Fibrinogen interactions with ICAM-1 (CD54) regulate endothelial cell survival

Authors


: S. E. D'Souza, Department of Molecular Cardiology/NB-50, The Cleveland Clinic Foundation, 9500 Euclid Avenue, Cleveland, OH 44195, USA. Fax: + 1 216 445 8204, Tel.: + 1 216 445 8205, E-mail: dsouzas@ccf.org

Abstract

We tested hypothesis that the interaction of fibrinogen (Fg) with intercellular adhesion molecule 1 (ICAM-1) mediates cellular adhesion and cell proliferation. Our results demonstrate that Fg : ICAM-1 ligation mediates endothelial cell survival and has an anti-apoptotic effect via activation of the MAP kinase pathway. Fg : ICAM-1 ligation in endothelial cells treated with tumor necrosis factor (TNF)α resulted in the hyperphosphorylation of extracellular signal-regulated kinase (ERK)-1/2 (eightfold to 10-fold) at 5–30 min. The specificity of ERK-1/2 phosphorylation was verified using the recognition peptides Fg-γ-(117–133) and ICAM-1(8–22). ERK-1/2 hyperphosphorylation was dependent on intact cytoskeleton, as treatment with cytochalasin B and nocodazole blocked this activity. The attachment of TNFα-treated endothelial cells to fibrinogen or Fg-γ-(117–133) resulted in cell survival, as assessed by an annexin V binding assay. ICAM-1(8–22) blocked the survival process. The MEK-1 inhibitor PD 98059 blocked ERK-1/2 phosphorylation, and treatment of endothelial cells with PD 98059 resulted in apoptosis even upon Fg : ICAM-1 ligation. Cells transfected with dominant-negative ERK-1/2 underwent apoptosis upon Fg : ICAM-1 ligation. Cell survival factor A1 was specifically upregulated upon adhesion of TNFα-stimulated endothelial cells to Fg. A1 expression was blocked by ICAM-1(8–22) and PD 98059. The Fg : ICAM-1 endothelial cell survival pathway appears to be mediated via the activation and upregulation of ERK-1/2 and A1.

Abbreviations
DMEM F-12

Dulbecco's modified Eagle's medium Ham's F-12

ECs

endothelial cells

ERK-1/2

extracellular signal-regulated kinase-1/2

FAK

focal adhesion kinase

Fg

fibrinogen

HBSS

Hank's balanced salt solution

HUVEC

human umbilical vein endothelial cells

ICAM-1

intercellular adhesion molecule-1

IMDM

Isove's modified Dulbecco's medium

MAPK

mitogen-activated protein kinase

MAPKK

mitogen-activated protein kinase kinase

MEK-1

mitogen-activated ERK kinase-1

PLL

poly(l-lysine)

PY

phosphotyrosine

RGD

the sequence Arg-Gly-Asp

TNF

tumor necrosis factor

The expression of intercellular adhesion molecule-1 (ICAM-1, also termed CD54) on endothelial cells (ECs) is dependent upon the presence of cytokines such as tumor necrosis factor (TNF)α and interleukin (IL)-1. The interaction of ICAM-1 with integrins (αLβ2 and αMβ2) results in the adhesion of leukocytes to the endothelium and in the transmigration of leukocytes to the site of inflammation [1,2]. The plasma protein fibrinogen (Fg), which is the critical component in the blood coagulation cascade, is a ligand for both ICAM-1 and αMβ2. Leukocytes are therefore able to adhere to the endothelium via an alternative process that involves the αMβ2-bound Fg interactions with ICAM-1 [3,4]. Fg : ICAM−1 interactions are implicated in the adhesion of platelets to ECs [5], in the vasorelaxation of canine saphenous veins [6] and in the proliferation of B-lymphoid Raji cells [7]. The recognition sequences ICAM-1(8–22) and Fg-γ-(117–133) participate in cellular interactions mediated via Fg : ICAM-1, including mitogenesis [7–9]. ICAM-1(8–22), contained within the first immunoglobulin (Ig)-like motif of ICAM-1, blocks Fg-induced cell proliferation and signals in Raji cells [7,10]. The Fg-γ-(117–133) sequence resides within the γ-chain of Fg and is retained in fragment D of Fg [8]. Fragment D (100 kDa) is obtained upon digestion of Fg with plasmin. Fg-γ-(117–133) binds directly to ICAM-1 and induces mitogenic signals in Raji cells [7,10].

ICAM-1 is a transmembrane glycoprotein with a short cytoplasmic tail of ≈ 28 amino acids [2]. This short intracellular sequence in ICAM-1 has been reported to generate the phosphorylation of the Src kinase substrate, cortactin, upon ligation of β2 integrins (derived from activated T cells) with ICAM-1 on ECs [11]. Cross-linking of ICAM-1 with antibodies on rat brain microvessel-derived ECs resulted in activation of the small GTP-binding protein Rho [12]. The activation of Rho has been implicated in leukocyte transmigration [13]. In Raji cells, Fg : ICAM-1 ligation resulted in activation of the Src family kinases and the mitogen-activated protein kinases (MAPKs) [10]. Two isoforms of MAPK, the p42 MAPK [extracellular signal-regulated kinase (ERK)-2] and the p44 MAPK (ERK-1), are expressed in most cell types sharing 80% amino-acid sequence identity. In Raji cells, ERK-1/2 phosphorylation was increased by a modest twofold to threefold compared with cells incubated in the absence of Fg. The recognition sequences within Fg and ICAM-1 regulated the signals to modulate Fg-induced mitogenesis [10].

ERK-1/2 activation is involved in a variety of cellular events, such as differentiation, cell attachment and migration, and proliferation [14–17]. As cellular adhesive and migratory interactions on the endothelium are augmented under inflammatory conditions [3–5], it was of interest to investigate the effects mediated via Fg : ICAM-1 on ECs. We used TNFα, as an inflammatory cytokine, to upregulate ICAM-1 expression on ECs. TNFα, however, has an apoptotic effect on these cells. In earlier studies, including ours on Raji cells, the use of cytokines was not required because ICAM-1 was expressed constitutively on the cell types used [7,10–13]. This study attempted to define the role of ERK-1/2 activation upon Fg : ICAM-1 ligation in ECs in the context of TNFα. Our results indicate that ERK-1/2 becomes dramatically phosphorylated (eightfold to 10-fold) upon Fg : ICAM-1 ligation in TNFα-stimulated ECs. The kinetics of ERK-1/2 activation in TNFα-stimulated ECs was found to be different to those noted on Raji cells [10]. More importantly, ICAM-1 ligation to Fg modulated EC survival, which was dependent upon ERK-1/2 activation. Fg-γ-(117–133) promoted the survival process of TNFα-stimulated ECs, but not of resting nonstimulated ECs. ICAM-1(8–22) specifically blocked the survival of TNFα-stimulated ECs.

Members of the Bcl−2 family play a key role in inhibiting and promoting cell death [18]. Prosurvival homologs include Bcl-2, Bcl-XL, Bcl-w and the recently described A1 (bfl-1) [19,20]. A1 has been reported to become induced upon TNFα stimulation in ECs [21]. In our studies, A1 was specifically upregulated upon Fg : ICAM-1 ligation. Blockage of Fg : ICAM-1 ligation with ICAM-1(8–22) downregulated A1 expression. A1 expression was also blocked by inhibiting ERK-1/2 activation with the antagonist PD 98059. This is the first report to demonstrate the involvement of ICAM-1 in cell survival. The Fg–ICAM-1 anti-apoptotic pathway may play a role in the endothelial repair process in inflammatory diseases, such as atherosclerosis, or in the development of restenosis following angioplasty.

