SEARCH

SEARCH BY CITATION

Keywords:

  • Tryptophan hydroxylase;
  • Serotonin;
  • Transcription;
  • CCAAT displacement protein;
  • CDP/Cut

Abstract

  1. Top of page
  2. Abstract
  3. MATERIALS AND METHODS
  4. Construction of TPH/luciferase reporter plasmids
  5. Construction of pTPH/luciferase reporter plasmids
  6. In vitro coupled transcription-translation of human GATA-2
  7. EMSA
  8. Preparation of DNA and oligonucleotide probes.
  9. RESULTS
  10. Identification of nuclear protein binding sites in the -429/-169 hTPH sequence
  11. Multiple proteins bind to the -310/-220 hTPH sequence
  12. The -270 TCGATAAT -263 hTPH sequence is essential for complex I and complex II formation
  13. Interaction of CDP/Cut with hTPH requires FP-I and additional 5′ flanking sequences
  14. Functional importance of the CDP/Cut binding site in hTPH gene transcription
  15. DISCUSSION
  16. Acknowledgements

Abstract : Tryptophan hydroxylase (TPH) is the rate-limiting enzyme in the biosynthesis of serotonin, a neurotransmitter that has been implicated in many psychiatric illnesses. The mechanism of transcriptional regulation of the human TPH gene is largely unknown. We have identified a negative regulatory element located between nucleotides -310 and -220 in the human TPH (hTPH) gene. Electromobility shift analyses performed with the -310/-220 hTPH probe and nuclear extract from P815-HTR (a TPH-expressing cell line) revealed two slow migrating protein-DNA complexes, designated I and II. CCAAT displacement protein (CDP/Cut) is involved in complex I formation as shown in electromobility shift analysis, using consensus oligonucleotide competitor and antibody. Mutations in the CDP/Cut binding site not only disrupted the CDP-DNA complex but also disrupted the second complex, suggesting that the core binding sequences of the two proteins are overlapping. The functional importance of these protein-DNA interactions was assessed by transiently transfecting wild-type and mutant pTPH/luciferase reporter constructs into P815-HTR cells. Mutations in the core CDP/Cut site resulted in an approximately fourfold increase in relative luciferase activities. Because CDP/Cut has been shown to repress transcription of many target genes, we speculate that disruption of the CDP/Cut binding was responsible, at least in part, for the activation of hTPH gene.

Tryptophan hydroxylase [TPH ; EC 1.14.16.4 ; l-tryptophan, tetrahydropteridine : oxygen oxidoreductase (5-hydroxylating)] is the initial and rate-limiting enzyme in the biosynthesis of serotonin (Grahame-Smith, 1964 ; Jequier et al., 1967). In the pathway, TPH converts the amino acid l-tryptophan to 5-hydroxytryptophan (5-HTP), which is further decarboxylated by l-aromatic amino acid decarboxylase to form 5-hydroxytryptamine (5-HT or serotonin). The expression of TPH is limited to cells and tissues that produce serotonin and melatonin, including serotonergic neurons in the brain (Kuhar et al., 1972 ; Tong and Kaufman, 1975) and gut (Gershon et al., 1977), the pineal gland (Deguchi, 1977), retina (Thomas and Iuvone, 1991), intestinal and pancreatic enterochromaffin cells (Legacy et al., 1983), and mouse mastocytoma cells (Lovenberg et al., 1965 ; Sato et al., 1967). Serotonin is a neurotransmitter that has been implicated in many psychiatric illnesses, such as depression (Blier and de Montigny, 1994), obsessive-compulsive disorder (DeVeaugh-Geiss, 1993), schizophrenia (Crow et al., 1979 ; Korpi et al., 1986), and alcoholism (Sellers et al., 1992). Because TPH is the rate-limiting enzyme in serotonin synthesis, it has been considered a potential target for manipulation of serotonergic neurotransmission. Understanding the regulation of TPH activity at the transcriptional level is an essential step toward clarifying the regulation of serotonin synthesis and activity.

