Antisense Bcl2 oligonucleotide in cisplatin-resistant bladder cancer cell lines

Authors


Abstract

Objective  To determine the change of expression of Bcl2 in cisplatin-resistant bladder cancer cell lines and the reversibility of chemoresistance to cisplatin with antisense oligonucleotide against Bcl2, as higher expression of Bcl2 is associated with drug resistance in many different cancer cell lines.

Materials and methods  In the cisplatin-resistant bladder tumour cell lines T24R1 and T24R2, the expression of Bcl2 was determined by reverse transcription-polymerase chain reaction and Western blot assay, and antisense oligonucleotide targeting of the Bcl2 coding sequence was administered with lipofectin.

Results  The expression of Bcl2 mRNA and protein was greater in T24R1 and T24R2 cells than in the parent T24 cells. Short-term exposure to cisplatin up-regulated Bcl2 mRNA and protein expression in parent T24 cells. Treatment with antisense oligonucleotide down-regulated Bcl2 protein expression and significantly enhanced the cytotoxicity of cisplatin.

Conclusions  Up-regulation of Bcl2 protein expression might be one of the mechanisms of cisplatin resistance in bladder cancer cells, and antisense Bcl2 oligonucleotide may be helpful in chemotherapy for bladder cancer by reversing cisplatin resistance.

Introduction

Resistance to anticancer chemotherapeutic drugs remains a major obstacle in cancer chemotherapy. Cisplatin-based combination chemotherapy has been the mainstay of the treatment of advanced bladder cancer. However, the efficacy of cisplatin-based chemotherapy is limited because of de novo drug resistance or the development of cellular resistance during chemotherapy [1]. A variety of mechanisms responsible for he cisplatin resistance has been proposed, including the increased detoxification of the drug by metallothionein or glutathione, the decreased intracellular accumulation of the drug, and changes in DNA topoisomerase [2–5]. Recently, the increased expression of Bcl2, which is known to suppress apoptosis, has been reported to be related to the development of drug resistance in many different cancers. For bladder cancer it has been reported that transfection of Bcl2 gene into bladder cancer cell lines caused them to become resistant to cisplatin [6]. We assessed the changes in the expression of Bcl2 in cisplatin-resistant bladder cancer cell lines and the reversibility of chemoresistance to cisplatin with antisense oligonucleotide against Bcl2.

Materials and methods

The human bladder cancer cell lines T24 and J82 were obtained from the American Type Culture Collection (Rockville, MD, USA). Cells were routinely maintained in RPMI-1640 medium (Gibco, Grand Island, NY, USA) containing 10% fetal bovine serum (Gibco) and antibiotics. The cisplatin-resistant T24 cell lines were established by stepwise increments of exposure to cisplatin, starting with 10 ng/mL of cisplatin. When the cells became resistant at 1.0 µg/mL (T24R1) and 2.0 µg/mL (T24R2) of cisplatin, they were stored in liquid nitrogen.

The chemosensitivity was tested using a colorimetric tetrazolium (MTT) assay. Cells were plated in flat-bottomed 96-well microtitre plates (Corning, NY, USA) in 100 µL of medium. Cisplatin was added to each well at a gradually increasing concentration and the cells incubated in a 5% CO2, 37 °C incubator. At 4 h before the end of exposure to cisplatin, 100 µL of MTT solution (Sigma, St. Louis, MO, USA) was added to each well; 4 h later the medium was discarded and 100 µL of DMSO (Sigma) was added to each well to solubilize the formazan crystals. The plate was placed in a spectrophotometer (Spectra Max340, Molecular Devices, Sunnyvale, CA, USA) and the absorbance at 570 nm measured.

