelled primers (5 pmol), electrophoresed on a NEN Global IR2 DNA LI-COR analyzer (Lincoln, NB, USA) and scored using saga software (LI-COR).

Table 1.  Characteristics of microsatellite loci used in this study.
Locus*Primer (5′–3′)Annealing temperature (°C)Number of allelesAllele size range (bp)
Drosophila serrataCryptic species
  1. Shaded loci previously reported in Magiafoglou et al. (2002).

  2. *Loci derived from Drosophila birchii are denoted Dbir and those from D. serrata, denoted Dser.

  3. NA, either no amplification or nonspecific amplification was observed for these loci.

Dbir 1F: AACTTCCAGAACGCCACTTGA527117–125132–138
R: GTCGAGGGGGTCTGACTTTGA    
Dbir 3F: TTTAACACTCATACGCCCTTTG5219245–239266–280
R: AGCTACGGAAGTATGACGAACA    
Dbir 6F: AGCAGCTACAACTTTTTCCC5215144–164152
R: GCGTTTCATTAAAGTTTTTGGC    
Dbir 7F: CTGTCACTCTGAATGTTAAACT4510157–159185–199
R: CAAATAGTTATTATTATTGATT    
Dser 6F: GAGCAAATCGTGGCAGAAGAG5024123–155NA
R: CTCCACCCCCAGCACAAG    
Dser 9F: TGTCCAGCTCATCCACCGA505156–164NA
R: AGCAATGCCAAAACCACAAAG    
Dser 13F:GGATCTTTCTCGCAATTCGG5516222–256NA
R:ACTAACTAACCAACGAAAGCCG    
Dser 15F:GGTCTGCGGTTGATTTTTATGG5717166–190NA
R:CTGGGACTGAGGCTGGGACT    
Dser 16F:TCTCAAGTGGGGTATGCCTGG4713131–151125–127
R:CGGTAGAGAAGATTCGGACGG    
Dser 17F: AATTACACTATCAATATCGG5020247–291250–257
R: CATCATATTTTACATTTTCG    
Dser 34F: GAGCGAGAACTGGTTTTAC4730124–182128–182
R: AACTGATACTACTCTTTGTGG    
Dser 75F: GATAGGGAGAAGAAGTCGGAG5010237–255NA
R: TTCAGTTTTATTATTTCCTCC    

Pairwise FST values were calculated using genepop version 3.1 (http://vbiomed.curtin.edu.au/genepop) (Raymond & Rousset, 1995) to estimate divergence between D. serrata and the cryptic species. Owing to the fact that our analysis is based on laboratory lines and not field flies, FST measures were used only to quantify differences between the two species. At no stage do we attempt to make any phylogeographic inferences from these data.

ND5 sequence data

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Laboratory stocks
  6. Crosses
  7. Microsatellite variation
  8. ND5 sequence data
  9. Distribution
  10. Development time, viability, size and shape
  11. Results
  12. Crosses
  13. Reproductive isolation
  14. Microsatellite variation
  15. ND5 sequence data
  16. Distribution
  17. Development time, viability, size and shape
  18. Discussion
  19. Acknowledgments
  20. References

To establish a direct link between the data presented here and the findings of Kelemen & Moritz (1999), we sequenced a representative from the cryptic species and D. serrata massbred populations for the same fragment of the mitochondrial ND5 gene. We also included a D. birchii individual from a Yeppoon massbred population created at the same time as the D. serrata massbreds.

The ND5 fragment was amplified using the 2838L–2299R primer pair as described by Kelemen & Moritz (1999). Reactions were carried out in 25–50 μL volumes, with 5 μL of template DNA, 200 μm dNTPs, 1.5–4 mm MgCl2, 0.5 μm forward and reverse primer, 1X Taq buffer and 1.0 unit of Taq polymerase (Promega, Madison, WI, USA). Thermocycling was completed in an Applied Biosystems 9700 using a touchdown profile with an initial denaturation at 94 °C for 2 min, followed by 10 cycles of 94 °C for 45 s, 60 °C (−1 °C per cycle) for 45 s and 72 °C for 1 min, then 25 cycles of 94 °C for 30 s, 45 °C for 45 s and 72 °C for 1 min.

The PCR product was purified using a Promega Wizard PCR Preps DNA Purification System kit and sequenced on an ABI 373 automated sequencher (ABI prism DYEnamicTM ET termination kit, Flinders University of South Australia, Australia). A consensus sequence for each species was constructed in Sequencer version 3.1.2 (http://www.genecades.com/sequencher/index.html) using forward and reverse sequences, and submitted to Genbank (accession numbers: AY34522931). A subset of sequences from Kelemen & Moritz (1999) was obtained from Genbank. All sequences were aligned using the Clustal W algorithm (Thompson et al., 1994) and manually adjusted as necessary. A neighbour-joining phylogram was constructed in paup* beta v.10 (http://paup.csit.fsu.edu/), using the same model and parameters as Kelemen & Moritz (1999).