Recently, the coding and 5′ regulatory sequences of the human tryptophan hydroxylase (hTPH) gene have been cloned (Boularand et al., 1995). Studies have shown that 2 kb of sequence upstream of the transcription start site of the hTPH gene functions as a promoter to direct expression of the luciferase reporter gene, but this 2-kb region is not sufficient to mediate cell type-specific expression (Boularand et al., 1995 ; Teerawatanasuk and Carr, 1998). This finding is consistent with results regarding mouse TPH transcriptional regulation in vivo (Huh et al., 1994). Although a -6.1 kb to +42 TPH-lacZ reporter gene was expressed in both the pineal gland and brain serotonergic cell bodies, the reporter gene was also expressed in brain regions that do not express TPH.

Although several canonical binding sites for transcription factors are present in the proximal promoter of the hTPH gene, only an inverted CCAAT box (nucleotides -67 ATTGG -63) has been shown to be functionally important. Progressive deletions from -2 kb to nucleotide -164 produced only small changes in transcriptional activity in TPH-expressing cells, pinealocytes and P815-HTR, and nonexpressing cells, PC12 and HeLa cells (Boularand et al., 1995 ; Teerawatanasuk and Carr, 1998). We surmise that there may be multiple regulatory elements within some of these large deleted regions, so that little change in transcriptional activity would be expected if both positive and negative regulatory elements were simultaneously deleted. In this report, we continued our study on hTPH transcriptional regulation by examining protein-DNA interactions in the region from -429 to -169, using P815-HTR cells, to determine if there were regulatory sites that were not evident from deletion analyses. A mouse TPH-expressing cell line, P815-HTR mastocytoma, has been used to study the regulation of hTPH transcription because a human TPH-expressing cell line of neural origin was not available. Expression of TPH in P815-HTR cells has been verified by radioenzymatic assay (Reed et al., 1995).

We report here the identification of a CCAAT displacement protein (CDP) binding site in the region extending from nucleotides -310 to -220. CDP is a human homologue of the Drosophila Cut homeoprotein (Neufeld et al., 1992), murine Cux (Cut homeobox) (Valarche et al., 1993), and canine Clox (Cut-like homeobox) (Andres et al., 1992). Hereafter, we will refer to this protein as CDP/Cut. Using electromobility shift analysis (EMSA), we showed that CDP/Cut binds primarily to the -270 TCGATAAT -263 sequence in the hTPH gene. Mutations in this CDP/Cut binding site increased relative luciferase activity approximately fourfold in P815-HTR cells. Our results suggest that CDP/Cut is a transcriptional repressor of the hTPH gene.

Construction of TPH/luciferase reporter plasmids

  1. Top of page
  2. Abstract
  3. MATERIALS AND METHODS
  4. Construction of TPH/luciferase reporter plasmids
  5. Construction of pTPH/luciferase reporter plasmids
  6. In vitro coupled transcription-translation of human GATA-2
  7. EMSA
  8. Preparation of DNA and oligonucleotide probes.
  9. RESULTS
  10. Identification of nuclear protein binding sites in the -429/-169 hTPH sequence
  11. Multiple proteins bind to the -310/-220 hTPH sequence
  12. The -270 TCGATAAT -263 hTPH sequence is essential for complex I and complex II formation
  13. Interaction of CDP/Cut with hTPH requires FP-I and additional 5′ flanking sequences
  14. Functional importance of the CDP/Cut binding site in hTPH gene transcription
  15. DISCUSSION
  16. Acknowledgements

Materials.