For RT-PCR, the total RNA was isolated using the acid guanidinium thiocyanate-phenol-chloroform method [7]; 200 ng of total cellular RNA and 5 µmol/L of random hexamer were mixed with 20 µL of the PCR solution (50 mmol/L Tris-HCl, 75 mmol/L KCl, 3 mmol/L MgCl2, 10 mmol/L dithiothreitol, each dNTP 500 µmol/L, reverse transcriptase 10 U) and cDNA was synthesized. PCR was performed with this cDNA (5 µL), Amplitaq (1 U) and PCR kit (Perkin-Elmer, Norwalk, CT, USA). The following primers for Bcl2 were used (Stratagene, La Jolla, CA, USA). 5′ primer – 5′TGCACCTGACGCCCTTCAC3′; 3′ primer – 5′AGACAGCCAGGAGAAATCAAACAG3′ (expected size 293 bp). RT was performed in the following conditions: 94°C for 2 min, 60°C for 2 min, 72°C for 2 min. After RT, PCR was performed as follows: 94°C for 1 min, 60°C for 2 min and 72°C for 2 min for 35 cycles, followed by a 10-min incubation at 72°C. The primer of β-actin was used as an internal control. The PCR product was analysed electrophoretically on 2.0% agarose gel mixed with ethidium bromide, and photographed under ultraviolet illumination.

For the Western blot analysis, cells treated with or without oligonucleotide were dissolved in buffer solution (50 mmol/L Tris-HCl, pH 7.5, 5 mmol/L MgCl2, 0.5 mmol/L EDTA, 1 mmol/L dithiothreitol, 10% glycerol) and protease inhibitor. Protein concentrations were determined using the Bradford protein assay (Bio-Rad Laboratories, Richmond, CA, USA); 100 µg of protein was subjected to SDS-PAGE (12.5%), analysed electrophoretically with 5 W/gel for 3.5 h and transferred onto nitrocellulose membrane using the electrotransfer method. The membrane was incubated overnight in blocking buffer (3% BSA, 0.05% Tween, 20 mmol/L Tris-Cl, 500 mmol/L NaCl, pH 7.2). Subsequently, the membrane was probed with mouse anti-Bcl2 mAb (Novocastra, Newcastle, UK), conjugated with antimouse IgG peroxidase. Signals of bound antibody were visualized using the enhanced chemiluminescence detection system (Amersham Life Sciences, Aylesbury, UK).

The sequence of antisense for Bcl2 mRNA [8] is 5′AATCCTCCCCCAGTTCACCC3′; this was stored in 10 mmol/L Tris (pH 7.4) and 1 mmol/L EDTA at −20°C. The following sense oligonucleotide was used as a control: 5′GGGTGAACTGGGGGAGGATT3′. To increase the oligonucleotide uptake of cells, lipofectamine (Life Technologies, Gaithersburg, MD, USA), a cationic lipid, was used. First, oligonucleotide was pre-incubated for 45 min in a solution of serum-free OPTI-MEM (Life Technologies) 1 µg, and lipofectamine 6 µL. Tumour cells were treated with sense or antisense oligonucleotide and incubated for 24 h.

The significance of differences in sensitivity to cisplatin of T24, T24R1 and T24R2 was evaluated using the Kruskal–Wallis test, with nonparametric methods, and the changes before and after oligonucleotide treatment assessed using a one-way anova with contrast.

Results

The doses required for 50% inhibition of T24, T24R1, and T24R2 cells to cisplatin were 1.5, 7.1 and 11.2 µg/mL, respectively. The resistance to cisplatin in T24R1 and T24R2 cells was 4.7-fold and 7.5-fold greater than in the parent T24 cells.

The expression levels of Bcl2 mRNA in T24, T24R1, and T24R2 are shown in Fig. 1. The expression of Bcl2 mRNA in T24R1 and T24R2 cells was slightly higher than that of T24 cells in cisplatin-free conditions. When the cisplatin-resistant cells were exposed to less than the maintenance concentration of cisplatin, their expression of Bcl2 mRNA increased. Interestingly, parent T24 cells also showed significant increases in the expression of Bcl2 mRNA after 24 h of exposure to cisplatin.

Figure 1.

RT-PCR of Bcl2 mRNA expression of cells treated with cisplatin for 48 h. The lower band shows the internal control. (A) T24 with no cisplatin; (B) T24 with cisplatin 0.5 µg/mL; (C) T24 with cisplatin 1.0 µg/mL; (D) T24R1 with no cisplatin; (E) T24R1 with cisplatin 0.5 µg/mL; (F) T24R1 with cisplatin 1.0 µg/mL; (G) T24R2 with no cisplatin; (H) T24R2 with cisplatin 0.5 µg/mL; (I) T24R2 with cisplatin 1.0 µg/mL.

