SEARCH

SEARCH BY CITATION

Keywords:

  • germline cells;
  • somatic cells;
  • vasa homolog;
  • Xenopus

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

The expression of Xenopus vasa homolog or XVLG1 was examined in oocytes and embryos by whole-mount in situ hybridization and reverse transcription–polymerase chain reaction (RT-PCR). To confirm the results in embryos, both methods were also applied to explants of germ plasm-bearing cells (GPBC) from 32-cell embryos and to those of partial embryos deprived of GPBC. By hybridization, XVLG1 ribonucleic acid (RNA) was shown to be present throughout the cytoplasm in oocytes at stages I–III, except for the mitochondrial cloud. It was barely recognizable in a portion of germline cells of embryos at specific stages, notwithstanding that XVLG1 protein was present in those cells almost throughout their life-span. A weak signal for the RNA was detectable in some of the presumptive primordial germ cells (pPGC, descendants of GPBC from the gastrula stage onward) from the late gastrula (stage 12) to the hatching tadpole stage (stage 33/34), and in some of the PGC at stages 49–50. The results for pPGC were confirmed by the hybridization of explants of GPBC at equivalent stages in control embryos. In contrast, XVLG1 RNA was detected in certain somatic cells of embryos until stage 46. These observations were supported in part by the results of RT-PCR for embryos and explants. The possible role of the product of XVLG1 was reconsidered given its presence in both germline and somatic cells.


Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

It was first revealed by genetic studies in Drosophila that vasa plays an essential role in the formation of germ cells, that is, pole cells or the precursors of germ cells were not formed in blastoderm embryos from a mother homozygous mutant for this gene ( Schüpbach & Wieschaus 1986). Since then, vasa homolog has been demonstrated to be present in various animals such as nematodes, planaria, insects, zebrafish, frogs and mammals ( Hay et al. 1988a ; Lasko & Ashburner 1988; Roussell & Bennett 1993; Fujiwara et al. 1994 ; Komiya et al. 1994 ; Komiya & Tanigawa 1995; Gruidl et al. 1996 ; Olsen et al. 1997 ; Yoon et al. 1997 ; Shibata et al. 1999 ).

As the protein products of vasa and its homologs have been reported to be localized in germline cells in almost all animal species so far examined ( Hay et al. 1988a , b; Fujiwara et al. 1994 ; Komiya et al. 1994 ; Gruidl et al. 1996 ; Ikenishi et al. 1996 ), it has long been believed that the products play a role in the formation or the maintenance of germ cells. In fact, glh-1 or -2 ribonucleic acid (RNA; finally GLH-1 or -2 protein) in Caenorhabditis elegans and Xenopus vasa-like gene 1 (XVLG1) protein in Xenopus were revealed to be involved in the formation of germ cells by perturbation experiments with antisense RNA and antibody, respectively ( Gruidl et al. 1996 ; Ikenishi & Tanaka 1997).

In a previous study ( Ikenishi et al. 1996 ), however, XVLG1 protein was demonstrated to be also present in certain somatic cells of embryos until the young tadpole stage (stage 42). As there were obvious differences in the pattern of appearance and disappearance of the protein and in the intensity of the fluorescence for it between somatic and germline cells, it was assumed that XVLG1 protein in somatic cells, and that in germline cells, at least, from stage 12 onward, were of maternal and zygotic RNA origins, respectively. However, this assumption has not yet been tested.

To date, RNA of vasa and its homologs have mainly been studied in germline cells of larval or adult gonads in the above-mentioned animals. Accordingly, information about the spatio-temporal distribution of RNA in embryos is scarce for most of the animals, including Xenopus. It is important to know the distributions in those animals and to compare them if we are to understand to what extent the mechanism of germ cell formation is conserved among animal species.

To clarify the spatio-temporal distribution of Xenopus vasa-like gene 1, (XVLG1) RNA in the oocytes and embryos and to test the above-mentioned assumption, in the present study we investigated the expression of XVLG1 RNA by whole-mount in situ hybridization and reverse transcription–polymerase chain reaction (RT-PCR). Both methods were also applied to the explants of germ-plasm bearing cells (GPBC) or the predecessor of presumptive primordial germ cells (pPGC) and PGC, and to those of partial embryos deprived of GPBC to confirm the results obtained in the embryos.

Materials and Methods

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

Oocytes and embryos

Oocytes, and unfertilized and fertilized eggs of Xenopus were obtained as described previously ( Ikenishi et al. 1996 ). Oocytes and embryos were staged after Dumont (1972) and Nieuwkoop and Faber (1967), respectively.

Cultured explants

To confirm the results obtained in embryos by whole-mount in situ hybridization and RT-PCR, an in vitro culture system used in a previous study ( Ikenishi 1982) was adopted. Four larger cells around the vegetal pole, which are to become GPBC ( Ikenishi et al. 1984 ), were isolated from 32-cell (stage 6) embryos and cultured in Liebovit’s L-15 medium until the control embryos developed to stages 7, 10, 15, 23, 28, 33/34 and 40. Partial embryos deprived of GPBC of the same stage were also cultured in a similar manner.