Materials and methods

Reagents and antibodies

TNFα was purchased from Genzyme (Boston, MA, USA). BSA, dimethylsulfoxide and poly(l-lysine) (PLL) were purchased from Sigma Chemicals (St. Louis, MO, USA). PD 98059, a specific inhibitor of MAP kinase kinase-1 (MEK-1) [22], geldanamycin and PP2 (the inhibitors of pp60src), nocodazole and cytochalasin D, inhibitors of microtubule assembly and actin polymerization, respectively, were purchased from Calbiochem (San Diego, CA, USA). These inhibitors were stored at 10 mm in dimethylsulfoxide at −20 °C. Recombinant protein G–Sepharose was from Zymed Laboratories (South San Francisco, CA, USA). Both γ-[32P]-ATP and the p42/p44 MAPK enzyme assay system were purchased from Amersham Life Sciences (Piscataway, NJ, USA). The apoptosis assay kit utilizing annexin V binding was purchased from R&D Systems, Inc. (Minneapolis, MN, USA).

Clone 4G10, an antiphosphotyrosine mAb was obtained from Upstate Biotechnology (Lake Placid, NY, USA). The polyclonal antiphosphotyrosine raised in rabbit was from Zymed Laboratories. The mAbs anti-ERK-1/2, anti-focal adhesion kinase (FAK), anti-SHP-1 and polyclonal rabbit anti-Shc were from Transduction Laboratories (Lexington, KY, USA). Monoclonal antiphospho p42/p44 MAPK was from New England Biolabs (Beverly, MA, USA). Polyclonal anti-pp60src was from Santa Cruz Biotechnology (Santa Cruz, CA, USA). The anti-ICAM-1 mAbs 84H10 and LB-2 were from AMAC International (Westbrook, ME, USA) and Becton Dickinson (San Jose, CA, USA), respectively. The peroxidase-linked goat anti-mouse IgG and anti-rabbit IgG were from Biorad Laboratories (Richmond, CA, USA).

Synthetic peptides

Peptides with amino-acid sequences corresponding to regions of Fg and ICAM-1 were synthesized by solid-phase synthesis on an Applied Biosystems model 430A peptide synthesizer (Foster City, CA, USA), using N-(9-fluorenyl)methoxycarbonyl chemistry. Specific sequences were ICAM-1(8–22) KVILPRGGSLVTCS, ICAM-1(130–145) REPAVGEPAEVTTTV, Fg-γ-(117–133) NNQKIVNLKEKVAQLEA, scrambled peptide Fg-γ-(117–133)scr ALENAEVQNLVKKIQKN, Fg-γ-(124–133) LKEKVAQLEA and Fg-Aα-(571–576) GRGDSP. The cleaved peptides were purified by HPLC and purity was checked by mass spectrometry [7,9].

Cell culture

Human umbilical vein endothelial cells (HUVECs) were obtained from umbilical cord veins as described previously [9,23]. Cells were plated on tissue culture-treated polystyrene plates (Costar Corp., Cambridge, MA, USA) coated with 1.0 µg·cm−2 human fibronectin (Boehringer Mannheim, Indianapolis, IN, USA) and grown in Dulbecco's modified Eagle's medium Ham's F-12 (DMEM F-12; BioWhittaker, Walkersville, MD, USA) supplemented with 15% fetal bovine serum, 90 µg·mL−1 heparin (Sigma) and 150 µg·mL−1 EC growth supplements (Clonetics, San Diego, CA, USA). ECs from passages 2–4 were used for this study.

Transfection of HUVECs with dominant-negative and wild-type ERK-1/2

The wild-type MAPK (wild-type ERK-2) and dominant-negative MAPK (dominant negative mutant of ERK-2) constructs used in this study were provided by Dr Andrew Larner (Cleveland Clinic Foundation, Cleveland, OH, USA) [24,25]. To generate clones that transiently expressed either wild-type or dominant-negative MAPK, ECs were transfected with the corresponding constructs in pcDNA3 (Invitrogen, Carlsbad, CA, USA), a mammalian expression vector containing a neomycin-resistant gene, using Lipofectamine Plus reagent (Gibco BRL, Rockville, MD, USA) as follows. ECs (passage 2) grown to ≈ 70% confluency on a six-well plate (Costar) were incubated with 3 µg of DNA with Lipofectamine-Plus reagent in serum-free DMEM F-12 medium for 5 h at 37 °C at 5% CO2. After 5-h incubation, the medium containing the complexed DNA was replaced with fresh complete medium and incubated for 24 h. Transfectant cells were selected by treatment with up to 200 µg·mL−1 neomycin (Invitrogen) in complete medium for 5 days. Neomycin-resistant colonies were expanded and maintained in complete medium containing 50 µg·mL−1 neomycin.

Preparation of Fg and fragments of Fg

Fg was purified from fresh human plasma by cryoethanol precipitation [26]. The isolated material was estimated to comprise > 95% Fg using electrophoresis separation. The presence of fibrinopeptides A and B in the Fg preparations was analyzed by elution on a Sephapak C18 HPLC column using standard preparations of each of the fibrinopeptides (Sigma). At a protein concentration at least 50-fold greater than those used in experiments, amounts of fibrinopeptides A and B were below detectable levels. Fragments X, D100 and E were obtained by plasmin digestion of Fg and were purified by ion-exchange chromatography using a 0–200-mm NaCl gradient [7,26]. The molecular masses of fragments X, D100 and E were 245, 100 and 45 kDa, respectively, as estimated by 5–15% gradient SDS/PAGE. The fragments were dialyzed against 0.14 m NaCl/Pi.

Fluorescence-activated cell sorting

Resting and TNFα-stimulated ECs were removed by brief trypsin treatment and washed in Dulbecco's NaCl/Pi. Cells were resuspended in a staining medium of Hank's balanced salt solution (HBSS), containing 2.0 mm CaCl2, 2.0 mm MgCl2, 10 mm Hepes (pH 7.4) and 0.1% BSA and incubated at 4 °C for 30 min with 5.0 µg·mL−1 of either control mouse IgG, the anti-αvβ3 mAb LM 609 or the anti-ICAM-1 mAb LB-2. Cells were centrifuged through a cushion of fetal calf serum and resuspended in staining medium containing 50 µg·mL−1 fluoresceine isothiocyanate (FITC)-conjugated goat anti-mouse IgG sera (Zymed Laboratories) for 30 min at 4 °C. Cell-bound antibodies were detected using a FACScan and analyzed on the lysis program (Becton Dickinson).

Adhesion assay

The six-well tissue culture plates or Petri dishes (Corning, NY, USA) were coated with human Fg, Fg fragments (200 nm in NaCl/Pi) or peptides (200 µm in NaCl/Pi) for 16 h at 4 °C. The plates were blocked with 1% heat-inactivated BSA in NaCl/Pi for 1 h at room temperature. Prior to use, plates were rinsed three times with NaCl/Pi. ECs were maintained in Iscove's modified Dulbecco's medium (IMDM) containing 1% fetal calf serum for 18 h prior to the commencement of an experiment. In addition to serum deprivation, some cells were stimulated with TNFα (10 ng·mL−1) for 18 h. Cells were trypsinized briefly (BioWhittaker, Inc.), harvested by low-speed centrifugation (200 g for 5 min) and resuspended in the medium. ECs were seeded onto culture plates coated with proteins or peptides at 3 × 105 cells per well and incubated at 37 °C for 15, 30, 60 or 120 min. Cells were then processed for Western blot analysis, annexin V binding assay or total RNA or genomic DNA extraction.