P815-HTR cells were generously provided by W. Biddison, National Institute for Neurological Disorders and Stroke, National Institutes of Health (MD, U.S.A.). Oligonucleotides were obtained from Integrated DNA Technologies (Coralville, IA, U.S.A.). M13 reverse and forward primers were from Perkin-Elmer (Foster City, CA, U.S.A.). T7 Sequenase version 2.0 was a product of Amersham Life Science (Cleveland, OH, U.S.A.). TNT coupled reticulocyte lysate systems, pRL-TK plasmid, and dual luciferase assay system were obtained from Promega (Madison, WI, U.S.A.). pBluescript II KS +/- plasmid was obtained from Stratagene (La Jolla, CA, U.S.A.). RPMI medium 1640, fetal bovine serum, HindIII, EcoRI, EcoRV, PstI, bacterial alkaline phosphatase, T4 polynucleotide kinase, and the Klenow fragment of E. coli DNA polymerase I were obtained from GibcoBRL (Gaithersburg, MD, U.S.A.). PacI was from New England Biolabs (Beverly, MA, U.S.A.). [γ-32P]ATP was a product of NEN-Du Pont (Wilmington, DE, U.S.A.). Bio-Rad protein assay system was a product of Bio-Rad Laboratories (Hercules, CA, U.S.A.). Minimum essential medium, dithiothreitol (DTT), polydeoxyinosinic-deoxycytidylic acid [poly(dI-dC)], HEPES, Tris-HCl, EDTA, EGTA, sodium dodecyl sulfate, and distamycin A were from Sigma Chemical (St. Louis, MO, U.S.A.). DNase I was from Worthington Biochemical (Freehold, NJ, U.S.A.). Proteinase K and tRNA were from Boehringer Mannheim (Indianapolis, IN, U.S.A.). Guinea pig polyclonal antibody against CDP was kindly provided by E. J. Neufeld, Harvard University (Boston, MA, U.S.A.). A double-stranded GATA consensus oligonucleotide was obtained from Santa Cruz Biotechnology (Santa Cruz, CA, U.S.A.). Human GATA-2 expression plasmid (hGATA-2/pSG5) was kindly provided by D. F. Gordon, University of Colorado Health Sciences Center (Denver, CO, U.S.A.) with permission from S. H. Orkin, Harvard University.

Construction of pTPH/luciferase reporter plasmids

  1. Top of page
  2. Abstract
  3. MATERIALS AND METHODS
  4. Construction of TPH/luciferase reporter plasmids
  5. Construction of pTPH/luciferase reporter plasmids
  6. In vitro coupled transcription-translation of human GATA-2
  7. EMSA
  8. Preparation of DNA and oligonucleotide probes.
  9. RESULTS
  10. Identification of nuclear protein binding sites in the -429/-169 hTPH sequence
  11. Multiple proteins bind to the -310/-220 hTPH sequence
  12. The -270 TCGATAAT -263 hTPH sequence is essential for complex I and complex II formation
  13. Interaction of CDP/Cut with hTPH requires FP-I and additional 5′ flanking sequences
  14. Functional importance of the CDP/Cut binding site in hTPH gene transcription
  15. DISCUSSION
  16. Acknowledgements

The pTPH(-429)/luc reporter plasmid, containing the -429 to +40 hTPH fragment linked to the luciferase gene in the pXP2 vector (Nordeen, 1988), was generated by 5′ deletion of the pTPH(-1,954)/luc reporter plasmid (Teerawatanasuk and Carr, 1998). The mutant counterpart of pTPH(-429)/luc, containing three altered base pairs at nucleotides -268, -267, and -264 in the core CDP/Cut binding site, was created by site-specific PCR mutagenesis (Higuchi, 1989). PCR mutagenesis was performed by using two internal overlapping mutant primers and two external primers. The sequences of the internal overlapping primers, carrying the three altered nucleotides (underlined), are 5′-GCAGGTCATTGTGTCTCTACTAGGCGTTATCTTGGTTTGG-3′ (sense strand) and 5′-CCAAACCAAGATAACGCCTAGTAGAGACACAATGACCTGC-3′ (antisense strand). The external primer at the 5′ end of the fragment anneals to pXP2 sequence 5′ of the polylinker. The external primer at the 3′ end of the fragment anneals to complementary DNA that encodes amino acids 1-8 of the luciferase gene. The two overlapping PCR fragments from the first round of PCR were purified, mixed, and subjected to a second round of PCR, using the external primers. After this, the final PCR product was digested with BamHI and XhoI, and directionally ligated into the pXP2 vector. Legitimacy of the hTPH sequence was verified by dideoxy sequencing, using T7 Sequenase version 2.0, according to the manufacturer's instruction.