In situ hybridization

Whole-mount in situ hybridization for oocytes and embryos was carried out essentially according to the method of Islam and Moss (1996), modified from that of Hemmati-Brivanlou et al. (1990) . Sense and antisense digoxigenin (DIG)-labeled riboprobes were prepared from linearized XVLG1 cDNA ( Komiya et al. 1994 ) with XhoI and EcoRI, respectively, using DIG RNA Labeling Kit from Boehringer Mannheim, (Mannheim, Germany). The hybridization was also carried out for cultured explants of GPBC. The whole-mount specimens, photographed in Murray’s Clear ( Dent & Klymkowsky 1989), were processed for paraplast sectioning. Serial sections (10 μm thick) without counterstaining were examined and photographed by an Olympus microscope BH2 (Olympus Kogaku, Tokyo, Japan).

Presumptive primordial germ cells in embryos from the gastrula stage onward and PGC in tadpoles were identified by their location and morphological characteristics as described previously ( Ikenishi & Kotani 1975; Ikenishi & Tanaka 1993, 1997). The pPGC in explants were identified by morphological characteristics, that is, they had a granular cytoplasm adjacent to the nucleus, which was not observed in somatic cells.

RT-PCR

Total RNA was extracted from a significant number of oocytes of stages I–III, 10 oocytes at stages IV–VI, five unfertilized eggs and five embryos at stages 1, 6–10, 12, 15, 18, 23, 28, 33/34, 40, 42 and 46 with acid guanidium, followed by phenol and chloroform. It was also extracted from five explants of GPBC and five partial embryos that were cultured until the control embryos reached the stages mentioned earlier. First-strand cDNA was synthesized on two-fifths of the total RNA of oocytes and embryos and on the total RNA of explants by the SuperScript Preamplification System (Gibco BRL, Gaithersburg, MD, USA) according to the instructions. The cDNA was diluted 10-fold and 2 μL of cDNA was used for each polymerase chain reaction (PCR) using PCR beads (Pharmacia Biotech, Uppsala, Sweden) according to the manufacturer’s instructions. Two microliters of a 25 μL PCR product were analyzed in a 2% agarose gel containing ethidium bromide (EtBr). The DNA band was photographed using a Polaroid M-085 camera (Spectronics, Westbury, NY, USA). The thermal cycler program was 95°C for 1 min (denaturation), 53–55°C for 1 min (hybridization), depending on the primer employed, and 72°C for 2 min (elongation).

To demonstrate the suitability of the in vitro culture system for studying gene expression, mRNA of GS17, mixer and muscle actin, all of which show specific expression patterns in normal embryos with development ( Krieg & Melton 1985; Stutz & Spohr 1986; Henry & Melton 1998), were examined in the same cDNA samples of whole embryos and explants at comparable stages as employed in the expression of XVLG1 by RT-PCR. EF1 α was used as a control for RNA recovery ( Krieg et al. 1989 ). Primer sequences used for RT-PCR were; XVLG1 forward primer AGCAGTTGCTGCCAGAGGCTTGGAT, reverse GATTGATAATTCTCACATAAGGAG ( Komiya et al. 1994 ); GS17 forward CGGGATAAAAGAAACAGACTCCAG, reverse TTGGTGAGGGATGCCTTGAAG ( Krieg & Melton 1985); muscle actin forward GCTGACAGAATGCAGAAG, reverse TGCTTGGAGGAGTGTGT ( Stutz & Spohr 1986); mixer forward CACCAGCCCAGCACTTAACC, reverse CAATGTCACATCAACTGAAG ( Henry & Melton 1998); EF1 α forward CGAAGAAGTGGCAAGAAGC, reverse CAAGTGGAGGATAGTCAGAA ( Krieg et al. 1989 ).

Results

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

XVLG1 RNA examined by in situ hybridization

A signal indicating XVLG1 RNA obtained with the antisense probe was clearly recognized in oocytes of stages I–III but only rarely observed in those of stage IV–VI ( Fig. 1A). It was uniformly detected throughout the cytoplasm, other than in the mitochondrial cloud, of stage I oocytes ( Fig. 1B). The intensity of the signal decreased with oocyte growth and was moderate and faint in the cytoplasm of stage II and III oocytes, respectively. Although the signal was rarely seen in late-stage oocytes, there remained the possibility that XVLG1 RNA was present in those oocytes not hybridized by the antisense probe. This possibility was supported by RT-PCR analysis.