Western blot analysis

After treatment, cells were washed with NaCl/Pi and incubated on ice for 10 min with 100 µL of ice-cold lysis buffer (10 mm Tris, pH 7.5, 5 mm EDTA, 50 mm sodium pyrophosphate, 50 mm NaF, 50 mm NaCl, 0.5% Triton X-100, 0.1% SDS, 1% NP-40, 0.1 mm Na3VO4 and 1 mm phenylmethylsulfonyl fluoride). Cells were scraped from the plates and lysates were clarified by centrifugation at 14 000 g for 15 min at 4 °C. Supernatants were assayed for protein concentration using bicinchroninic acid reagents (Pierce Chemicals, Rockford, IL) according to manufacturer's instructions. Laemmli sample buffer was added to equal amounts of soluble protein in the supernatant, and the lysates were analyzed by 8% SDS/PAGE and transferred to nitrocellulose membranes (Biorad, Hercules, CA, USA). Membranes were blocked with 5% BSA in Tris-buffered saline, pH 7.4, for 1 h at room temperature and immunoblotted with the primary anti-(phosphotyrosine 4G10), anti-(phospho-ERK-1/2) or anti-(ERK-1/2) mAb followed by 1 : 10 000 dilution of peroxidase-conjugated goat anti-(mouse IgG) secondary serum. Immunoblots were developed using enhanced chemiluminescence (Pierce Chemicals). Some blots were stripped using stripping buffer (0.1 m glycine, pH 2.8, 3 m NaCl, 0.1% Tween 20) with constant shaking at room temperature for 30 min. Membranes were rinsed several times with Tris-buffered saline, blocked with 5% BSA for 1 h and reprobed with other antibodies. The tyrosine phosphorylation of proteins in the Western blots was quantitated by laser scanning densitometry using Photoshop (Adobe Systems, Inc., San Jose, CA, USA) and the computer image analysis software NIH Image (Research Services Branch, National Institutes of Health, Bethesda, MD, USA).

The p42/p44 MAPK (ERK-1/2) activity assay

After treatment, cells were lysed in 100 µL of modified lysis buffer (10 mm Hepes, pH 7.4, 5 mm EDTA, 5 mm EGTA, 50 mm NaF, 50 mm sodium pyrophosphate, 50 mm NaCl, 0.1 mm Na3VO4, 0.1% Triton X-100 and 1 mm phenylmethylsulfonyl fluoride). Cell lysates were prepared by freezing on dry ice, thawing on ice and scraping. After centrifugation for 15 min at 16 000 g (4 °C), the protein concentration was determined using bicinchroninic acid. The p42/p44 MAPK activity was determined in cell lysates using the p42/p44 MAPK activity assay system (Amersham Life Sciences, Piscataway, NJ, USA) according to manufacturer's instructions. Cell lysates were incubated with the specific substrate peptide and γ-[32P]-ATP for 30 min at 30 °C. The reaction was terminated with a stop reagent. Reaction mixtures were applied onto paper disks, which were washed twice with 1% acetic acid and twice with water. The amount of 32P incorporated into the substrate was counted in a beta counter (LS 380, Beckman Instruments, Fullerton, CA, USA).

Immunoprecipitation

ERK-1/2, FAK, pp60src, Shc, SHP-1 and tyrosine phosphorylated proteins were purified from cell lysates by immunoprecipitation. Cells were lysed as described and precleared by incubation with 20 µL of protein G–Sepharose (Zymed). Aliquots containing equivalent amounts of protein (400 µg) were mixed with 1–2 µg of specific respective antibody overnight at 4 °C. The immune complexes were recovered by the addition of 30 µL recombinant protein G–Sepharose and incubated for 4 h at 4 °C. Sepharose beads were washed twice with NaCl/Pi with NaCl adjusted to 1.0 m containing 0.1 mm Na3VO4, and twice with NaCl/Pi containing 0.1 mm Na3VO4. Precipitated immune complexes were extracted from the Sepharose beads by boiling in nonreducing SDS gel loading buffer and were subjected to Western blot analysis.

Annexin V binding assay

Adherent cells were trypsinized briefly, washed once with calcium-enriched binding buffer (1 × 105 in 0.1 mL) and incubated with FITC-labeled annexin V (R&D Systems) for 15 min at room temperature; 100 µL of binding buffer was then added. Annexin V–FITC-stained cells were detected by FACS analysis.

RNA extraction and RT-PCR assay

Total RNA was extracted from adherent cells using Qiagen RNeasy kit (Qiagen, Inc., Valencia, CA, USA) according to manufacturer's instructions. Briefly, 4 × 106 cells were lysed and homogenized under highly denaturing conditions (guanidinium isothiocyanate and 2-mercaptoethanol), cell lysates were then applied to an RNeasy spin column containing a silica membrane, and contaminants were washed away, followed by RNA elution with 100 µL of water. One microgram of RNA was reverse transcribed using Moloney murine leukemia virus reverse transcriptase and random hexamer primers (Gibco BRL). RT-PCR analysis of cDNA was conducted in 50 µL reactions using PlatinumTaq DNA polymerase (Gibco BRL) and the following primers: A1 forward, CTCCACCAGGCAGAAGATGACGACAGA; A1 reverse, ATGCCGTCTTCAAACTCCTTTTCCAT; Bcl-XL forward, GCTGGAGTCAG-TTTAGTGATGTGGAA; Bcl-XL reverse, GTGGAGCTGGGATGTCAGGTC; Bcl-2 forward, GTAAGCACCACTGCATTTCAGGAA; Bcl-2 reverse, TGTTGTCCCTTTGA-CCTTGTTTCTTG; GAPDH forward, CTACTGGCGCTGCCAAGGCTGT; GAPDH reverse, GCCATGAGGTCCACCACCATG. The reaction was conducted for 35 cycles using an annealing temperature of either 56 °C, yielding a 264 and 295-nucleotide product from A1 and Bcl-2 cDNA, respectively, or 60 °C, yielding a 272 and 390-nucleotide product from Bcl-XL and GAPDH cDNA, respectively. PCR products were fractionated by 2% agarose gel electrophoresis and photographed under UV illumination. Band intensities were quantified by laser densitometric scanning (Molecular Dynamics, Sunnyvale, CA, USA).

Nucleosomal DNA degradation assay

Genomic DNA isolation was performed using the Qiagen Blood & Cell Culture mini kit (Qiagen, Inc.) according to the manufacturer's directions. Briefly, adherent cells were trypsinized and lysed with lysis buffer, the nuclei were pelleted at 4 °C for 15 min at 1300 g. The nuclei were lysed with lysis buffer followed by a 1-h incubation with Proteinase K at 50 °C. Nuclei lysates were passed through Qiagen Anion Exchange Resin followed by a salt wash. Genomic DNA was eluted in a high-salt buffer and then concentrated and desalted by isopropanol precipitation. After an alcohol wash (70% ethanol), the DNA was hydrated and quantified, and 20 µg was analyzed by 1.5% agarose gel electrophoresis.

Data analysis

The data are expressed as the mean ± SE. The paired Student's t-test was used to determine the significance of any differences between two groups, P < 0.05 was considered significant.