Cell culture and transient transfection assays

P815-HTR mouse mastocytoma cells were grown in RPMI medium 1640 supplemented with 10% fetal bovine serum, 100 U/ml penicillin, 100 μg/ml streptomycin, and 250 ng/ml amphotericin B. Cells were cultured at 37°C in a humidified incubator under 5% CO2 atmosphere. Transient transfections were performed by a calcium phosphate precipitation method (Graham and van der Eb, 1973) as previously described (Reed et al., 1995). The pRL-TK plasmid, which encodes the Renilla luciferase enzyme, was used as an internal control to monitor transfection efficiency. Ten micrograms of pTPH (-429)/luc and 1.0 μg of pRL-TK were cotransfected into P815-HTR cells. After transfection, cells were further incubated at 37°C for 20 h before harvesting. Cell lysates from individual transfections were assayed for firefly and Renilla luciferase activities, using the dual luciferase assay system, according to the manufacturer's instruction. In all experiments, firefly luciferase activities were normalized to the corresponding Renilla luciferase activities, and the ratio was represented as relative luciferase activity (RLA).

Preparation of nuclear protein extracts

Nuclear extract from P815-HTR cells was prepared essentially as described (Gorski et al., 1986 ; Shapiro et al., 1988), quick-frozen in liquid nitrogen, and stored at -70°C. Protein concentrations were determined using the Bio-Rad protein assay system.

In vitro coupled transcription-translation of human GATA-2

  1. Top of page
  2. Abstract
  3. MATERIALS AND METHODS
  4. Construction of TPH/luciferase reporter plasmids
  5. Construction of pTPH/luciferase reporter plasmids
  6. In vitro coupled transcription-translation of human GATA-2
  7. EMSA
  8. Preparation of DNA and oligonucleotide probes.
  9. RESULTS
  10. Identification of nuclear protein binding sites in the -429/-169 hTPH sequence
  11. Multiple proteins bind to the -310/-220 hTPH sequence
  12. The -270 TCGATAAT -263 hTPH sequence is essential for complex I and complex II formation
  13. Interaction of CDP/Cut with hTPH requires FP-I and additional 5′ flanking sequences
  14. Functional importance of the CDP/Cut binding site in hTPH gene transcription
  15. DISCUSSION
  16. Acknowledgements

The expression plasmid containing the coding sequence of human GATA-2 (hGATA-2/pSG5) (Gordon et al., 1997) was used as a template to synthesize hGATA-2 protein, using the TNT reticulocyte lysate systems (Promega), according to the manufacturer's recommendations. The parent pSG5 vector was used to produce the control lysate. Lysates (2 μl) were used in the EMSA.

DNase I footprint analysis

The pTPH (-429)/luc plasmid was first linearized with BamHI to generate a sense strand 5′ overhang. This 5′-end was dephosphorylated with bacterial alkaline phosphatase, and then end-labeled with [γ-32P]ATP, using T4 polynucleotide kinase. After the labeling reaction, the linearized plasmid was digested with PacI, which cleaves the hTPH fragment at nucleotide -169. The labeled -429/-169 hTPH fragment was isolated from the plasmid DNA by electrophoresis through an 8% wt/vol nondenaturing polyacrylamide gel.

Each binding reaction was performed in a 20-μl volume, containing 20,000 cpm of the labeled hTPH fragment, 10 mM HEPES (pH 7.9), 0.2 mM EDTA, 60 mM KCl, 7% vol/vol glycerol, 1 mM DTT, 2 μg poly(dI-dC), and 60 μg P815-HTR nuclear protein extract. After a 30-min incubation at room temperature, 5 μl of DNase I (0.008-0.3 U) was added to each reaction tube and the samples were further incubated for 2 min at room temperature. DNase I digestion was terminated by adding 75 μl of stop solution [20 mM Tris-HCl (pH 7.5), 20 mM EDTA, 5 mM EGTA, 0.5% wt/vol sodium dodecyl sulfate, and 0.01% wt/vol proteinase K]. The samples were incubated at 45°C for 1 h and then extracted with 100 μl of a mixture containing phenol/chloroform/isoamyl alcohol (25 : 24 : 1) to remove proteins. DNA fragments were precipitated with 2.0 volumes of ethanol, 0.1 volume of 3 M sodium acetate (pH 5.2), and 10 μg of tRNA. DNA pellets were resuspended in 5 μl of loading dye (98% vol/vol deionized formamide, 20 mM EDTA, 0.05% wt/vol bromophenol blue, and 0.05% wt/vol xylene cyanole FF) and fractionated in a 6% wt/vol denaturing polyacrylamide gel. A G + A sequencing ladder of the -429/-169 fragment was generated by incubating 20,000 cpm of the labeled fragment with 5 μl of acidic loading dye (pH 6.0) at 95°C for 20 min (Song et al., 1997). Bands were visualized by autoradiography.