image

Figure 1. (A) Whole-mount in situ hybridization of oocytes at stages I–VI with antisense or sense ribonucleic acid (RNA) probe for XVLG1 RNA. A signal representing XVLG1 RNA is clearly seen in stage I–III oocytes but nearly undetectable in stage IV–VI oocytes with the antisense probe (upper tier). The signal is not detected in oocytes at any stage when the sense probe is employed (lower tier). From left to right, oocytes at stages from I to VI are lined up in order. (B) A section of the whole-mount specimen of stage I–III oocytes hybridized with the antisense probe as shown in Fig. 1(A). XVLG1 RNA is distributed throughout the cytoplasm of stage I–III oocytes, except for the mitochondrial cloud (arrow) of the stage I oocyte. It seems to disappear with oocyte growth, but can be still observed moderately in stage II oocytes and faintly in stage III oocytes. Bar, 1 mm (A), 100 μm (B).

Download figure to PowerPoint

The signal was present in the periphery of the cytoplasm of animal blastomeres ( Fig. 2A) but nearly undetectable in the cytoplasm of vegetal ones, including the germ plasm of GPBC in embryos from the fertilized to late blastula stage (stage 9). It was first visible in pPGC (descendants of GPBC, being situated in the endodermal cell mass from the gastrula to the younger tadpole stage [stage 40; Ikenishi & Kotani 1979]) at the late gastrula stage (stage 12) and remained until just after hatching (stage 33/34; Fig. 2C,D). It was hardly detectable in pPGC and PGC of embryos at stages 40–47, but appeared again in PGC at stages 49 and 50 ( Fig. 2E). Even in the stages mentioned earlier, only small portions of pPGC and PGC had a weak signal. On the other hand, from the gastrula stage onward, XVLG1 RNA was present in the cytoplasm of ecto- and mesodermal cells, whereas it was rarely found in endodermal cells other than germline cells. Above all, the RNA was prominent in cells of the notochord and somites from the neurula to the tail-bud stage, and in cells of somites and spinal cord at subsequent stages until stage 46 ( Fig. 2F).

image

Figure 2. Xenopus embryos and tadpoles examined by whole-mount in situ hybridization with antisense or sense ribonucleic acid (RNA) for XVLG1 RNA. (A) A section parallel to an animal–vegetal axis of a stage 7 embryo treated with the antisense probe. Signal for the RNA is prominent in the peripheral cytoplasm of animal blastomeres but hardly recognizable in vegetal ones, including germ plasm-bearing cells (GPBC). (B) A section parallel to an animal–vegetal axis of a stage 7 embryo labeled with the sense probe. The signal is not seen in the blastomeres. (C) Transverse section of a stage 15 embryo treated with the antisense probe. Only a central region of the endodermal cell mass is shown. A weak signal is present in a cell having a granular cytoplasm next to the nucleus (arrowhead), probably a presumptive primordial germ cell (pPGC) because only pPGC in the endodermal cell mass have such a granular cytoplasm at a juxta-nuclear location. (D) Transverse section of a stage 33/34 embryo treated with the antisense probe. Only a dorso-lateral part of the embryo is shown. A signal is observed in a cell with granular cytoplasm (arrowhead) that is roundish and has a large intercellular space between the surrounding endodermal cells, being angular in form. These were the features of pPGC in the migratory phase, as reported previously ( Ikenishi & Kotani 1975; Kamimura et al. 1976 ). Top, dorsal; bottom, ventral; e, epidermis. (E) Transverse section of a stage 49 tadpole treated with the antisense probe. Only a gonadal region is shown. A weak signal is present in a PGC of the left gonad (large arrowhead) but is undetectable in a PGC of the right one (small arrowhead). Top, dorsal; bottom, ventral; i, intestine; s, somite. (F) Transverse section of a stage 33/34 embryo hybridized with the antisense probe. Only a dorsal part of the embryo is shown. A distinct signal, as compared with the weak one in pPGC and PGC, is seen in cells of somites (so), spinal cord (sp) and notochord (n). Bar, 100 μm (A,B,E), 50 μm (C,F), 20 μm (D).