Results

Protein tyrosine phosphorylation upon adhesion of TNFα-stimulated ECs to Fg

To gain an understanding of the Fg : ICAM-1 adhesion pathway, we investigated the levels of tyrosine phosphorylation in resting and TNFα-stimulated ECs upon adhesion to Fg, PLL and BSA for 0–120 min at 37 °C. Equivalent amounts of cell lysate protein were Western blotted and probed with the anti-phosphotyrosine mAb (Fig. 1A). In resting ECs, the major proteins in which a specific increase in phosphorylation was detected were of approximate molecular masses 57 and 120 kDa. The phosphorylation of 43-kDa and 70-kDa proteins was rather modest and was observed at late time points (30–120 min). In TNFα-stimulated ECs, the 57-kDa and 120-kDa proteins were also phosphorylated, but the phosphorylation of proteins migrating at ≈ 43 and 70 kDa was much more robust (an eightfold increase) than in resting ECs. These proteins became highly phosphorylated within 5 min. Phosphorylation of the 43-kDa and 70-kDa proteins in stimulated ECs was sustained until 30 min, and by 60 min the proteins were dephosphorylated. In resting ECs phosphorylation of the 43-kDa and 70-kDa proteins was initiated after 30-min ligation to Fg and maintained at low levels thereafter. This distinct difference in the tyrosine phosphorylation pattern in resting and TNFα-stimulated ECs was not induced by TNFα itself, because we found that in cells adherent to PLL and transferrin and BSA (results not shown), protein phosphorylation was negligible. Through immunoprecipitation, the 120-kDa and 57-kDa proteins were identified as FAK and pp60src kinase, respectively. The phosphorylation level of these kinases was elevated marginally in TNFα-stimulated cells compared with levels in resting ECs (Fig. 1A). Through immunoprecipitation, using specific antibodies, the 43-kDa band was identified as ERK-1/2, a member of the MAPK family, and here we focused on the regulation and effect of ERK-1/2 activation on ECs. The identity of the phosphorylated proteins in the 70-kDa cluster is uncertain. However, adaptor protein Shc and phosphatase SHP-1 were found to be absent in the 70-kDa cluster.

Figure 1.

Tyrosine phosphorylation ofintracellular proteins (A) and the potent increase of ERK-1/2 phosphorylation (B) and enzymatic activity (C) in TNFα-stimulated ECs induced by Fg. (A) Resting and TNFα-stimulated ECs were detached from flasks using the cell dissociation buffer, washed with NaCl/Pi and seeded onto Fg-coated or PLL-coated plates at a density of 3 × 105 cells per well and incubated at 37 °C for 0–120 min. Adherent cells were washed and lysed as described in Materials and methods. The equivalent amounts of protein were separated on 8% polyacrylamide/SDS gels, then transferred to nitrocellulose membranes, which were probed with anti-phosphotyrosine. Bound antibody was detected using peroxidase-conjugated goat anti-(mouse IgG) Ig followed by enhanced chemiluminescence (representative of three experiments). (B) Resting and TNFα-stimulated ECs were allowed to adhere to Fg for the indicated times. Cells were lysed and ERK-1/2 was immunoprecipitated using anti-ERK-1/2 mAb from lysates containing equivalent amounts of protein. Immunocomplexes were captured using protein G–Sepharose and eluted with 2× Laemmli buffer. Western blots of captured ERK-1/2 were probed with antiphosphotyrosine mAb. Membranes were later stripped and reprobed with anti-ERK-1/2 mAb to determine equal loading of this kinase (lower). (C) Levels of kinase activity of ERK-1/2 were estimated in cell lysates containing the equivalent amounts of total protein using the p42/p44 activity assay system as described under Materials andmethods. Results shown are the mean ± SE of three replicate samples at each incubation time-point and are representative of two independent experiments. * Significantlydifferent from control (cells adherent to BSA) at P < 0.05 (Student's t-test).

Time-dependent ERK-1/2 activation in resting and TNFα-stimulated ECs after adhesion to Fg was verified by immunoprecipitation using anti-ERK-1/2 mAbs. Western blots of immunoprecipitates were probed with anti-phosphotyrosine and anti-ERK-1/2 antibodies. Figure 1B shows the robust (> 10-fold increase compared with that detected in cells seeded on PLL) phosphorylation of ERK-1/2 at early time points (5–30 min) in stimulated cells. In resting ECs, ERK-1/2 activation was maintained at a low level from 5 to 30 min, after which there was a steady increase (upper panel). The potent ERK-1/2 phosphorylation in stimulated cells diminished drastically at 60 min and thereafter remained at low levels. The lower portion of each panel demonstrates equal loading of ERK-1/2 isolated from cell lysates. As an added control, the pattern of ERK-1/2 phosphorylation upon ligation of stimulated ECs to another adhesive protein, fibronectin was studied. ERK-1/2 phosphorylation observed with fibronectin, was not as robust as that seen with Fg (data not shown). Figure 1C illustrates the time-dependent increase of ERK-1/2 activity in resting and TNFα-stimulated cells. ERK-1/2 activity was measured in cell lysates after adhesion to Fg or control BSA by estimation of the amount of 32P transferred by this kinase from γ-[32P]-ATP to a specific substrate peptide using the p42/p44 MAPK. The time-dependent changes of ERK-1/2 phosphorylation corresponded to the increased kinase activity. In TNFα-stimulated cells, ERK-1/2 activity peaked at 30 min and was 2.4-fold higher than in resting cells, whereupon it decreased rapidly by 1 h (Fig. 1C). At 30 min, the levels of ERK-1/2 in TNFα-stimulated ECs were significantly different to those in resting EC. In contrast to stimulated cells, in resting ECs activity was low at early time points and increased gradually until 60 min, then decreased slightly and was sustained at a constant level. In both resting and stimulated cells adherent to BSA, ERK-1/2 activity was negligible and remained unchanged. The kinetics of ERK-1/2 actvity correlated with ERK-1/2 phosphorylation (Fig. 1B) in both resting and stimulated cells. However, there was a clear discrepancy in the increases in the enzymatic levels of ERK-1/2 (2.4-fold) and the phosphorylation levels of ERK-1/2 (eightfold to 10-fold) noted in TNFα-stimulated ECs. The stability of the enzymatic activity under the assay conditions may account for this discrepancy. Such differences in ERK-1/2 enzymatic and phosphorylation levels have been reported in other systems [16].

Recognition sequences in Fg and ICAM-1 regulate ERK-1/2 in TNFα-stimulated ECs

A region of Fg encompassing amino acids 117–133 within the γ-chain has been reported to mimic Fg and bind ICAM-1 [7–9]. We investigated the capacity of this peptide to induce the phosphorylation of ERK-1/2 in TNFα-stimulated ECs. Equivalent amounts of protein (20 µg) from cell lysates after adhesion to peptides Fg-γ-(117–133), Fg-γ-(124–133) and Fg-Aα-(571–576) containing the Arg-Gly-Asp (RGD) sequence were analyzed by Western blotting using the anti-phosphotyrosine mAb 4G10. Figure 2A shows the large (sevenfold) enhancement of ERK-1/2 phosphorylation in TNFα-stimulated ECs adherent to the ICAM-1 recognition peptide Fg-γ-(117–133) at the 15-min time point (lane 1). Fg-γ-(124–133) induced ERK-1/2 phosphorylation to a slight extent (2.2-fold; lane 2), but the RGD-containing peptide (lane 3) failed to induce ERK-1/2 activity. ERK-1/2 activation was negligible in cells adherent to PLL. The Fg-γ-(117–133)-induced phosphorylation of ERK-1/2 was decreased upon adhesion for 120 min. In contrast, in resting ECs (Fig. 2A), neither Fg-γ-(117–133), Fg-γ-(124–133) nor Fg-Aα-(571–576) was able to stimulate ERK-1/2 activity, which was sustained at a low steady-state level. Equal loading of ERK-1/2 is shown in the bottom panels. The ICAM-1 recognition peptide Fg-γ-(117–133), but not the αvβ3 antagonist sequence RGD within the Fg-Aα-(571–576) peptide, recapitulated the results induced by Fg. These data provide compelling evidence for the involvement of ICAM-1 in the induction of high ERK-1/2 activity in TNFα-stimulated ECs.