Distribution

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Laboratory stocks
  6. Crosses
  7. Microsatellite variation
  8. ND5 sequence data
  9. Distribution
  10. Development time, viability, size and shape
  11. Results
  12. Crosses
  13. Reproductive isolation
  14. Microsatellite variation
  15. ND5 sequence data
  16. Distribution
  17. Development time, viability, size and shape
  18. Discussion
  19. Acknowledgments
  20. References

Based on microsatellite and/or diagnostic morphological characters, the distribution of the cryptic species relative to that of D. serrata and D. birchii was examined. Simple external visual diagnostic features were identified and validated against molecular markers and the results of the crosses. These visual differences include setation of the primary clasper and colour of the cercus. In the cryptic species, the setation is denser and extends further along the primary clasper relative to D. serrata; in addition, the cercus is darker in colour in the cryptic species (for full description refer M. Schiffer and S. McEvey, unpublished data). Both characters can be used accurately on live or preserved specimens from the field or laboratory environment. As well as flies from stocks, preserved and freshly collected field flies from 10 field surveys spanning 5 years, were used to establish the distribution of the cryptic species.

Development time, viability, size and shape

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Laboratory stocks
  6. Crosses
  7. Microsatellite variation
  8. ND5 sequence data
  9. Distribution
  10. Development time, viability, size and shape
  11. Results
  12. Crosses
  13. Reproductive isolation
  14. Microsatellite variation
  15. ND5 sequence data
  16. Distribution
  17. Development time, viability, size and shape
  18. Discussion
  19. Acknowledgments
  20. References

We examined differences in development time, viability, size and shape among the three species in flies reared under laboratory conditions. Isofemale lines were established from field flies collected in March 2002 and maintained under the same conditions as the massbred lines. In total, 244 D. birchii (126 females and 118 males, representing 14 populations from Cooktown to Yeppoon), 89 D. serrata (46 females and 43 males representing six populations from Cairns to Yeppoon) and 56 cryptic species individuals (30 females and 26 males representing seven populations from Iron Range to Kirrama) were tested (refer Fig. 2). Females from each line laid eggs on treacle medium (treacle-semolina-yeast-agar) over a 12-h period. For each line, 15 eggs were spotted from the treacle medium and placed into a glass vial containing 15 mL of standard montium culture medium. Vials were coded, randomized and held at 19 ± 1 °C, 12L : 12D throughout development. Vial positions were rotated regularly to account for any positional bias in lighting or temperature. Flies were scored for development time on a daily basis and eclosing adults were frozen upon maturation.

To examine wing shape and wing size, a single male and female representative was analysed from each line. Wings were mounted on a glass slide and a two-dimensional image captured using a Pixelink camera attached to a wild MSB stereo microscope. Following Hoffmann & Shirriffs (2002), 10 landmarks were placed on the wing images (Fig. 3) using TpsDig software from F. J. Rohlf (http://life.bio.sunysb.edu/ee/rohlf/software.html) and converted to Cartesian coordinates. Prior to measurement, all wing images were randomized.

image

Figure 3. Detail of landmarks used in size and shape analysis.

Download figure to PowerPoint

Wing size was calculated as centroid size, defined as the square root of the sum of squared inter-landmark distances. Shape variation was determined with Procrustes superimposition as outlined elsewhere (Klingenberg et al., 2002) and used in D. serrata by Hoffmann & Shirriffs (2002). Generalized least-squares superimposition was used with the TpsSuper program of F. J. Rohlf (http://life.bio.sunysb.edu/ee/rohlf/software.html).

To compare viability and development time among the species, collection sites and sexes, anova was carried out. In this analysis, line was nested within collection site and species, although collection site was nested within species. To compare the overall shape of the wings from the species and populations, we undertook a Procrustes anova on the Procrustes residuals following Klingenberg & McIntyre (1998). In this analysis, the sums of squares are computed for coordinates and then summed to produce an overall anova. Degrees of freedom of a standard anova are multiplied by the number of landmarks minus four in the anova. As for centroid size, sexes were analysed separately as the three species exhibit sexual dimorphism in size.

To characterize differences among members of each species for both centroid size and the shape parameters, a discriminant function analysis was undertaken on centroid size and the Procrustes residuals, using the within group covariance matrix. Data from each individual were considered separately to examine the ability of individuals from each species to be separated by size and shape. Note that differences in size and shape determined from this experiment apply only to laboratory-reared flies, not flies collected from the field.

Crosses

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Laboratory stocks
  6. Crosses
  7. Microsatellite variation
  8. ND5 sequence data
  9. Distribution
  10. Development time, viability, size and shape
  11. Results
  12. Crosses
  13. Reproductive isolation
  14. Microsatellite variation
  15. ND5 sequence data
  16. Distribution
  17. Development time, viability, size and shape
  18. Discussion
  19. Acknowledgments
  20. References

No fertile eggs were produced by any of the massbred crosses between Lake Placid and the five more southern D. serrata populations. All other crosses produced large numbers of progeny (Table 2). These data indicate complete reproductive isolation between the Lake Placid massbred population and the more southern populations, suggesting the presence of a cryptic species.

Table 2.  Outcome of crosses between alledged Drosophila serrata massbred populations.
CrossProgeny producedCrossProgeny produced
  1. Codes: LP, Lake Placid; Y, Yeppoon; E, Eungella; RB, Rainbow Beach; RR, Red Rock; W, Wollongong.