Download figure to PowerPoint

In situ hybridization for explants of GPBC isolated from stage 6 embryos was also carried out to confirm the above-mentioned results. The weak signal in the pPGC of stage 12–33/34 embryos might have resulted from difficulty in the penetration of the probe to the pPGC situated in the central part of the endodermal cell mass. The signal was not recognized in GPBC nor somatic cells of explants derived from the isolated cells, which were cultured until the control embryos developed to stage 7 (designated as ‘stage 7’ explants; Fig. 3A). A weak signal as seen in the pPGC of embryos was first noticed in some of the cells with a granular cytoplasm adjacent to the nucleus in ‘stage 10’ explants, which were probably pPGC, judging from the fact that only pPGC have a granular cytoplasm at the juxtanuclear location ( Ikenishi & Kotani 1975; Ikenishi 1982). A portion of the small number of cells in ‘stage 15’, ‘23’, ‘28’ and ‘33/34’ explants, having characteristics similar to the pPGC in ‘stage10’ explants, had a weak signal, also ( Fig. 3B). The signal was also detected in a group of cells that were somewhat different morphologically from the rest without it, occupying most of the explant ( Fig. 3C,D), that is, the former cells had yolk platelets that were much smaller in size and number than those in the latter. Those cells with the signal might be mesodermal because the signal was recognized in the ecto- and mesodermal cells but rarely in the endodermal cells of embryos beyond the gastrula stage as described earlier ( Fig. 2F). Yolk platelets in the ecto- and mesodermal cells were much smaller in size and number than those in the endodermal cells. Besides, a small number of mesodermal cells and a large number of endodermal cells were expected to appear in the explants of GPBC, according to the fate map of the GPBC by Dale and Slack (1987). These features of the somatic cells persisted in all explants examined over the period equivalent to stages 15–40 in control embryos.

image

Figure 3. Explants of germ plasm-bearing cells (GPBC) isolated from 32-cell stage (stage 6) embryos by in situ hybridization with antisense or sense ribonucleic acid (RNA) for XVLG1 RNA. (A) A ‘stage 7’ explant labeled with the antisense probe. No signal is detected either in cells having a granular cytoplasm or the germ plasm (arrowhead), nor in somatic cells. (B) A ‘stage 23’ explant labeled with the antisense probe. A signal is observed in a cell with granular cytoplasm (arrowhead), probably a presumptive primordial germ cell (pPGC), which is found in the periphery of the explant. (C) ‘Stage 10’ explants hybridized with the antisense or sense probe. A signal is clearly seen in the explants of the upper tier with the antisense probe while it is not detectable in those of the lower tier with the sense probe. (D) Section of a ‘stage 33/34’ explant labeled with the antisense probe. A signal is recognized in a group of cells, probably mesodermal cells, which were somewhat different morphologically from the endodermal cells occupying most of the explant. Bar, 50 μm (A), 20 μm (B), 1 mm (C), 100 μm (D).

Download figure to PowerPoint

A signal was rarely detected in any oocytes or cell types of the embryos and explants when sense XVLG1 probe was employed in the hybridization ( Figs 1A,2B,3C).

XVLG1 RNA and marker RNA by RT-PCR analyses

The PCR product obtained with XVLG1 primers was observed in samples from stage I–III oocytes and whole embryos from the fertilized to the feeding tadpole stage (stage 46), but not in stage VI oocytes and only rarely in unfertilized eggs, and stage 7 and 10 embryos ( Fig. 4A). The absence of the PCR products obtained with XVLG1 and EF1 α primers in the sample of stage VI oocytes was not attributed to the RNA recovery because the product with cyclin B primers was detected in the same sample (data not shown). In contrast, with XVLG1 primers, a considerable amount of the product was found in stage 1 and 3 embryos, although little was seen in stage VI oocytes and unfertilized eggs. This suggests that polyadenylation of the XVLG1 RNA, which would not have a poly-A tail in the oocytes and unfertilized eggs, occurred after fertilization. The first-strand cDNA for RT-PCR analysis was synthesized with oligo-dT primers, so the first-strand cDNA for mRNA lacking a poly-A tail frequently present in those oocytes and eggs were never synthesized. XVLG1 RNA was also detected in all explants from GPBC and the partial embryos deprived of GPBC, except for the ‘stage 7’ explants of GPBC ( Fig. 4B). Judging from the bands of the PCR product, the amount of XVLG1 RNA per embryo and per partial embryo seemed to increase with development and prolongation of the culture period, respectively, because equal amounts of PCR products prepared in the same conditions from RNA of five embryos or five partial embryos were loaded in each lane. This is in contrast to the gradual decrease of XVLG1 protein per embryo at stages later than 12 with development ( Ikenishi et al. 1996 ). The RNA and protein detected in the embryos by RT-PCR and immunoblotting, respectively, are considered to be mostly of somatic cell origin because the embryos consist of an innumerable number of somatic cells and a very small number of germline cells. If so, the increase in RNA and the decrease in protein in embryos beyond the gastrula stage may be interpreted by a lag time between the transcription and translation of XVLG1 in somatic cells, as reported in the RNA and protein syntheses of the alkaline phosphatase gene in the development of Dictyostelium discoideum ( Loomis 1969). That is, the amount of XVLG1 RNA in embryos beyond the gastrula stage may increase with development by the zygotic transcription in somatic cells, but the RNA may not be translated until the protein product is needed at later developmental stages. Also, XVLG1 protein from the maternal, XVLG1 RNA in embryos at the cleavage stage may decrease as development proceeds.

image

Figure 4. Reverse transcription–polymerase chain reaction (RT-PCR) analysis of XVLG1 ribonucleic acid (RNA) in Xenopus oocytes and embryos, and in explants of germ plasm-bearing cells (GPBC) and the partial embryos deprived of GPBC. See text for details concerning the conditions for RT-PCR. The PCR product was analyzed in a 2% agarose gel containing ethidium bromide (EtBr). (A) XVLG1 RNA is detected in stages I–III but not in stage VI oocytes. It is clearly observed in almost all embryos from the fertilized to the feeding tadpole stage, except that it was rare in unfertilized eggs, and stage 7 and 10 embryos. Expression of EF1 α is shown as a control for loading. (B) XVLG1 RNA is present in all partial embryos and all explants of GPBC, except for the ‘stage 7’ explants.