Figure 2.

Recognition peptides Fg-γ-(117–133)and ICAM-1(8–22) regulate ERK-1/2 phosphorylation in TNFα-stimulated ECs. (A) Resting and TNFα-stimulated ECs were allowed to adhere to the following peptides: (1) Fgγ-(117–133); (2) Fgγ-(124–133); and (3) FgAα-(571–576) containing the RGD sequence and incubated for 15 min and 2 h at 37 °C. Cell lysates were prepared as described in Materials and methods, and equal amounts of protein were subjected to immunoprecipitation using anti-ERK1/2 mAb, then immunoblotted with anti-phosphotyrosine (PY) mAb (upper). Equivalent amounts of ERK-1/2 were verified by stripping the immunoblots and reprobing with anti-ERK-1/2 mAb (lower). (B) Six-well tissue culture plates were coated with Fg (200 nm) overnight at 4 °C and plates were blocked with 1% heat-inactivated (1 h, 56 °C) BSA in NaCl/Pi for 1 h at room temperature. TNFα-stimulated cells were seeded onto Fg-coated plates that were pre-incubated at 37 °C with 25–200 µm of peptides with sequences corresponding to ICAM-1(8–22) and ICAM-1(130–145) for 1 h. Some TNFα-stimulated cells were pre-incubated with the RGD-containing sequence FgAα-(571–576) for 30 min at 37 °C. Cells pre-incubated with the RGD peptide were seeded onto Fg-coated plates and incubated for 30 min at 37 °C. Adherent cells were lysed and equivalent amounts of cell protein wereimmunoblotted with anti-(phospho-ERK-1/2) (upper, Fig. 2B) and anti-(ERK-1/2) to show equal loading (lower). (C) ERK-1/2 activity was determined in cell lysates containing equivalent amounts of protein in the presence of ICAM-1 peptides as indicated and using the p42/p44 activity assay system as described in Materials and methods. The data show means ± SE from three experiments. * Significantly differentfrom the control (cells adherent to Fg in the absence of ICAM-1 peptides) at P < 0.05 (Student's t-test).

A region within the first Ig-like domain of ICAM-1, ICAM-1(8–22), has been shown to mediate Fg binding and block Fg : ICAM-1mediated functions [7,9]. To verify the requirement for Fg : ICAM−1 interactions to generate increased ERK-1/2 activity, Fg was pre-incubated with peptides corresponding to ICAM-1 amino acids (8–22), (10–22) and (130–145). In independent assays, stimulated cells were pre-incubated with the RGD-containing sequence and then allowed to adhere to Fg for 30 min at 37 °C. Equivalent amounts of total protein from cell lysates were analyzed both by Western blotting using anti-(phospho-ERK-1/2), anti-(ERK-1/2) mAbs (Fig. 2B) and the ERK-1/2 activity assay (Fig. 2C). Figure 2B shows that ICAM-1(8–22) diminished the hyperphosphorylation of ERK-1/2 in a dose-dependent manner. Neither ICAM-1(130–145) nor Fg-Aα-(571–576) indicated any effect on ERK-1/2 phosphorylation. Densitometric scanning of the upper panel of Fig. 2B indicated a 55, 64 and 82% reduction in band intensity after incubation of Fg with ICAM-1(8–22) peptide at 25, 50 and 100 µm, respectively. The lower panel of Fig. 2B shows that equivalent amounts of ERK-1/2 were loaded per line. The blot probed with the antiphosphotyrosine mAb shows that ICAM-1(8–22) specifically blocked only ERK-1/2 phosphorylation and did not have any influence on phosphorylation of the other kinases (data not shown), thus suggesting the fine specificity in the signaling mechanism. The above result was confirmed by ERK-1/2 activity assay in the cell lysates (Fig. 2C). Both ICAM-1(8–22) and ICAM1-(10–20) peptides reduced ERK-1/2 activity to the level detected in cells adherent to control PLL, whereas ICAM-1(130–145) decreased ERK-1/2 activity by only 20% compared with incubations in the absence of the peptide. ICAM-1(8–22) and ICAM-1(10–20) are potent Fg-binding peptides [9]. Analysis of ICAM-1(8–22) and ICAM-1 (130–145) indicates that these two peptides are structurally comparable [9]. The ICAM-1(8–22)-dependent inhibition of ERK-1/2 phosphorylation was statistically significant and this indicates that the interaction of Fg with ICAM-1 via the region spanning amino acids 8–22 is important for the generation of cellular signals and that ICAM-1 is the prominent receptor involved in the ERK-1/2 activation in TNFα-stimulated ECs. The inability of the Fg-Aα-(571–576) peptide, which contains the RGD sequence that is the αvβ3 receptor antagonist, to block ERK-1/2 activation suggests that αvβ3 plays a minimal role in ERK-1/2 activation in TNFα-stimulated cells.

Effect of inhibitors of intracellular kinases and cytoskeleton disrupting agents on ERK-1/2 phosphorylation

TNFα-stimulated cells were pretreated with geldanamycin and PD 98059 for 30 min at 37 °C and then allowed to adhere to Fg for 30 min. Geldanamycin is an inhibitor of the Src family kinases. PD 98059, a specific inhibitor of MEK-1, blocks the ability of MEK-1 to promote ERK-1/2 phosphorylation within specific threonine and tyrosine residues. As shown in Fig. 3, both geldanamycin and PD 98059 inhibited ERK-1/2 phosphorylation in a dose-dependent manner as measured by immunoblotting (Fig. 3A) and ERK-1/2 activity (Fig. 3D). The inhibition noted with 10 and 50 µm geldanamycin was 55 and 80%, respectively, whereas in the presence of 10 and 50 µm PD 98059, ERK-1/2 phosphorylation was inhibited by 40 and 65%, respectively (Fig. 3A). This result confirms the specificity of ERK-1/2 activation in ECs adherent to Fg. PP2, a more specific inhibitor of the Src-family kinases [27,28] was utilized to verify the results in Fig. 3A. PP2 (10 µm) completely blocked the activation of both Src family kinases and ERK-1/2 in TNFα-stimulated cells, that adhered to Fg (Fig. 3C). The geldanamycin and PP2-dependent inhibition of ERK-1/2 phosphorylation suggests that Src family kinases are involved in the upstream activation of the ERK-1/2 pathway.

Figure 3.

Inhibitors of intracellular kinases and cytoskeleton disrupting factors modulate ERK-1/2 phosphorylation and activity. TNFα-stimulated ECs were pretreated with the Src kinase family inhibitor geldanamycin (10 and 50 µm), the MEK-1 inhibitor PD 98059 (10 and 50 µm), cytochalasin B (50 µm) and nocodazole (5 µm) for 30 min at 37 °C. (A, B) Cells were allowed to adhere to Fg for 30 min at 37 °C; adherent cells were lysed with radioimmunoprecipitation assay buffer, ERK 1/2 was purified from cell lysates using anti-(ERK1/2) mAb and analyzed by Western blotting using antiphosphotyrosine and anti-(ERK-1/2) sera. (C) TNFα-stimulated ECs were pre-incubated with the Src kinase family inhibitor PP2 (10 µm) for 30 min at 37 °C and allowed to adhere to Fg for 30 min at 37 °C. Adherent cells were lysed and pp60src kinase family protein(s) were immunoprecipitated using anti-pp60src. Western blots were probed using antiphosphotyrosine mAb (left, upper) or antipp60src (right, upper). Equal amounts of total protein from the same lysates were immunobloted with anti-(phospho-ERK1/2) and anti-(ERK1/2), as indicated (lower). (D) ERK-1/2 activity was determined in cell lysates containing equal amounts of protein using the assay system described in Materials and methods. The data show the means ± SE from three experiments. * Significantly different from control cells(adherent to Fg, but untreated with the indicated inhibitors) at P < 0.05 (Student's t-test).