LP × ENoRR × EYes
E × LPNoE × WYes
LP × YNoW × EYes
Y × LPNoY × RBYes
LP × RBNoRB × YYes
RB × LPNoY × RRYes
LP × RRNoRR × YYes
RR × LPNoY × WYes
LP × WNoW × YYes
W × LPNoRB × RRYes
E × YYesRR × RBYes
Y × EYesRB × WYes
E × RBYesW × RBYes
RB × EYesRR × WYes
E × RRYesW × RRYes

In the crosses involving the additional laboratory stocks, all reciprocals behaved identically for each cross (i.e. they either both produced large numbers of offspring or none at all). The subset of crosses between D. birchii and the cryptic species failed to produce any offspring indicating reproductive isolation between the two species. Laboratory stocks originally identified as ‘D. serrata’ (other than the massbreds already discussed) consisted in reality of 26 D. serrata lines and 38 cryptic species lines (Table 3). In addition, the data revealed a substantial overlap in the distribution of the two species (see also Fig. 2), which is not concordant with the findings of Kelemen & Moritz (1999).

Table 3.  Outcome of crosses between lines from alledged Drosophila serrata laboratory stocks and reference D. serrata and cryptic species massbred populations.
PopulationLatitudeDate of field collectionLines viable with LP (cryptic species)Lines viable with Y (Drosophila serrata)
  1. LP, Lake Placid massbred; Y, Yeppoon massbred.

Cooktown15°28′55′′SSeptember 19981
Cooktown15°28′55′′SMarch 20011
Cape Tribulation16°02′24′′SNovember 200010
Cape Tribulation16°02′24′′SMarch 20012
Mossman16°28′21′′SMarch 20013
Lake Placid16°52′04′′SNovember 200055
Lake Placid16°52′04′′SMarch 20019
Lake Placid16°52′04′′SAugust 200133
Lake Barrine17°14′42′′SMarch 20011
Kirrama18°11′45′′SMarch 20014
Townsville19°22′28′′SMarch 19981
Finch Hatton21°04′11′′SMarch 19981
Finch Hatton21°04′11′′SMarch 20011
Terrigal33°25′45′′SMarch 200113
Wollongong34°19′14′′SFebruary 19991

Reproductive isolation

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Laboratory stocks
  6. Crosses
  7. Microsatellite variation
  8. ND5 sequence data
  9. Distribution
  10. Development time, viability, size and shape
  11. Results
  12. Crosses
  13. Reproductive isolation
  14. Microsatellite variation
  15. ND5 sequence data
  16. Distribution
  17. Development time, viability, size and shape
  18. Discussion
  19. Acknowledgments
  20. References

Mating was observed for intraspecific crosses only, with the majority (>60%) of the pairs coupling within the first 2 h usually following wing extension. Over the next 2 weeks, all intraspecific crosses had produced offspring. None of the crosses between D. serrata and the putative species were observed mating, and no progeny were produced. Interaction between the males and females from the interspecific crosses was extremely limited. Initially males showed interest in the females until physical contact via foreleg tapping occurred, thereafter no further interaction was observed. Research has shown that after a male has visually identified a potential mate, foreleg tapping signals the first element of courtship (Spieth & Ringo, 1983). It is believed that possession of chemoreceptors on the foretarsus allows the male to make interspecific and conspecific discriminations with the information received from a single tap. Our results suggest that reproductive isolation between D. serrata and the cryptic species is due to pre-mating isolation, although further investigation would be required to confirm this.

Microsatellite variation

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Laboratory stocks
  6. Crosses
  7. Microsatellite variation
  8. ND5 sequence data
  9. Distribution
  10. Development time, viability, size and shape
  11. Results
  12. Crosses
  13. Reproductive isolation
  14. Microsatellite variation
  15. ND5 sequence data
  16. Distribution
  17. Development time, viability, size and shape
  18. Discussion
  19. Acknowledgments
  20. References

There were differences in the amplification and allelic diversity of microsatellite loci between the Lake Placid (cryptic species) population and the five D. serrata populations (Table 1). The loci Dser 6, Dser 9, Dser 13, Dser 15 and Dser 75 did not amplify a PCR product, or else produced nonspecific amplification in the cryptic species. These same loci did however amplify polymorphic products in D. serrata. The locus Dbir 6 was monomorphic in the cryptic species, but polymorphic in D. serrata. Loci that amplified products in both species generally did not share common alleles. This was apparent for the loci Dbir 1, Dbir 6, Dbir 7 and Dser 16. The largest gap in the allelic distributions for each species at any one locus was for Dbir 7 where there was a 26 bp gap between the largest allele of D. serrata and the smallest allele of the cryptic species, rendering this locus useful for discriminating between the two species.

Estimates of FST showed large differences between D. serrata and the cryptic species (Table 4). Pairwise FST estimates between D. serrata massbred populations were low (FST < 0.0862) and remained low even when only the loci that amplified in both species were compared. In contrast, FST estimates between D. serrata and the Lake Placid massbred populations were high, ranging from 0.3733 to 0.4019. The difference in FST between D. serrata massbred populations and Lake Placid was around five times that between the D. serrata massbred populations.