Download figure to PowerPoint

The expressions of GS17, actin and mixer in the explants and embryos are summarized in Fig. 5. GS17, which was originally reported to be transcribed during gastrulation ( Krieg & Melton 1985), was expressed in ‘stage 10’, ‘15’ and ‘23’ explants from the GPBC and partial embryos and in whole embryos at stages 9, 10, 15 and 23. Muscle actin RNA, which is a mesodermal marker, was detected in ‘stage 15’, ‘23’, ‘28’, ‘33/34’ and ‘40’ explants from partial embryos, but not in the explants from the GPBC. It was present in the whole embryos examined after stage 15. Mixer, an endodermal marker, was expressed in ‘stage 15’ explants from the GPBC and in ‘stage 10’ and ‘15’ explants from partial embryos. It was detected in whole embryos at stages 9, 10, 12 and 15. Likewise, the temporal expression of these RNA in the explants was strikingly similar to that in whole embryos, although there was a slight difference in the expression pattern of embryos between the present study and previous studies, probably because of a difference in the method employed ( Krieg & Melton 1985; Stutz & Spohr 1986; Henry & Melton 1998). Besides, the spatial expression of the actin gene seemed to be correctly regulated in the explants of both types, that is, actin RNA was detected in the explants of partial embryos in which muscle cells would arise, while it was not recognized in the explants of GPBC, in which they wouldn’t.

image

Figure 5. Reverse transcription–polymerase chain reaction (RT-PCR) analysis of GS17, actin and mixer in explants of germ plasm-bearing cells (GPBC) and the partial embryos deprived of GPBC, and in whole embryos. The temporal expressions of ribonucleic acid (RNA) of these three genes in explants and the partial embryos are nearly consistent with those in whole embryos. This strongly suggests that gene expression in the in vitro culture system reflects that in vivo. See text for details.

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

In the present study, the spatio-temporal distribution of XVLG1 RNA was first shown in Xenopus oocytes and embryos by whole-mount in situ hybridization. In part, the results were supported by the findings of RT-PCR analyses on oocytes and embryos, and on the explants. XVLG1 RNA was distributed throughout the cytoplasm in oocytes at stages I–III, other than the mitochondrial cloud, and not detected thereafter ( Fig. 1). In contrast, Xcat-2, Xlsirt and Xdazl RNA, which were found in the germ plasm late in oogenesis, were localized in the cloud of early stage oocytes ( Kloc et al. 1993 ; Forristall et al. 1995 ; Houston et al. 1998 ). It was significant that the RNA was barely detectable in a portion of the germline cells of embryos at particular stages ( Fig. 2C–E), but was detected clearly in certain somatic cells of embryos at all stages examined until stage 46 ( Fig. 2A,F).

It was suggested by the analyses of RT-PCR that not only the temporal expression of the four genes examined, including XVLG1, but also the spatial expression of the actin gene in embryos during development occurred even in the explants during culture ( Figs 4,5). This is consistent with the observation in an earlier study ( Ikenishi 1982) that the change of germinal granules through the irregularly shaped string-like body to the ‘granular material’ or ‘nuage material’, noticed upon the differentiation of pPGC into PGC in the embryos, took place in the pPGC of the explants from GPBC during culture. Therefore, the in vitro culture system may be useful for investigating when the Xenopus genes cloned so far are expressed in the descendants of individual blastomeres of early stage embryos.

XVLG1 RNA in germline cells

A week signal for XVLG1 RNA was detected in the pPGC of embryos at stages 12–33/34 and the PGC of feeding tadpoles at stages 49–50 ( Fig. 2C–E), although XVLG1 protein was recognized in germline cells in embryos from the fertilized to the tadpole stage ( Ikenishi et al. 1996 ). This was not caused by the difficulty of the probe penetrating to the pPGC in the deep endodermal cell mass of embryos at those stages, because some of the pPGC at the periphery of the explants, to which the probe would easily penetrate, had a weak signal ( Fig. 3B). In addition, it was recently reported that a strong signal was detected in pPGC in the deep endodermal cell mass of Xenopus embryos at stages 10.5–38 on whole-mount in situ hybridization with the antisense probe for Xpat RNA ( Hudson & Woodland 1998), which was similar in size to the probe for XVLG1 RNA. Rather, the weak signal might relate to a rapid translation of the RNA. This would be supported by the fact that XVLG1 protein first accumulated in the pPGC of embryos at stage 12 (late gastrula) and became prominent in those cells with development ( Ikenishi et al. 1996 ).