The levels of expression of Bcl2 protein in T24, T24R1, and T24R2 cells are shown in Fig. 2; the expression of Bcl2 protein in T24R1 and T24R2 cells was significantly higher than that of T24 cells. As seen in the change of expression of Bcl2 mRNA, exposure of T24 cells to cisplatin caused a significant increase in the expression of Bcl2 protein. In contrast to the parent T24 cells, exposure of cisplatin-resistant cells to cisplatin caused no further increase in Bcl2 protein expression. To clarify whether this result was cell-line-specific, the same experiment was conducted in another invasive bladder cancer cell line, J82. The result was similar to that obtained from T24 cells (Fig. 3).

Figure 2.

Western blot analysis of T24, T24R1, T24R2 cells after cisplatin exposure. (A) T24 with no cisplatin; (B) T24 with cisplatin 0.5 µg/mL; (C) T24 with cisplatin 1.0 µg/mL; (D) T24R1 with no cisplatin; (E) T24R1 with cisplatin 0.5 µg/mL; (F) T24R1 with cisplatin 1.0 µg/mL; (G) T24R2 with no cisplatin; (H) T24R2 with cisplatin 0.5 µg/mL; (I) T24R2 with cisplatin 1.0 µg/mL.

Figure 3.

The expression of Bcl2 protein (1) and mRNA (2) in J82 cells. (A) J82 with cisplatin 0 µg/mL, (B) cisplatin 0.5 µg/mL, and (C) cisplatin 1.0 µg/mL.

The changes in expression of Bcl2 protein in T24, T24R1 and T24R2 cells after treatment with 150 nmol/L Bcl2 antisense oligonucleotide for 24 h are shown in Fig. 4. The levels of expression of Bcl2 protein in cisplatin-resistant cells decreased with Bcl2 antisense oligonucleotide treatment (Lane 1). The change in Bcl2 protein in T24 cells after oligonucleotide treatment was less conspicuous than in cisplatin-resistant cells. However, after treatment with Bcl2 sense oligonucleotide (Lane 2), which was used as a control group, there was little change in the expression of Bcl2 protein.

Figure 4.

Changes in Bcl2 protein expression after treatment with 150 nmol/L antisense Bcl2 oligonucleotide for 24 h (Lane 1). Sense oligonucleotide was used as control group (Lane 2). (A) and (B), T24; (C) and (D) T24R1; (E) and (F) T24R2 cells; (B,D,F) show changes of Bcl2 protein after treatment with oligonucleotide. In T24R1 and T24R2 cells, Bcl2 expression was increased 68% and 114%, respectively, compared with T24 cells. After oligonucleotide treatment, the decrease in Bcl2 protein expression was much larger in resistant cell lines than in parental T24 cells, compared with levels before treatment.

The cytotoxicity of cisplatin in T24, T24R1, and T24R2 cells with or without Bcl2 antisense oligonucleotide is shown in Fig. 5. All the cell lines treated with Bcl2 antisense oligonucleotide showed greater cytotoxicity with cisplatin. However, the increased cytotoxicity in T24R1 and T24R2 cells was greater than that of parent T24 cells (both P<0.001). At 3 µg/mL of cisplatin, treatment with Bcl2 antisense oligonucleotide resulted in similar cytotoxicity among the cell lines.

Figure 5.

Cisplatin cytotoxicity of ( a ) T24, ( b ) T24R1 and ( c ) T24R2 cells 24 h after antisense Bcl2 oligonucleotide treatment; green closed circles, control; red closed squares, with sense oligonucleotide; light green open circles, with antisense oligonucleotide.

Discussion

Cisplatin is an important chemotherapeutic agent that is used in many malignancies. Combined chemotherapy including cisplatin has resulted in a response rate of 60–80% in patients with advanced bladder cancer, but because of the emergence of chemoresistance, complete remission was sustained in only 15% of patients [9]. Many studies have been conducted to modulate this cisplatin resistance [10], but there are no clear results.