Table 4.  Pairwise FST comparisons: (i) comparisons above the diagonal include all loci tested (all loci amplified in Drosophila serrata, some loci did not amplify in the cryptic species), (ii) comparisons below the diagonal include only loci that amplified in both D. serrata and the cryptic species.
 Wollongong(Drosophila serrata)Red Rock(Drosophila serrata)Rainbow Beach(Drosophila serrata)Yeppoon(Drosophila serrata)Eungella(Drosophila serrata)Lake Placid(Cryptic species)
Wollongong 0.05610.05850.06140.08510.3987
Red Rock0.0485 0.05330.02580.07390.3733
Rainbow Beach0.03560.0507 0.03590.08620.3971
Yeppoon0.07260.03440.0356 0.06990.4019
Eungella0.06390.06390.08030.0726 0.3977
Lake Placid0.39870.37330.39710.40190.3977 

ND5 sequence data

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Laboratory stocks
  6. Crosses
  7. Microsatellite variation
  8. ND5 sequence data
  9. Distribution
  10. Development time, viability, size and shape
  11. Results
  12. Crosses
  13. Reproductive isolation
  14. Microsatellite variation
  15. ND5 sequence data
  16. Distribution
  17. Development time, viability, size and shape
  18. Discussion
  19. Acknowledgments
  20. References

As can be seen in the phylogram (Fig. 4), the individuals we sequenced for ND5 fall into the three categories defined by Kelemen & Moritz (1999), with high bootstrap support. The cryptic species, D. birchii and D. serrata were allocated to the ‘northern D. serrata’, D. birchii and ‘southern D. serrata’ groups respectively. The cryptic species therefore corresponds to the ‘northern D. serrata’ grouping described by Kelemen & Moritz (1999).

image

Figure 4. Neighbour-joining phylogram incorporating Drosophila birchii (Yeppoon B MB), D. serrata (Yeppoon MB) and cryptic species (Lake Placid MB) partial ND5 sequences with a subset of sequences from Kelemen & Moritz (1999). Constructed using Tamura-Nei algorithm with substitution rates following γ distribution with a shape parameter of 0.4 (see Kelemen & Moritz, 1999). Bootstrap was used to determine support for nodes (10 000 iterations). The clades ‘Northern D. serrata’, D. birchii and ‘Southern D. serrata’ are those described by Kelemen & Moritz (1999).

Download figure to PowerPoint

Distribution

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Laboratory stocks
  6. Crosses
  7. Microsatellite variation
  8. ND5 sequence data
  9. Distribution
  10. Development time, viability, size and shape
  11. Results
  12. Crosses
  13. Reproductive isolation
  14. Microsatellite variation
  15. ND5 sequence data
  16. Distribution
  17. Development time, viability, size and shape
  18. Discussion
  19. Acknowledgments
  20. References

Based on information from isofemale lines, massbred populations and field collected individuals, all three species occur sympatrically (Fig. 2). The cryptic species was found at locations ranging from Iron Range National Park (12°38′54′′ S) to Townsville (19°22′28′′S). It occurs along the east coast of Queensland as well as on the Atherton Tablelands. Drosophila birchii overlaps completely with the range of the cryptic species. The cryptic species tends to be collected only from rainforests, suggesting similar habitat preferences to D. birchii. Drosophila serrata is sympatric with the cryptic species and D. birchii but typically only in locations fringing rainforests. The distributions of both D. birchii and in particular D. serrata extend further south than that of the cryptic species. Based on our collections, D. serrata occurs on the Australian mainland from as far north as Weipa, on the western coast of the Cape York Peninsula, and on the east coast from Cooktown down to the southern species border at Wollongong, just below Sydney (Magiafoglou et al., 2002). In addition, there is one confirmed record of D. serrata from Mataranka, Northern Territory (see below). Although D. serrata has previously been reported from collections at Iron Range National Park (van Klinken & Walter, 2001), Cape York Peninsula (McEvey, 1993), far north Western Australia (Bock, 1976) and additional locations in far north Northern Territory [van Klinken & Walter, 2001; van Klinken et al., 2002; S. McEvey, personal communication (2002)], these records could be confounded by the presence of the cryptic species.

We also confirmed that historic collections maintained by the Tucson Center from Mataranka, Northern Territory (stock number: 14028–0681.4) and Queensland (14028-0681.0 and 14028-0681.1), Australia and from two locations in Papua New Guinea (14028-0681.2 and 14028-0681.3) are D. serrata. All lines were imported, checked visually and four were sequenced for the same mitochondrial ND5 fragment as described earlier (accession numbers: AY3707658). This verifies that the Northern Territory and Papua New Guinea lines used in the mitochondrial analysis of Pissios & Scouras (1993) are all D. serrata (stock numbers have since been updated, but correspond as follows: 14028–0681.2 = 3018.1, 14028–0681.3 = 3019.7 and 14028–0681.4 = 3022.1). These authors identified the presence of two different D. serrata mitochondrial haplotypes/strains and reported considerable divergence between them. This divergence is not a result of a misidentified cryptic species but due to intraspecific variation.