To explore the role of cell architecture in ERK-1/2 signaling, we used cytochalasin B to disrupt actin filaments and nocodazole to disrupt intermediate filaments and microtubules. TNFα-stimulated ECs were pre-incubated with cytochalasin B (50 µm) or nocodazole (5 µm) for 30 min at 37 °C before adhesion to Fg. ECs treated with cytochalasin B or nocodazole and seeded onto Fg for 30–120 min attached but did not spread and maintained a round cell morphology (data not shown). Both cytochalasin B and nocodazole decreased the phosphorylation of ERK-1/2 by 70% (Fig. 3B). A similar decrease in ERK-1/2 activity occurred in the presence of cytochalasin B (Fig. 3D). Treatment of the cells with vehicle (0.1% dimethylsulfoxide) had no effect on cell morphology and ERK-1/2 phosphorylation. These results indicate that the intact cytoskeletal architecture of actin filaments and microtubules is essential for the phosphorylation of ERK-1/2.

Fg : ICAM-1 ligation rescues ECs from TNFα-induced apoptosis

We hypothesized that the high levels of ERK-1/2 phosphorylation noted upon Fg : ICAM-1 ligation could be a response against the apoptotic effect of TNFα on ECs. To test this hypothesis, we utilized the annexin V binding assay. Table 1 shows the numbers obtained for resting and TNFα-stimulated ECs that adhered to transferrin and Fg. In the absence of TNFα, 23.3% of cells adhering to transferrin underwent apoptosis due to serum deprivation. In the presence of TNFα, cells binding annexin V increased to 39%. This indicates that TNFα has an augmented apoptotic effect on ECs. However, in the cells that adhered to Fg, the number of cells binding annexin V decreased to 11% or less. The TNFα-stimulated cells maintained cellular survival upon ligation to fragment D (the more specific ligand for ICAM-1 than intact Fg) and Fg-γ-(117–133), as < 10% of cells underwent apoptosis. Cellular rescue resulting from ICAM-1 ligation with each of the ligands was statistically significant. However, in resting ECs (cells incubated in the absence of TNFα), fragment D and Fg-γ-(117–133) ligation was ineffective in rescuing cells from apoptosis. This discrepancy is likely due to the absence or very low levels of ICAM-1 on resting ECs, and it appears that the rescue from apoptosis in these serum-deprived cells is through ligation of αv integrins with Fg. This result points to the ICAM-1 axis as the means by which the rescue of TNFα-treated ECs from undergoing apoptosis is accomplished, as the fragment D of Fg and Fg-γ-(117–133) are the selective ligands for ICAM-1, and αv integrins do not ligate these reagents [7,29]. Further independent verification of the above results was obtained utilizing the Fg recognition peptide ICAM-1(8–22) in an apoptosis assay (Table 1). We previously reported the effectiveness of ICAM-1(8–22) in blocking Fg binding to ICAM-1 [7,9,10]. ICAM-1(8–22), but not the relevant control peptide ICAM-1(130–145), inhibited the cell rescue mediated via Fg : ICAM-1 ligation in TNFα-treated ECs by 60%. The levels of peptides used in the assay were comparable with those shown in Fig. 2 to block ERK-1/2 activation and in previously reported functional assays [10]. More importantly, treatment of nonstimulated ECs with ICAM-1(8–22) failed to block rescue mediated via Fg, and cell survival was unaffected. These results clearly point to a novel EC survival mechanism, which is specifically mediated via ICAM-1. As ICAM-1(8–22) did not completely block Fg-mediated EC survival, this indicates that other Fg receptors on TNFα-stimulated EC may affect survival. In addition to integrins, VE-cadherin has been reported to serve as a Fg-receptor [30]. The recognition specificity of VE-cadherin is directed against Bβ15−45 of Fg, a region that becomes exposed upon fibrinolysis [30]. It is quite likely that Fg binding integrins along with VE-cadherin may contribute to a small extent in the adhesion of TNFα-stimulated ECs to Fg. Therefore, rendering ICAM-1(8–22) incompletely effective in blocking Fg-mediated cell survival. Nevertheless, ICAM-1 recognition peptide Fg-γ-(117–133) was fully effective in maintaining cell survival comparable with that of intact Fg.

Table 1. CD54 dependent survival of TNFα-treated ECs. Serum starved, nonstimulated or TNFα-stimulated ECs were allowed to adhere to different ligands, as indicated (left column) for 1 h at 37 °C. Apoptosis in adherent cells was measured using the annexin V binding assay as described in Materials and methods. Results shown are the means ± SE taken from three independent experiments.
 % Apoptotic cells
AdhesionNonstimulatedTNFα-stimulated
  • a 

    Significantly different from control (cells adherent to transferrin) at P < 0.01.

  • b 

    Significantly different from control (cells adherent to Fg) at P < 0.05 (Student's t-test)

Transferrin23.26 ± 2.039.43 ± 2.9
Fg10.11 ± 1.3a11.07 ± 1.7a
FgD19.47 ± 2.09.31 ± 1.0a
Fg-γ-(117–133)30.18 ± 2.49.90 ± 1.3a
Fg-γ-(117–133)Scr28.10 ± 2.130.73 ± 1.9
Fg + 100 µm ICAM-1(8–22)11.80 ± 1.017.50 ± 1.1b
Fg + 200 µm ICAM-1(8–22)10.64 ± 0.919.80 ± 1.3b
Fg + 200 µm ICAM-1(130–145)11.80 ± 1.211.30 ± 1.4

To assess the role of ERK-1/2 in cell survival mediated via ICAM-1 and to establish a functional basis for the high levels of ERK-1/2 activation upon Fg : ICAM-1 ligation (Fig. 2), we used the specific MEK-1 inhibitor PD 98059 in assays wherein TNFα-treated ECs were allowed to ligate Fg, fragment D or Fg-γ-(117–133). The results in Table 2 demonstrate that PD 98059 blocked the ICAM-1mediated cell survival process in a dose-dependent manner. The concentrations of PD 98059 used in this assay were similar to those used to block ERK-1/2 activation (Fig. 3) and cell proliferation mediated via Fg : ICAM−1 interactions [7]. Further verification along these lines was carried out using ECs transfected with a vector containing dominant-negative ERK-2 [24,25]. The effect of dominant-negative ERK-1/2 was verified experimentally; in these cells, ERK-1/2 phosphorylation was absent upon adhesion to Fg (data not shown). Transiently transfected ECs were treated with TNFα as in previous experiments and allowed to adhere to Fg to evaluate their capacity to avoid apoptosis. ECs containing the dominant-negative form of ERK-1/2 were able to adhere to Fg and Fg-γ-(117–133), yet this ligation did not prevent these cells from undergoing apoptosis (Table 3). However, cells transfected with wild-type ERK-1/2 were rescued from apoptosis following ligation to Fg or Fg-γ-(117–133). EC adhesion to a scrambled peptide, Fg-γ-(117–133)scr, failed to rescue either of the cell types (Table 3). This result, together with that in Table 2, strongly suggests that ERK-1/2 activation is essential for cell survival mediated through Fg : ICAM-1 ligation.