The detection of XVLG1 RNA in a portion of the germline cells at the definite stages mentioned earlier may be interpreted as follows. Regarding the proliferative activity of germline cells, it was reported that GPBC didn’t increase in number at cleavage stages because of the segregation of the germ plasm into one daughter cell at division. But, their descendants or pPGC asynchronously divided three times after the gastrula stage, increasing the number, that is, the first clonal division took place during gastrulation (stages 10–12), the second at about stages 22–24 and the third at about stages 37–39 ( Whitington & Dixon 1975; Dziadek & Dixon 1977). Also, the average number of pPGC around the hatching tadpole stage (stages 33/34–35/36) nearly reached that of PGC in stage 46 tadpoles ( Kamimura et al. 1976 ; Kotani et al. 1994 ). It is also known that the number of PGC in the genital ridges remains more or less constant during stages 45–47 and increases after stage 49 ( Ijiri & Egami 1975; Züst & Dixon 1977). These facts suggest that pPGC in embryos at stages 10–39 and PGC in feeding tadpoles at later than stage 49 are in a proliferative phase but in different phases of the cell cycle. Considering the stages at which XVLG1 RNA was detected in pPGC and PGC, it is tempting to speculate that germline cells, especially in a critical period of the cell cycle at the proliferative stages, which would synthesize XVLG1 RNA, might be detected by the hybridization.

As XVLG1 RNA was rarely detected not only in the GPBC of embryos before the gastrula stage by hybridization but also in the ‘stage 7’ explants of GPBC by RT-PCR ( Fig. 4B), it is likely that the RNA in pPGC of embryos at stages 12–33/34 are of zygotic origin. This is consistent with the assumption that the accumulation of XVLG1 protein in germline cells from stage 12 onward is because of zygotic XVLG1 RNA.

XVLG1 RNA in somatic cells

The spatio-temporal expression of XVLG1 RNA in somatic cells was nearly consistent with that of XVLG1 protein in a previous study ( Ikenishi et al. 1996 ). A signal for XVLG1 RNA was well detected in animal cells at the cleavage stages and in ecto- and mesodermal derivatives from the gastrula stage onward by in situ hybridization ( Fig. 2A,F). The presence of RNA in somatic cells was confirmed by RT-PCR for explants of the partial embryos ( Fig. 4B). In addition, the RNA was scarcely detected in any cells of ‘stage 7’ explants of GPBC ( Fig. 3A) but was detectable in mesodermal cells of the explants at the equivalent stages, 10–40, in control embryos by hybridization ( Fig. 3C,D). Therefore, it is reasonable to consider that XVLG1 is transcribed also in somatic cells after the mid-blastula stage.

Possible role of the product of XVLG1

The presence of the protein products of vasa homologs in somatic cells has not been reported so far in the animal species mentioned earlier, while vasa protein of Drosophila was transiently detected in the nucleus of almost all somatic cells at larval stages ( Hay et al. 1988b ). However, as the protein and zygotic RNA of XVLG1 were demonstrated to be present in somatic cells in a previous ( Ikenishi et al. 1996 ) and in the present study, respectively, it is necessary to reconsider the role of the product.

When 2L-13 antibody specific for XVLG1 protein was injected into single GPBC of Xenopus 32-cell embryos, the germline descendant from the GPBC or pPGC in the embryos seemed not to be affected until stage 37/38, but finally failed to differentiate into PGC at the feeding tadpole stage ( Ikenishi & Tanaka 1997). In contrast, the somatic descendant of the GPBC, mostly endodermal cells, were nearly unaffected by the injection, probably owing to the paucity of the protein, and normally differentiated into intestine at the tadpole stage. On the other hand, when the antibody was injected into a single animal, dorsal blastomeres on the right-hand side of the 8-cell embryos, the eye and brain on the side of the tadpoles that was injected (both of which are fated from the blastomeres; Dale & Slack 1987), were considerably reduced in size. Notwithstanding, no abnormality was noticed in those embryos until hatching (K. Ikenishi, unpubl. data, 1999). The precursor cells of both organs were confirmed to have XVLG1 protein ( Ikenishi & Tanaka 1997). Thus, it is apparent that the differentiation of certain cell types that would be derived from the injected blastomeres was disrupted by the antibody, if the descendants of the blastomeres had the protein. This means that XVLG1 protein might be involved in the differentiation not only of germline cells, but also somatic cells.