Development time, viability, size and shape

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Laboratory stocks
  6. Crosses
  7. Microsatellite variation
  8. ND5 sequence data
  9. Distribution
  10. Development time, viability, size and shape
  11. Results
  12. Crosses
  13. Reproductive isolation
  14. Microsatellite variation
  15. ND5 sequence data
  16. Distribution
  17. Development time, viability, size and shape
  18. Discussion
  19. Acknowledgments
  20. References

The anovas indicated differences among species for development time and viability (Table 5). Population differences were not evident for any of the traits whereas there were differences among the replicate lines from the populations. Mean values (Fig. 5) signified that the cryptic species had the longest development time and lowest viability.

Table 5. anovas comparing species, populations and strains for development time, viability, wing centroid size and wing shape. d.f., degrees of freedom; MS, mean squares.
 Development timeViabilityFemale sizeMale sizeFemale shapeMale shape
Species
 d.f.22222828
 MS43.41450.43820.33640.36170.23690.3964
 P-value<0.0010.0015<0.001<0.001<0.001<0.001
Population (nested within species)
 d.f.24242421336336
 MS0.85700.05110.00360.00330.05560.0452
 P-value0.05440.30780.58010.78850.00010.7580
Strain (nested within species and population)
 d.f.117117777410781036
 MS0.53840.04460.00400.00450.04080.0481
 P-value<0.001<0.0010.04830.00870.2582<0.001
Error
 d.f.1431441048914561246
 MS0.17020.02250.00280.00270.03930.0356
image

Figure 5. Mean values for development time, viability and centroid size of the cryptic species, Drosophila serrata and D. birchii. Error bars representing SD values.

Download figure to PowerPoint

anovas also indicated species differences but no population differentiation for wing size (Table 5). Mean values for centroid size (Fig. 5) showed that for both sexes the wings of the cryptic species were relatively smaller than those of the other species, whereas wings of D. birchii and D. serrata were of similar size.

The Procrustes anova indicated differences in wing shape among the species for both sexes (Table 5). There were also among population differences for the females and strain differences for the males. Shape differences among the species were evident from the mean values of the landmarks for the three species, which are given as a consensus configuration in dimensionless Procrustes units (Fig. 6). Because the shape differences were relatively small, these have been exaggerated in the figure by treating the D. birchii shape as a reference and multiplying the difference between this species and the other species by a factor of 5. In both sexes, there is a tendency for the outer wing area to be wider in the cryptic species relative to the other species (distance between landmarks 1 or 2 and 4), and for these landmarks to be closer together on a horizontal plane.

image

Figure 6. Concensus Procrustes landmark coordinates (illustrated as dimensionless Procrustes units) for the cryptic species, Drosophila serrata and D. birchii. Differences between the cryptic species coordinates and those of the other two species were multiplied by 5 to emphasize differences in shape among the species.

Download figure to PowerPoint

In the discriminant analysis of Procrustes residuals and centroid size for both sexes, two significant canonical functions were extracted, the first function with 63% of the variance reflecting size and allometric effects of size on shape, and the second function with 37% of the variance reflecting shape. For the females, centroid size correlated strongly with the first canonical function (r = 0.78) and none of the shape correlations were higher than 0.25. Residuals for 7y, 2y, 4x and 9x (landmark number followed by axis of interest) showed correlations >0.3 for the second canonical function. For the males, there was also a strong correlation (r = 0.76) with the first canonical function. The second canonical function was correlated strongly (r > 0.40) with 2x and 9y. Therefore, it is possible to differentiate between the three species for both sexes using the four landmarks: 2, 4, 7 and 9. Scatterplots show clear separation between the species based on these discriminant functions (Fig. 7) and highlight the small size of the cryptic species compared with D. serrata and D. birchii, as well as the difference in shape between D. birchii and D. serrata with the cryptic species being intermediate. Overall, the cryptic species was clearly separated on the basis of these functions. For the females, all of the cryptic species were correctly identified, none of the D. serrata were assigned as the cryptic species, and only two D. birchii (1.5%) were incorrectly assigned to this group. For the males, all members of the cryptic species were identified as belonging to this group whereas only one D. birchii (<1%) and no D. serrata were assigned to the cryptic species.

image

Figure 7. Scatterplots of the first two canonical functions from a discriminant analysis comparing the species for wing centroid size and the x and y Procrustes coordinates. The first canonical function largely describes wing size, whereas the second function describes shape.

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Laboratory stocks
  6. Crosses
  7. Microsatellite variation
  8. ND5 sequence data
  9. Distribution
  10. Development time, viability, size and shape
  11. Results
  12. Crosses
  13. Reproductive isolation
  14. Microsatellite variation
  15. ND5 sequence data
  16. Distribution
  17. Development time, viability, size and shape
  18. Discussion
  19. Acknowledgments
  20. References

The crossing data clearly indicate three Australian species that closely resemble each other morphologically, including a new cryptic species that is reproductively isolated from both D. serrata and D. birchii. Based on keys for Drosophila species in Australia (Bock, 1982), the cryptic species would previously have been classified as D. serrata (both D. serrata and the cryptic species possess two subequal medial black bristles on the secondary clasper). We can therefore discount the possibility of the cryptic species being D. dominicana, which has a secondary clasper possessing two very large bristles and another somewhat smaller bristle located anteriorly (Ayala, 1965a). Unfortunately, it is impossible to make any direct comparisons between the cryptic species and D. dominicana as the latter has not been collected for over four decades and to our knowledge there are no extant cultures. The microsatellite and mitochondrial DNA data show that there is substantial genetic divergence between D. serrata, D. birchii and the cryptic species. To what extent can these findings clarify previous research on this group, and to what extent do these findings have the potential to complicate interpretations in previous studies of the D. serrata species complex?