Preparation of DNA and oligonucleotide probes.

  1. Top of page
  2. Abstract
  3. MATERIALS AND METHODS
  4. Construction of TPH/luciferase reporter plasmids
  5. Construction of pTPH/luciferase reporter plasmids
  6. In vitro coupled transcription-translation of human GATA-2
  7. EMSA
  8. Preparation of DNA and oligonucleotide probes.
  9. RESULTS
  10. Identification of nuclear protein binding sites in the -429/-169 hTPH sequence
  11. Multiple proteins bind to the -310/-220 hTPH sequence
  12. The -270 TCGATAAT -263 hTPH sequence is essential for complex I and complex II formation
  13. Interaction of CDP/Cut with hTPH requires FP-I and additional 5′ flanking sequences
  14. Functional importance of the CDP/Cut binding site in hTPH gene transcription
  15. DISCUSSION
  16. Acknowledgements

The -310/-220 hTPH fragment was amplified from the pTPH (-429)/luc plasmid by PCR. The amplified fragment was blunted at both ends, using the Klenow fragment of E. coli DNA polymerase I, and cloned into the EcoRV restriction enzyme site of pBluescript II KS +/- to generate the pBS-TPH (-310/-220) plasmid. The mutant -310/-220 hTPH fragment, containing altered base pairs at nucleotides -268, -267, and -264, was created by PCR mutagenesis, using pBS-TPH (-310/-220) as a template. The internal overlapping primers used in PCR mutagenesis are described in the section entitled “Construction of TPH/luciferase reporter plasmids,” and the external primers were M13 reverse and M13 forward primers. The mutant fragment was cloned into pBluescript II KS +/- to generate the pBS-TPH (MUT -310/-220) plasmid. The wild type and mutant -310/-220 hTPH fragments were obtained by digesting the corresponding plasmids with HindIII and EcoRI. The -291/-220 hTPH fragment (sense strand : -291 GTCCTATAGCAGGTCATTGTGTCGATAATAGGCGTTATCTTGGTTTGGA GAGAATGTCCAACTCTGGATTG -220) was obtained by digesting the pBS-TPH (-310/-220) plasmid with PstI and HindIII ; PstI cleaves at nucleotide -291 of the hTPH fragment and HindIII cleaves in the 3′ multiple cloning site of the plasmid. The fragments were gel-purified, dephosphorylated, and end-labeled with [γ-32P]ATP.

For oligonucleotide probes, the sense strands were endlabeled with [γ-32P]ATP, using polynucleotide kinase, and then annealed to their complementary unlabeled antisense strands.

Binding assays.

Each binding reaction was performed in a 20-μl volume, containing 20,000 cpm of the probe, 10 mM HEPES (pH 7.9), 1 mM EDTA, 50 mM KCl, 7% vol/vol glycerol, 1 mM DTT, 2 μg poly(dI-dC), and 10 μg of P815-HTR nuclear protein extract or 2 μl of reticulocyte lysate with or without hGATA-2 protein. After a 30-min incubation at room temperature, the samples were resolved in a 4% wt/vol nondenaturing polyacrylamide gel (acrylamide/bisacrylamide, 29 : 1). For competition experiments, 100-fold molar excess of the respective unlabeled consensus oligonucleotide was incubated with nuclear extract in a reaction mixture for 10 min before addition of the probe. For EMSA using antibody, 1.0 μl of a 1 : 10 dilution of anti-CDP antiserum (Neufeld et al., 1992) was preincubated on ice for 30 min with nuclear extract, reaction buffer, and poly(dI-dC) before addition of the probe. For distamycin A studies, the desired concentration of distamycin A was added to the reaction mixture before addition of the probe.