In humans, bcl2 protein is composed of 239 amino acids (25–26 kDa); it inhibits apoptosis induced by many kinds of stimuli, including irradiation, chemotherapeutic agents, steroid and heat, and is thought to be a downstream regulator of apoptosis [11]. The increased expression of Bcl2 was suggested to be a mechanism of resistance to chemotherapy or radiotherapy [12,13]. Ikeguchi et al.[14] reported that in human stomach cancer the sensitivity of tumour cells to cisplatin could be predicted from the p53 status and expression of Bcl2. The relationship between Bcl2 expression and apoptosis or chemoresistance was reported in acute lymphoblastic leukaemia [15], small cell lung cancer [16] and epidermoid cancer [17].

Recently Miyake et al.[18] reported that the introduction of the Bcl2 gene into bladder tumour cells that do not express Bcl2 protein can confer resistance to cisplatin through the inhibition of apoptosis, suggesting strongly that Bcl2 may be important in cisplatin resistance in bladder cancer. The biochemical mechanism by which the Bcl2 protein prevents apoptosis remains enigmatic.

In the present study, with exposure to cisplatin, Bcl2 mRNA was up-regulated in bladder tumour cells and cisplatin-resistant cells. As far as we are aware this is the first report of the possibility of inducing Bcl2 in bladder tumour cells with cisplatin.

Antisense oligonucleotides are chemically modified stretches of single-stranded DNA that are complementary to mRNA regions of a target gene and are capable of inhibiting gene expression by forming RNA/DNA duplexes [19]. Recently, several antisense oligonucleotides targeted against genes involved in neoplastic progression have been evaluated both in vitro and in vivo as potential therapeutic agents. Viral vector or direct insertion with a ‘gene gun’ were used to introduce oligonucleotides into the cell. However, liposomes have now been developed which can be used in large populations and with low immunogenicity [20]. Cationic liposomes like lipofectin are positively charged and bind strongly with the negatively charged phosphate groups in oligonucleotides, and so are easily endocytosed into the cells. There are studies using antisense Bcl2 oligonucleotide; Ziegler et al.[8] reported the induction of apoptosis in small-cell lung cancer cells with antisense Bcl2 oligonucleotide. Jansen et al.[21] reported that malignant melanoma cells in SCID mice had less Bcl2 mRNA and Bcl2 protein with antisense Bcl2 oligonucleotide, and antisense Bcl2 oligonucleotide also increased the chemosensitivity of melanoma. Waters et al.[22] showed in patients with non-Hodgkin's lymphoma that antisense Bcl2 oligonucleotide induced tumour regression, improved the biochemical and haematological variables and symptoms, and reduced Bcl2 protein expression. These results suggest that inhibiting the expression of Bcl2 with antisense Bcl2 oligonucleotide might be a useful treatment. In the present study, antisense Bcl2 oligonucleotide reduced the expression of Bcl2 protein levels in cisplatin-resistant cells to the levels in parent cells; it also decreased cell survival in cisplatin-resistant cells compared with parent T24 cells (Fig. 5). From these results we infer that antisense oligonucleotide influenced Bcl2 expression and that this amplified the cytotoxicity of cisplatin.

In conclusion, Bcl2 is important in cisplatin resistance and the decrease in Bcl2 genes with antisense oligonucleotide can reverse cisplatin sensitivity. Antisense Bcl2 oligonucleotide may be a novel therapeutic strategy in the treatment of cisplatin-resistant bladder cancer.

Acknowledgements

This study was supported by a grant (99–012) from the Asan Institute for Life Sciences, Seoul, Korea.

Authors

Jun Hyuk Hong, MD, Assistant Professor.

Eunsik Lee, MD, Professor.

Jeehee Hong, BS, Research Assistant.

Yoon Joo Shin, MS, Research Assistant.

Hanjong Ahn, MD, Professor.

H. Ahn, Department of Urology, Asan Medical Center, 388–1, Poongnap-dong, Songpa-gu, Seoul, 138–736, Korea.
e-mail: hjahn@amc.seoul.kr

Ancillary