Many of the DEAD family proteins in eukaryotes, including vasa protein, are known to be involved in the translation of mRNA, exhibiting RNA helicase activity ( Wassarman & Steitz 1991; Liang et al. 1994 ). So, it is plausible that XVLG1 protein also functions in translation as the RNA helicase not only in germline cells but also in somatic cells. Therefore, it is possible that XVLG1 protein functions in the translation of unknown mRNA, each of which is essential to the specification of a certain cell type.

Acknowledgements

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

We are thankful to Drs M. Furusawa and T. Komiya, members of the former Furusawa MorphoGene Project of ERATO, for encouragement and valuable suggestions throughout this study.

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  • Dale, L. & Slack, J. M. W. 1987. Fate map for the 32-cell stage of Xenopus laevis. Development 99, 527 551.
  • Dent, J. A. & Klymkowsky, M. W. 1989. Whole-mount analyses of cytoskeletal reorganization and function during oogenesis and early embryogenesis in Xenopus. In The Cell Biology of Fertilization (Eds H. Schatten & G. Schatten), pp. 63–103. Academic Press, San Diego.
  • Dumont, J. N. 1972. Oogenesis of Xenopus laevis (Daudin): I. Stages of oocyte development in laboratory maintained animals. J. Morphol. 136, 153 180.
  • Dziadek, M. & Dixon, K. E. 1977. An autoradiographic analysis of nucleic acid synthesis in the presumptive primordial germ cells of Xenopus laevis. J. Embryol. Exp. Morphol. 37, 13 31.
  • Forristall, C., Pondel, M., Chen, L., King, M. L. 1995. Patterns of localization and cytoskeletal association of two vegetally localized RNAs, Vg1 and Xcat-2. Development 121, 201 208.
  • Fujiwara, Y., Komiya, T., Kawabata, H. et al. 1994. Isolation of a DEAD-family protein gene that encodes a murine homolog of Drosophila vasa and its specific expression in germ cell lineage. Proc. Natl Acad. Sci. USA 91, 12 258 12 262.
  • Gruidl, M. E., Smith, P. A., Kuznicki, K. A. et al. 1996. Multiple potential germ-line helicases are components of the germ- line-specific P granules of Caenorhabditis elegans. Proc. Natl Acad. Sci. USA 93, 13 837 13 842.
  • Hay, B., Ackerman, L., Barbel, S., January, L. Y., January, Y. N. 1988a. Identification of a component of Drosophila polar granules. Development 103, 635 640.
  • Hay, B., January, L. Y., January, Y. N. 1988b. A protein component of Drosophila polar granules is encoded by vasa and has extensive sequence similarity to ATP-dependent helicase. Cell 55, 577 587.
  • Hemmati-Brivanlou, A., Frank, D., Bolce, M. E., Brown, B. D., Sive, H. L., Harland, R. M. 1990. Localization of specific mRNAs in Xenopus embryos by whole-mount in situ hybridization. Development 110, 325 330.
  • Henry, G. L. & Melton, D. A. 1998. Mixer, a homeobox gene required for endoderm development. Science 281, 91 96.
  • Houston, D. W., Zhang, J., Maines, J. Z., Wasserman, S. A., King, M. L. 1998. A Xenopus DAZ-like gene encodes an RNA component of germ plasm and is a functional homologue of Drosophila boule. Development 125, 171 180.
  • Hudson, C. & Woodland, H. R. 1998. Xpat, a gene expressed specifically in germ plasm and primordial germ cells of Xenopus laevis. Mech. Dev. 73, 159 168.
  • Ijiri, K. & Egami, N. 1975. Mitotic activity of germ cells during normal development of Xenopus laevis tadpoles. J. Embryol. Exp. Morphol. 34, 687 694.
  • Ikenishi, K. 1982. A possibility of an in vitro differentiation of primordial germ cells (PGCs) from blastomeres containing ‘germinal plasm’ of early cleavage stage in Xenopus laevis. Develop. Growth Differ. 24, 205 215.
  • Ikenishi, K. & Kotani, M. 1975. Ultrastructure of the ‘germinal plasm’ in Xenopus embryos after cleavage. Develop. Growth Differ. 17, 101 110.
  • Ikenishi, K. & Kotani, M. 1979. Ultraviolet effects on presumptive primordial germ cells (pPGCs) in Xenopus laevis after the cleavage stage. Dev. Biol. 69, 237 246.
  • Ikenishi, K., Okuda, T., Nakazato, S. 1984. Differentiation of presumptive primordial germ cell (pPGC)-like cells in explants into PGC in experimental tadpoles. Dev. Biol. 103, 258 262.