Oligonucleotides.

Complementary oligonucleotides corresponding to the hTPH FP-I sequence (sense strand : -282 CAGGTCATTGTGTCGATAATAGGCGTTATCTTGGTTTGGAGAGAATGTCCAACTCTGGATTG -220) and FP-II sequence (sense strand : -310 ACAGGCGAGAAGCACTGCAGTCCTATAGCAGGTCATTGT -272) were gel-purified and annealed to generate double-stranded oligonucleotides. The FP-I and FP-II oligonucleotides have an 11-bp overlap from -282 to -272. Consensus oligonucleotides used in competition experiments were : E36 (5′-CGGATCCGAATTCATCGATAATCGATTAT-3′), an oligonucleotide representative of the CDP/mClox binding site (Andres et al., 1994), and GATA (5′-CACTTGATAACAGAAAGTGATAACTCT-3′), a consensus binding site for GATA-1, GATA-2, and GATA-3.

Methylation interference analysis

The -310/-220 hTPH fragment, selectively labeled with 32P at the 5′ end, was partially methylated at guanine residues as described (Ausubel et al., 1994). Approximatley 5 × 106 cpm of the methylated probe was incubated at room temperature for 30 min in a 200-μl reaction mixture, containing 100 μg of nuclear protein extract, 10 mM HEPES (pH 7.9), 1 mM EDTA, 50 mM KCl, 7% vol/vol glycerol, 1 mM DTT, and 10 μg poly(dI-dC). Subsequently, the samples were fractionated in a 4% wt/vol nondenaturing polyacrylamide gel (acrylamide/bisacrylamide, 29 : 1). Free and bound probes were recovered from the gel, purified, cleaved with piperidine, and electrophoresed through a 12% wt/vol sequencing gel.

Identification of nuclear protein binding sites in the -429/-169 hTPH sequence

  1. Top of page
  2. Abstract
  3. MATERIALS AND METHODS
  4. Construction of TPH/luciferase reporter plasmids
  5. Construction of pTPH/luciferase reporter plasmids
  6. In vitro coupled transcription-translation of human GATA-2
  7. EMSA
  8. Preparation of DNA and oligonucleotide probes.
  9. RESULTS
  10. Identification of nuclear protein binding sites in the -429/-169 hTPH sequence
  11. Multiple proteins bind to the -310/-220 hTPH sequence
  12. The -270 TCGATAAT -263 hTPH sequence is essential for complex I and complex II formation
  13. Interaction of CDP/Cut with hTPH requires FP-I and additional 5′ flanking sequences
  14. Functional importance of the CDP/Cut binding site in hTPH gene transcription
  15. DISCUSSION
  16. Acknowledgements

Sites of protein-DNA interactions within the -429/-169 fragment were determined by DNase I footprint analysis (Fig. 1). P815-HTR nuclear extract produced a strong extensive protection from nucleotides -220 to -366. Within this large protected region, there are two sites, at nucleotides -282 and -310, where the DNA is exposed to DNase I. The large protection and the presence of DNase I accessible sites within this protected region suggest that this region is either bound by multiple proteins or by a single large protein that binds to multiple sites. For further study, the entire protected region was divided into three footprints, designated FP-I (-282/-220), FP-II (-310/-282), and FP-III (-366/-310) based on the unprotected sites at nucleotides -282 and -310.

image

Figure 1. DNase I footprint analysis of the -429/-169 hTPH fragment. A singly end-labeled -429/-169 fragment was incubated in the absence (Free) and presence of P815-HTR nuclear extract before partial digestion with various concentrations of DNase I. Increasing DNase I concentrations are indicated at the bottom. G + A, G and A sequence markers. Footprinted regions are indicated by black rectangles.