Close scrutiny of the literature has failed to reveal any record of complete reproductive isolation when crossing populations of D. serrata (such results could indicate attempts to cross the cryptic species with D. serrata). However, an early study by Ayala (1965a) does report partial reproductive isolation between populations of D. serrata. For example, in crosses between Sydney females and Cooktown males, Ayala found that only 48% of females were inseminated, whereas 100% of females were inseminated in the reciprocal cross. It should be noted that although the Wolbachia endosymbiont is known to produce unidirectional cytoplasmic incompatibility in some Drosophila species (Hoffmann & Turelli, 1997), it has not been detected in D. serrata (Clancy & Hoffmann, 1997). Further, Ayala determined incompatibility by examining females for the presence or absence of sperm, thus rendering the effect of Wolbachia infection irrelevant. We would therefore not expect such unidirectional isolation in crosses involving D. serrata. However, if some of the massbred populations contained both D. serrata and the cryptic species then there are two possible scenarios that would result in unidirectional partial reproductive isolation. The first situation is a cross containing females of both species crossed with males of only one species. However, this was not responsible for the partial reproductive isolation observed by Ayala as the populations needed to be contaminated with the cryptic species (Sydney in the example cited) lie well beyond the cryptic species range. The second possibility would result from females of the same or primarily one species, crossed with a disproportionate ratio of males favouring the species least represented in the females. This is plausible considering the small subsets used by Ayala in the crosses (10 females and 10 males), and the fact that development times differ for D. serrata and the cryptic species (ratios of taxa would depend on the time at which virgins were collected). Thus, in the example cited, D. serrata females from Sydney, crossed with Cooktown males of both species (D. serrata being under-represented), could result in partial reproductive isolation if the D. serrata male/s died early on in the experiment or did not have enough sperm to inseminate all females. Alternatively, what appears to be partial reproductive isolation, may simply be an artefact arising from the experimental design (crosses where you would expect 100% insemination rates did not always act accordingly).

Drosophila serrata and D. birchii have been used as model systems to investigate the evolution of mate recognition (Higgie et al., 2000; Blows & Higgie, 2002). These authors have shown that there is reproductive character displacement of cuticular hydrocarbons in D. serrata when sympatric with D. birchii. They have shown that natural selection on mate recognition may be responsible for the reproductive character displacement in D. serrata when sympatric with D. birchii. These conclusions could be influenced by inaccurate identification of D. serrata. However, all populations of D. serrata used in these studies displayed no sexual isolation among them [M. Blows, personal communication (2003)], confirming that the populations from northern regions were all D. serrata at the time crosses were undertaken.

Another issue raised by our data concerns hybridization experiments between D. serrata and D. birchii. In the generation of some hybrids, populations of D. serrata were obtained south of the border of the distribution of the cryptic species (Blows & Allan, 1998) suggesting that D. serrata has been successfully crossed with D. birchii. However, in other crosses, flies were sourced from locations that we now know to be inhabited by both the cryptic species and D. serrata. For instance, Blows & Allan (1998) also obtained hybrids from ‘D. serrata’ collected at Townsville, and Hercus & Hoffmann (1999) created hybrids with flies sourced from Paluma and Kirrama. The cryptic species may hybridize more readily to D. birchii but insufficient data are available to draw any conclusions.

The D. serrata clines characterized by Hallas et al. (2002) for stress resistance and body size, and by Hoffmann & Shirriffs (2002) for wing shape could be influenced by the presence of the cryptic species. The clines in cold and starvation resistance were linear and evident from sites south of the distribution of the cryptic species (Hallas et al., 2002). The cryptic species therefore does not influence these patterns. However, the size and shape clinal data both indicate sudden changes at northern latitudes where the cryptic species occurs. Given the differences in size and shape among the species, these patterns are likely to reflect the presence of the cryptic species in the northern collections. We have checked preserved flies from the stocks used by Hallas et al. (2002) and Hoffmann & Shirriffs (2002) and found the cryptic species to be represented by some of the lines. Note that these findings do not negate the presence of clinal variation in wing shape in D. serrata described in Hoffmann & Shirriffs (2002); there was a linear cline in outer wing aspect (a shape measure) at sites south of the distribution of the cryptic species, which changed abruptly only at locations where the cryptic species occurs.