Table 2. Effect of the MEK-1 inhibitor PD 98059 on ICAM-1mediated EC survival. TNFα-stimulated ECs were pretreated with PD 98059 (0–100 µm) for 20 min at 37 °C and allowed to adhere to FgD or Fg-γ-(117–133) peptide for 1 h at 37 °C. Apoptosis was measured in adherent cells using the annexin V binding assay as described in Materials and methods. The data show means ± S.E. of three independent experiments.
PD 98059TNFα-stimulated ECs
% Apoptotic cells
concentration
m)

FgD

Fg-γ-(117–133)
  • a 

    Significantly different from control (ECs incubated in the absence of PD 98059) at P < 0.05 (Student's t-test).

  0 9.31 ± 1.09.90 ± 1.3
 10 µm11.07 ± 0.811.0 ± 0.9
 50 µm14.20 ± 1.0a17.25 ± 1.1a
100 µm21.70 ± 1.3a19.80 ± 0.8a
Table 3. Activated ERK-1/2 is essential for ICAM-1dependent EC survival. ECs were transiently transfected with dominant-negative or wild-type ERK-2 as described in the Materials and methods section. Cells were serum starved and stimulated with TNFα, then allowed to adhere to different ligands as indicated for 1 h at 37 °C. Apoptosis in adherent cells was measured using the annexin V binding assay. The data show means ± SE of triplicate determinations and are representative of three separate experiments.
 TNFα-stimulated ERK 2 transfected ECs
% Apoptotic cells
AdhesionWild-type ERK-1/2Dominant-negative ERK-1/2
  • a 

    Significantly different from control (cells transfected with wild-type ERK 2) for each the ligand group at P < 0.05 (Student's t-test).

Transferrin43.82 ± 2.140.0 ± 1.7
Fg9.09 ± 0.925.02 ± 2.0a
FgD10.39 ± 0.526.2 ± 1.3a
Fg-γ-(117–133)10.32 ± 1.024.34 ± 2.1a
Fg-γ-(117–133)Scr21.49 ± 1.524.10 ± 2.4

Fg : ICAM-1 ligation prevents the degradation of nucleosomal DNA in TNFα-treated ECs

DNA degradation is a characteristic feature of cells undergoing apoptosis [31]. Both resting and TNFα-treated ECs that adhered to transferrin, but not to Fg, showed significant nucleosomal DNA degradation (Fig. 4A,B, lane 1). In cells that attached to Fg, the DNA was largely intact, indicating the protective effect on ECs mediated via Fg (Fig. 4A,B, lane 2). PD 98059, in both resting and stimulated ECs, blocked the rescue process mediated by Fg (lane 4). However, only TNFα-treated, but not untreated, ECs attached to fragment D (lane 3) had intact DNA, suggesting the importance of ICAM-1 in rescuing ECs. This result is in concordance with the data in Table 1 and verifies the unique capacity of ICAM-1 to maintain cellular survival.

Figure 4.

Cell attachment mediated via Fg and ICAM-1 prevents nucleosomal DNA degradation. Following cell attachment, resting (A) and TNFα-stimulated (B) EC were lysed and nucleosomal DNA isolated and visualized as described in Materials and methods. Cells were allowed to attach to transferrin (lane 1), Fg (lane 2), fragment D (lane 3) and Fg + PD 98059 (lane 4). The 0.1-kb DNA ladder is denoted in kilobases.

Prosurvival factor A1 is involved in the ICAM-1 mediated cell survival

To gain initial understanding of the mechanism involved in cell survival mediated via Fg interactions with ICAM-1 and via the activation of ERK-1/2, we focused our investigations on prosurvival factors, such as the Bcl-2 family of proteins [18]. A1 is a recently identified member of the Bcl-2 family of prosurvival proteins that becomes induced upon TNFα treatment of ECs [21]. To assess the induction of mRNA levels for Bcl-2, Bcl-XL and A1, RT-PCR assays were performed on RNA isolated from resting and TNFα-stimulated ECs that were allowed to adhere to Fg for 0.5–2 h. The levels of Bcl-2 and Bcl-XL remained unchanged in either resting or stimulated ECs (Fig. 5A), whereas A1 levels, which were low on resting ECs, were upregulated on TNFα-stimulated ECs. A1 was induced only upon adhesion of TNFα-stimulated EC to Fg, but not to BSA. A1 induction was 2.4-fold higher following adhesion for 2 h, compared with cells that adhered for 0.5 h (Fig. 5A). In these experiments the levels of the housekeeping gene GAPDH remained unchanged. Results shown in Fig. 5B indicate that A1 levels decreased when TNFα-treated cells that were allowed to attach to Fg were incubated with either 100 µm of PD 98059 or 200 µm of ICAM-1(8–22) (lanes 1–3). Furthermore, only TNFα-stimulated cells that adhered to Fg-γ-(117–133) were able to exhibit A1 induction, but not cells that were allowed to adhere to a scrambled peptide (lanes 4 and 5). This result demonstrates for the first time that cell survival mediated via ICAM-1 is dependent upon the induction of survival factor A1. The regulation of A1 expression by recognition sequences ICAM-1(8–22) and Fg-γ-(117–133) defines the specificity of the cell-survival process. Because PD 98059 downregulated A1 levels, it appears that ERK-1/2 activation is a requirement for the A1-mediated survival of ECs.

Figure 5.

Survival factor A1 is induced upon Fg : ICAM-1 ligation. (A) RNA was isolated from resting and TNFα-stimulated ECs following adhesion to BSA or Fg for 0.5–2 h as indicated. RNA was reverse transcribed (RT). The RT samples were amplified on a thermal cycler (RT-PCR) using specifically designed primers corresponding to survival factors A1, Bcl2, BclxL and GAPDH (as control) as described in Materials and methods. (B) RT-PCR of TNFα-stimulated ECs that attached to Fg alone (lane 1), Fg in the presence of either PD 98059 (lane 2) or ICAM-1(8–22) (lane 3), Fgγ-(117–133) alone (lane 4) and Fgγ-(117–133)scr alone (lane5).

Discussion

EC survival and growth is a prerequisite for the repair of damaged blood vessels. Endothelium in the repair process mode following injury is likely to encounter an array of cytokines released by damaged or inflammatory cells. The growth signals generated via cell–extracellular matrix interactions and by several growth factors converge in the activation of the MAPKs [32–35]. Sustained activation of ERK-1/2 is necessary for cells to enter the G1 phase of cell-cycle progression [36]. Recent reports indicate that enzymes in the MAPK pathway may also become deactivated and consequently downregulate cellular functions such as platelet aggregation and cell growth and motility [37–39].