Download figure to PowerPoint

Multiple proteins bind to the -310/-220 hTPH sequence

  1. Top of page
  2. Abstract
  3. MATERIALS AND METHODS
  4. Construction of TPH/luciferase reporter plasmids
  5. Construction of pTPH/luciferase reporter plasmids
  6. In vitro coupled transcription-translation of human GATA-2
  7. EMSA
  8. Preparation of DNA and oligonucleotide probes.
  9. RESULTS
  10. Identification of nuclear protein binding sites in the -429/-169 hTPH sequence
  11. Multiple proteins bind to the -310/-220 hTPH sequence
  12. The -270 TCGATAAT -263 hTPH sequence is essential for complex I and complex II formation
  13. Interaction of CDP/Cut with hTPH requires FP-I and additional 5′ flanking sequences
  14. Functional importance of the CDP/Cut binding site in hTPH gene transcription
  15. DISCUSSION
  16. Acknowledgements

To further study protein binding sites in FP-I (nucleotides -282 to -220) and FP-II (nucleotides -310 to -282), EMSA was performed with the -310/-220 hTPH (FP-I + FP-II) probe, using P815-HTR extract. Two slow migrating complexes, designated I and II, were formed (Fig. 2, lane 2). A third faster complex appeared to be nonspecific binding, because it was not reproducible using different nuclear extract preparation. Both complexes I and II were eliminated by the addition of excess unlabeled self-competitor (lane 3). The unlabeled FP-I oligonucleotide completely eliminated complex II and slightly eliminated complex I (lane 4), suggesting that the protein in complex I has a much lower binding affinity for the FP-I oligonucleotide than the -310/-220 hTPH fragment. The unlabeled FP-II oligonucleotide had no effect on either complex (lane 5). These results indicate that the protein in complex II binds exclusively to the FP-I region, whereas the protein in complex I requires both FP-I and II to bind. In addition, a ternary complex was not formed with the -310 to -220 hTPH probe, indicating that the two complexes are formed by proteins binding to overlapping sites in a mutually exclusive manner.

image

Figure 2. Multiple proteins bind to the -310/-220 hTPH fragment. EMSA was performed with the -310/-220 probe, using 10 μg of P815-HTR nuclear extract. Lane 1, probe only ; lane 2, no competitor ; lanes 3-5, 100-fold molar excess of unlabeled DNA competitors as indicated. Two sequence-specific protein-DNA complexes are designated I and II.

Download figure to PowerPoint

The protein contact site(s) in the -310/-220 hTPH fragment was further investigated by methylation interference analysis, using P815-HTR nuclear extract (Fig. 3). Methylation of the -268 guanine residue in the sense strand strongly interfered with protein binding in complexes I and II. In addition, methylation of nucleotides -271 and -273 interfered with the binding of complex I to a lesser extent. Analyses of the sequence centered around nucleotide -268 revealed consensus recognition motifs for two distinct protein families, CDP/Cut and GATA (Fig. 4). The -270 TCGATAAT -263 hTPH sequence is identical to the core CDP/mClox binding site in the E36 oligonucleotide (Andres et al., 1994), and is nearly identical to the -102 TCGATAAA -95 motif in the CDP-α site of the gp91phox gene (Luo and Skalnik, 1996).

image

Figure 3. Methylation interference analysis of the -310/-220 hTPH fragment. The partially methylated hTPH probe was incubated with P815-HTR nuclear extract. F*, free probe that had not been passed through the gel ; F, free probe recovered from the unbound fraction after electrophoresis ; B1 and B2, bound probes recovered from complex I and complex II, respectively. The methylated guanine residue (nucleotide -268) that interfered with protein binding is indicated by an asterisk above the sequence and beside the sequence ladder of the sense strand.

Download figure to PowerPoint

image

Figure 4. Sequence comparisons of the -282/-220 (FP-I) hTPH with the E36 oligonucleotide, the gp91 phox CDP-α site, and the GATA consensus oligonucleotide. The E36 oligonucleotide represents the optimal CDP/mClox binding sequence. Consensus CDP/Cut core binding motifs are underlined ; consensus GATA binding motifs are indicated by arrows.