The results completely explain the anomalous patterns described in Kelemen & Moritz (1999). The sequence information for ND5 and the phylogenetic analysis indicate that the ‘northern D. serrata’ clade identified by these authors corresponds to the cryptic species whereas the ‘southern’ clade corresponds to D. serrata. This therefore confirms their first hypothesis that divergence observed in D. serrata lines was due to the presence of a reproductively isolated but morphologically similar taxon. Kelemen & Moritz (1999) did not find D. serrata overlapping with their northern group, however, this species frequently occurs in the areas they sampled. This may reflect their sampling sites (rainforest habitat vs. areas fringing rainforests) and/or seasonal changes in the relative abundance of D. serrata and the cryptic species. Our collection information suggests that D. serrata is more commonly found in rainforest fringes, during drier months, consistent with the high desiccation resistance of this species relative to D. birchii (Hoffmann, 1991). Furthermore, the identification of the cryptic species disproves the suggestion of a large phylogeographic break within D. serrata (Kelemen & Moritz, 1999). Interestingly, the southern border of the cryptic species occurs at Townsville just north of the Burdekin Gap, which is a well-documented major biogeographic barrier (Joseph & Moritz, 1994).

The molecular data indicate that the three species can be readily separated by either microsatellite or mitochondrial DNA markers. It is also possible to differentiate between the species using morphological characters (setation of the primary clasper and colour of the cercus) of both field and laboratory reared flies. When flies are reared at 19 °C the species can also be largely separated by wing size and wing shape. However, these characters are not diagnostic for field flies as both wing size and shape in Drosophila can change when flies are reared at different temperatures. In D. serrata, differences in wing size among populations in field flies are maintained when flies are reared in the laboratory (Jenkins & Hoffmann, 2000) but because the three species are often not collected at the same site or present at the same time, they cannot be identified based on size and shape alone.

The discovery of this new species provides a cornucopia of avenues for future research into this group. To what extent does the presence of the cryptic species influence reproductive character displacement inD. birchii and D. serrata? Does this species exhibit clinal patterns that match those in D. serrata? What is the relationship between the cryptic species and other montium subgroup species within Australia and elsewhere, including the elusive D. dominicana? No doubt the D. serrata species complex will continue to serve as an interesting model for evolutionary studies for many years to come.

Acknowledgments

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Laboratory stocks
  6. Crosses
  7. Microsatellite variation
  8. ND5 sequence data
  9. Distribution
  10. Development time, viability, size and shape
  11. Results
  12. Crosses
  13. Reproductive isolation
  14. Microsatellite variation
  15. ND5 sequence data
  16. Distribution
  17. Development time, viability, size and shape
  18. Discussion
  19. Acknowledgments
  20. References

The authors thank J. Dean, K. Guthridge, R. Hallas, J. Shirriffs, and K. Viduka for technical assistance, as well as M. Blows, S. McEvey, A. Magiafoglou, M. Ritchie, C. Sgrò, A. Weeks and an anonymous reviewer for comments on the paper and advice with analysis and taxonomy. The authors are also grateful to M. Higgie who provided some of the field flies. This research was supported by the Australian Research Council via their Special Research Centre Scheme and by a Systematic Infrastructure Grant from the Department of Employment, Training and Youth Affairs.