In our studies, ERK-1/2 phosphorylation was found to be eightfold to 10-fold higher upon adhesion of TNFα-stimulated ECs to Fg (Fig. 1). The high levels of ERK-1/2 phosphorylation were not due to TNFα, as adhesion of these cells to PLL or BSA did not result in phosphorylation of ERK-1/2. Furthermore, TNFα signaling occurs via an independent pathway [40]. ERK-1/2 phosphorylation was not dependent on cell spreading. ECs were not spread on Fg at 5 and 15 min, whereas ERK-1/2 phosphorylation reached peak levels at this stage of adhesion. Cell spreading was not the cause of ERK-1/2 dephosphorylation in stimulated ECs, as cells were fully spread by 30 min, at which time ERK-1/2 phosphorylation was still maintained. Rather, cell spreading coincided with the appearance of ERK-1/2 activity in resting ECs. ERK-1/2 phosphorylation and activity was dependent on intact cell cytoskeletal architecture, as disruption of actin filaments and microtubules with cytochalasin and nocodazole resulted in the loss of ERK activation (Fig. 3). The changes noted above were specific, as FAK (125 kDa) phosphorylation remained constant in resting and stimulated ECs over the 2 h of adhesion to Fg. A phosphatase may become activated in TNFα-stimulated ECs upon cell spreading. The likely candidate is the MAPK phosphatase, which has been identified as a specific inhibitor of ERK-1/2 [41,42] and which may attenuate ERK-1/2-phosphorylation. Nocodazole, a microtubule-disrupting agent has been reported to stimulate ERK-1/2 activation [43], however, in certain instances ERK-1/2 activation has been downregulated by inhibitors of microtubule formation [44]. These results may reflect differences in cell types and specific assay conditions.

Several features point to ICAM-1 as the target receptor involved in the hyperphosphorylation of ERK-1/2. First, a specific Fg recognition peptide, ICAM-1(8–22) [7,9,10], blocked ERK-1/2 phosphorylation in TNFα-stimulated ECs. Second, the ICAM-1 recognition sequence Fg-γ-(117–133) [7,8], induced a dramatic elevation in ERK-1/2 phosphorylation, comparable with that noted with intact Fg. A specific inhibitor of MEK-1 (PD 98059), which is the upstream activator of ERK-1/2, blocked ERK-1/2 phosphorylation to further verify the involvement of ERK-1/2 in these studies. In addition, the ERK-1/2 enzymatic activity measured concurrently verified ERK-1/2 augmentation. However, the activity measurements did not reflect the many-fold increases observed on Western blots using phosphotyrosine mAbs. Third, the RGD-containing peptide had no effect on the hyperphosphorylation of ERK-1/2 induced by Fg on TNFα-stimulated ECs, which indicates further specificity of our studies (Fig. 2).

Our results demonstrate that ICAM-1 ligation with Fg has an antiapoptotic effect to counterbalance the TNFα-mediated proapoptotic process. Interestingly, in this very process, TNFα mediates the upregulation of ICAM-1 on ECs and the induction of the survival factor A1 (Fig. 5). The attachment of resting and TNFα-stimulated ECs to Fg rescued these cells from apoptosis. Fragment D and Fg-γ-(117–133), which is located within fragment D, were able to rescue only TNFα-treated, but not resting, cells (Table 1). Fragment D and Fg-γ-(117–133) are specific ligands for ICAM-1 [8,9]. Integrins αvβ3 and αvβ5 do not interact with Fg-γ-(117–133), and the affinity of these integrins to bind fragment D is very low. Consequently, there was a marginal rescue of resting ECs upon ligation to fragment D. Moreover, ICAM-1(8–22) blocked EC survival in TNFα-stimulated cells, but this peptide was rather ineffective on resting ECs (Table 1). ICAM-1(8–22) at 200 µm blocked the survival of TNFα-stimulated ECs by ≈ 60%. The extent of the rescue of TNFα-stimulated ECs by Fg-γ-(117–133) and fragment D was comparable with that observed with Fg. These results indicate that the survival of TNFα-treated ECs is largely mediated via ICAM-1. Integrins expressed on stimulated ECs may have a minor role in the survival process, as complete blockage with ICAM-1(8–22) was not observed. Fg, the larger intact ligand, is recognized by both integrins and ICAM-1. Therefore, both resting and stimulated ECs are rescued via Fg ligation. As ICAM-1(8–22) was ineffective in blocking resting EC survival, we surmise that integrins, but not ICAM-1, are involved in the survival of resting ECs. PD 98059 blocked EC survival mediated via Fg-γ-(117–133) and fragment D (Table 2). Furthermore, using the dominant negative ERK, but not active ERK, transfected into ECs, we were able to block EC survival (Table 3). These results suggest that ERK-1/2 activation is necessary and essential for Fg : ICAM-1mediated cell survival. In fact, ERK-1/2 has been implicated in cell survival mediated via the receptors that bind epidermal growth factor, angiotensin and transforming growth factor [25,45,46]. EC survival mediated via fragment D and Fg-γ-(117–133) suggests that Fg degradation products, which become available in the circulation during fibrinolysis, upon binding to ICAM-1 could play a prosurvival role of vascular cells. In this context, Fg and Fg degradation products have been detected in atherosclerotic plaques [47,48] and may, therefore, participate in the survival of ECs under inflammatory conditions.

The Bcl-2 family of proteins are critical regulators of the apoptotic response which either inhibit or promote cell death. Prosurvival homologs include Bcl-2, Bcl-XL, Bclw, Mcl 1 and A1, whereas others, such as Bak, Bax and Bok, and the more distantly related BH3-only containing proteins Bad, Bik, Bid, Bim and Blk, are potent activators of apoptosis [18]. Our results indicate that A1, a member of the Bcl-2 family of proteins, a prosurvival factor which has recently been implicated in EC survival [21], becomes specifically induced upon Fg : ICAM-1 ligation on TNFα-stimulated ECs (Fig. 5A). Levels of Bcl-XL and Bcl-2 remained unchanged, whereas A1 levels were higher at 1–2 h than at 0.5 h. The ligation of TNFα-stimulated ECs to Fg-γ-(117–133) induced A1 levels comparable with those with Fg (Fig. 5B). Both ICAM-1(8–22) and the MEK-1 inhibitor PD 98059 blocked Fg-induced A1 expression. Therefore, the ligation of TNFα to its receptors induces competing apoptotic and prosurvival signals, which determine the fate of the cell. The TNFα-induced prosurvival pathway leads to upregulation of the A1 factor via the activation of Rel/NF-κB transcription factors [20,49]. Rel/NF-κB activation is also required for TNFα-induced ICAM-1 upregulation on ECs. Therefore, the emerging scenario is that TNFα induces the expression of the A1 factor and ICAM-1. Fg : ICAM-1 ligation further upregulates A1, mediating an antiapoptotic effect on ECs. The substrates of ERK-1/2 include nuclear transcription factors such as p62TCF (Elk-1), AP-1 components of the c-fos and c-jun families, and non-nuclear substrates such as the protein serine/threonine kinase p90rsk, and cytosolic phospholipase A2[50,51]. In this respect, the hyperactivation of ERK-1/2 noted upon Fg : ICAM-1 ligation may also participate via the above substrates in the induction of A1 to selectively regulate the ICAM-1 survival pathway. The mechanism for EC survival that is mediated via ICAM-1, may be important in maintaining vascular integrity during ischemia/reperfusion injury, wherein ICAM-1 has been reported to become expressed on ECs, and Fg becomes deposited on ECs under these conditions [52].

Acknowledgements

Support for these studies was obtained from the National Institutes of Health (HL 43721). S. E. D. is an Established Investigator of the American Heart Association (National Affiliate). HUVECs were provided by the cords collected through the Birthing Services Department at the Cleveland Clinic Foundation and the Perinatal Clinical Research Center (NIH General Clinical Research Center award RR00080) at MetroHealth Medical Center, Cleveland, Ohio. E. P. is the recipient of a postdoctoral fellowship of the American Heart Association (Ohio Valley Affiliate). Vicky Byers-Ward provided expert technical assistance on this project. We thank Dr Edward F. Plow for helpful discussions. Flow cytometry studies were supported by a grant from the Keck Foundation.

Ancillary