  • Ikenishi, K. & Tanaka, T. S. 1993. Xenopus heterochronic presumptive primordial germ cells (pPGCs) implanted in the correct position in host neurula embryos can differentiate into PGCs. Develop. Growth Differ. 35, 439 445.
  • Ikenishi, K. & Tanaka, T. S. 1997. Involvement of the protein of Xenopus vasa homolog (Xenopus vasa-like gene 1, XVLG1) in the differentiation of primordial germ cells. Develop. Growth Differ. 39, 625 633.
  • Ikenishi, K., Tanaka, T. S., Komiya, T. 1996. Spatio-temporal distribution of the protein of Xenopus vasa homologue (Xenopus vasa-like gene 1, XVLG1) in embryos. Develop. Growth Differ. 38, 527 535.
  • Islam, N. & Moss, T. 1996. Enzymatic removal of vitelline membrane and other protocol modifications for whole mount in situ hybridization of Xenopus embryos. Trends Genet.12, 459.
  • Kamimura, M., Ikenishi, K., Kotani, M., Matsuno, T. 1976. Observations on the migration and proliferation of gonocytes in Xenopus laevis. J. Embryol. Exp. Morphol. 36, 197 207.
  • Kloc, M., Spohr, G., Etkin, L. D. 1993. Translocation of repetitive RNA sequences with the germ plasm in Xenopus oocytes. Science 262, 1712 1714.
  • Komiya, T., Itoh, K., Ikenishi, K., Furusawa, M. 1994. Isolation and characterization of a novel gene of the DEAD box protein family which is specifically expressed in germ cells of Xenopus laevis. Dev. Biol. 162, 354 363.
  • Komiya, T. & Tanigawa, Y. 1995. Cloning of a gene of the DEAD box protein family which is specifically expressed in germ cells in rats. Biochem. Biophys. Res. Commun. 207, 405 410.
  • Kotani, M., Ogiso, Y., Ozaki, R., Ikenishi, K., Tsugawa, K. 1994. Presumptive primordial germ cells (pPGCs) and PGCs in tadpoles from UV-irradiated embryos of Xenopus. Develop. Growth Differ. 36, 457 467.
  • Krieg, P. A. & Melton, D. A. 1985. Developmental regulation of a gastrula-specific gene injected into fertilized Xenopus eggs. EMBO J. 4, 3463 3471.
  • Krieg, P. A., Varnum, S. M., Wormington, W. M., Melton, D. A. 1989. The mRNA encoding elongation factor 1-alpha (EF-1alpha) is a major transcript at the midblastula transition in Xenopus. Dev. Biol. 133, 93 100.
  • Lasko, P. F. & Ashburner, M. 1988. The product of the Drosophila gene vasa is very similar to eukaryotic initiation factor-4A. Nature 335, 611 617.
  • Liang, L., Diehl-Jones, W., Lasko, P. F. 1994. Localization of vasa protein to the Drosophila pole plasm is independent of its RNA-binding and helicase activities. Development 120, 1201 1211.
  • Loomis Jr W. F. 1969. Developmental regulation of alkaline phosphatase in Dictyostelium discoideum. J. Bacteriol. 100, 417 422.
  • Nieuwkoop, P. D. & Faber, J. 1967. Normal Table of Xenopus Laevis (Daudin), 2nd edn. North-Holland Publishers, Amsterdam.
  • Olsen, L. C., Aasland, R., Fjose, A. 1997. A vasa-like gene in zebrafish identifies putative primordial germ cells. Mech. Dev. 66, 95 105.
  • Roussell, D. L. & Bennett, K. L. 1993. glh-1: A germline putative RNA helicase from Caenorhabditis elegans has four zinc fingers. Proc. Natl Acad. Sci. USA 90, 9300 9304.
  • Schüpbach, T. & Wieschaus, E. 1986. Maternal-effect mutations altering the anterior–posterior pattern of the Drosophila embryo. Roux’s Arch. Dev. Biol. 195, 302 317.
  • Shibata, N., Umesono, Y., Orii, H., Sakurai, T., Watanabe, K., Agata, K. 1999. Expression of vasa (vas)-related genes in germline cells and totipotent somatic stem cells of planarians. Dev. Biol. 206, 73 87.
  • Stutz, F. & Spohr, G. 1986. Isolation and characterization of sarcomeric actin genes expressed in Xenopus laevis embryos. J. Mol. Biol. 187, 349 361.
  • Wassarman, D. A. & Steitz, J. A. 1991. Alive with DEAD proteins. Nature 349, 463 464.
  • Whitington P. McD. & Dixon, K. E. 1975. Quantitative studies of germ cells during early embryogenesis of Xenopus laevis. J. Embryol. Exp. Morphol. 33, 57 74.
  • Yoon, C., Kawakami, K., Hopkins, N. 1997. Zebrafish vasa homologue RNA is localized to the cleavage planes of 2- and 4-cell stage embryos and is expressed in the primordial germ cells. Development 124, 3157 3166.
  • Züst, B. & Dixon, K. E. 1977. Events in the germ cell lineage after entry of the primordial germ cells into the genital ridges in normal and u.v.-irradiated Xenopus laevis. J. Embryol. Exp. Morphol. 41, 33 46.