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Laboratory stocks
  6. Crosses
  7. Microsatellite variation
  8. ND5 sequence data
  9. Distribution
  10. Development time, viability, size and shape
  11. Results
  12. Crosses
  13. Reproductive isolation
  14. Microsatellite variation
  15. ND5 sequence data
  16. Distribution
  17. Development time, viability, size and shape
  18. Discussion
  19. Acknowledgments
  20. References
  • Ayala, F.J. 1965a. Sibling species of the Drosophila serrata group. Evolution 19: 538545.
  • Ayala, F.J. 1965b. Drosophila dominicana, a new sibling species of the serrata group. Pacific Insects 7: 620622.
  • Ayala, F.J. 1965c. Relative fitness of populations of Drosophila serrata and Drosophila birchii. Genetics 51: 527544.
  • Ayala, F.J. 1966. Reversal of dominance in competing species of Drosophila. Am. Nat. 100: 8183.
  • Berrigan, D. & Hoffmann, A.A. 1998. Correlations between measures of heat resistance and acclimation in two species of Drosophila and their hybrids. Biol. J. Linn. Soc. 64: 449462.
  • Birch, L.C., Dobzhansky, T., Elliott, P.O. & Lewontin, R.C. 1963. Relative fitness of geographic races of Drosophila serrata. Evolution 17: 7283.
  • Blows, M.W. 1993. The genetics of central and marginal populations of Drosophila serrata. II. Hybrid breakdown in fitness components as a correlated response to selection for desiccation resistance. Evolution 47: 12711285.
  • Blows, M.W. 1998. Evolution of a mate recognition system after hybridization between two Drosophila species. Am. Nat. 151: 538544.
  • Blows, M.W. & Allan, R.A. 1998. Levels of mate recognition within and between two Drosophila species and their hybrids. Am. Nat. 152: 826837.
  • Blows, M.W. & Higgie, M. 2002. Evolutionary experiments on mate recognition in the Drosophila serrata species complex. Genetica 116: 239250.
  • Bock, I.R. 1976. Drosophilidae of Australia I. Drosophila (Insecta: Diptera). Aust. J. of Zool. Suppl. Ser. 40: 1105.
  • Bock, I.R. 1977. Notes on the Drosophilidae (Diptera) of Townsville, Queensland, including four new Australian species records. J. Aust. Entomol. Soc. 16: 267272.
  • Bock, I.R. 1982. Drosophilidae of Australia. V. Remaining genera and synopsis (Insecta: Diptera). Aust. J. Zool. Suppl. Ser. 89: 1164.
  • Bock, I.R. & Wheeler, M.R. 1972. The Drosophila melanogaster Species Group. In: Studies in Genetics VII (M.R. Wheeler, ed.), pp. 1102. The University of Texas Publication No 7213, Texas.
  • Clancy, D.J. & Hoffmann, A.A. 1997. Behavior of Wolbachia endosymbionts from Drosophila simulans in Drosophila serrata, a novel host. Am. Nat. 149: 975988.
  • Dobzhansky, T. & Mather, W.B. 1961. The evolutionary status of Drosophila serrata. Evolution 15: 461467.
  • Hallas, R., Schiffer, M. & Hoffmann, A.A. 2002. Clinal variation in Drosophila serrata for stress resistance and body size. Genet. Res. 79: 141148.
  • Hercus, M.J. & Hoffmann, A.A. 1999. Desiccation resistance in interspecific Drosophila crosses: genetic interactions and trait correlations. Genetics 151: 14931502.
  • Higgie, M., Chenoweth, S. & Blows, M.W. 2000. Natural selection and the reinforcement of mate recognition. Science 290: 519521.
  • Hoffmann, A.A. 1991. Acclimation for desiccation resistance in Drosophila: species and population comparisons. J. Insect. Physiol. 37: 757762.
  • Hoffmann, A.A. & Shirriffs, J. 2002. Geographic variation for wing shape in Drosophila serrata. Evolution 56: 10681073.
  • Hoffmann, A.A. & Turelli, M. 1997. Cytoplasmic incompatibility in insects. In: Influential Passengers – Inherited Microorganisms and Arthropod Reproduction (S. L.O'Neill, A. A.Hoffmann & J. H.Werren, eds), pp. 380. Oxfrod University Press, New York.
  • Jenkins, N.L. & Hoffmann, A.A. 2000. Variation in morphological traits and trait asymmetry in field Drosophila serrata from marginal populations. J. Evol. Biol. 13: 113130.
  • Joseph, L. & Moritz, C. 1994. Mitochondrial DNA phylogeography of birds in eastern Australian rainforests: first fragments. Aust. J. Zool. 42: 385403.
  • Kelemen, L. & Moritz, C. 1999. Comparative phylogeography of a sibling pair of rainforest Drosophila species (Drosophila serrata and D. birchii). Evolution 53: 13061311.
  • Klingenberg, C.P. & McIntyre, G.S. 1998. Geometric morphometrics of developmental instability: analyzing patterns of fluctuating asymmetry with Procrustes methods. Evolution 52: 13631375.
  • Klingenberg, C.P., Barluenga, M. & Meyer, A. 2002. Shape analysis of symmetric structures: quantifying variation among individuals and asymmetry. Evolution 56: 19091920.
  • van Klinken, R.D. & Walter, G.H. 2001. Larval hosts of Australian Drosophilidae (Diptera): a field survey in subtropical and tropical Australia. Aust. J. Entomol. 40: 163179.
  • van Klinken, R.D., Walter, G.H. & Ross, M.K. 2002. Drosophilidae (Diptera) of Australia's Northern Territory: ecology and biogeography. Aust. J. Entomol. 41: 236242.
  • McEvey, S.F. 1993. Drosophilidae (Diptera) of Northern Cape York Peninsula. In: Cape York Peninsula Scientific Expedition, Wet Season 1992. pp. 155168. The Royal Geographic Society of Queensland Inc., Fortitude Valley, Brisbane.
  • Magiafoglou, A., Carew, M.E. & Hoffmann, A.A. 2002. Shifting clinal patterns and microsatellite variation in Drosophila serrata populations: a comparison of populations near the southern border of the species range. J. Evol. Biol. 15: 763774.
  • Malloch, J.R. 1927. Notes on Australian Diptera No. X. Proc. Linn. Soc. New South Wales 52: 116.
  • Mather, W.B. 1955. The genus Drosophila (Diptera) in eastern Queensland. I. Taxonomy. Aust. J. Zool. 3: 545582.
  • Mather, W.B. 1968. The genus Drosophila in New Guinea and Sabah. Univ. Qld. Pap., Dep. Zool. 3: 4750.
  • Pissios, P. & Scouras, Z.G. 1993. Mitochondrial DNA evolution in the montium-species subgroup of Drosophila. Mol. Biol. Evol. 10: 375382.
  • Raymond, M. & Rousset, F. 1995. GENEPOP (version 1.2): a population genetics software for exact tests and ecumenicism. J. Hered. 86: 248249.
  • Spieth, H.T. & Ringo, J.M. 1983. Mating behavior and sexual isolation in Drosophila. In: The Genetics and Biology of Drosophila, Vol. 3C. (M.Ashburner, H. L.Carson & J. N.Thompson, eds), pp. 223284. Academic Press, London.
  • Thompson, J.D., Higgins, D.G. & Gibson, T.J. 1994. Clustal W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position specific gap penalties and weight matrix choice. Nucleic Acids Res. 22: 4673–4680.