Download figure to PowerPoint

Two putative GATA recognition motifs, (T/A)GATA(A/G) (Whyatt et al., 1993), are located at nucleotides -269 to -264 (CGATAA) and nucleotides -257 to -252 (TTATCT) (Fig. 4). The -269 CGATAA -264 is not a perfect GATA motif, because it contains C instead of T or A at position -269. The -257 TTATCT -252 is a high-affinity binding GATA motif (Omichinski et al., 1993) in an inverted orientation.

Competition experiments were performed to determine whether GATA and CDP/Cut bind to the -310/-220 hTPH probe (Fig. 5A). It is interesting that complexes I and II formed with P815-HTR extract were differentially eliminated by the addition of excess unlabeled E36 (CDP/mClox binding site) and GATA oligonucleotides. The E36 oligonucleotide disrupted complex I (Fig. 5A, lane 4) and the GATA oligonucleotide disrupted complex II (lane 5). A combination of unlabeled E36 and GATA oligonucleotides disrupted both complexes (lane 6). A slight reduction in complex II formation was observed in the presence of excess unlabeled E36 oligonucleotide (lane 4). In addition, anti-CDP antiserum specifically disrupted complex I (lane 7), but preimmune serum had no effect on either complex (lane 8). When the E36 oligonucleotide was used as a probe, a single complex was formed and migrated to the same positions as complex I (Fig. 5B, compare lanes 2 and 5), and was disrupted by anti-CDP antiserum (lanes 3 and 6), further indicating that CDP/Cut is a component of complex I.

image

Figure 5. A : CDP/Cut is a component of complex I. EMSA was performed with the -310/-220 hTPH probe, using 10 μg of P815-HTR nuclear extract. Lane 1, probe only ; lane 2, probe with nuclear extract ; lanes 3-6, 100-fold molar excess unlabeled competitors as indicated ; lane 7, anti-CDP antiserum ; lane 8, preimmune serum. B : CDP/Cut forms a complex with the E36 oligonucleotide probe. Lanes 1-3, E36 probe :; lanes 4-6, -310/-220 hTPH prboe. Complexes I and II are indicated as I and II, respectively. C : hGATA-2 does not interact with the -310/-220 hTPH probe. EMSAs were performed with the GATA oligoneuclotide probe (lanes 1-4) and the -310/-220 hTPH probe (lanes 5-8). Lanes 1 and 5, probe only ; lanes 2 and 6, P815-HTR extract ; lanes 3 and 7, hGATA-2 lysate ; lanes 4 and 8, lysate without hGATA-2. complexes I and II are indicated as I and II, respectively.

Download figure to PowerPoint

P815 cells express high levels of GATA-2 (Martin et al., 1990 ; Zon et al., 1991). To test whether GATA-2 interacts with the -310/-220 hTPH probe, we used in vitro translated hGATA-2 in EMSA. The hGATA-2 lysate formed a complex with the GATA oligonucleotide probe but not with the -310/-220 hTPH probe (Fig. 5C, compare lanes 3 and 7). A faster migrating complex is visible in all the lanes, including the control lane (lane 4), indicating that this is a background signal. With the GATA probe, the hGATA-2 complex migrated to the same positions as the complex formed with P815-HTR extract (compare lanes 2 and 3). However, the hGATA-2 complex migrated much faster than complex II formed between the -310/-220 hTPH probe and P815-HTR extract (compare lanes 2 and 6), suggesting that they contain different proteins. The fast migration of hGATA-2 is consistent with its low molecular mass (50 kDa) (Dorfman et al., 1992) compared with that of CDP/Cut (180-190 kDa) (Neufeld et al., 1992). Collectively, these results suggest that GATA-2 is not a component of complex II.

Because we had only tested for GATA-2 binding, we next used an independent means to further rule out the involvement of other isoforms of GATA in the formation of complex II. Distamycin A, a DNA minor groove binding compound, has been shown to specifically disrupt the binding of transcription factors, such as CBF/NF-Y (Ronchi et al., 1995), CDP, and SATB1 (Banan et al., 1997) that interact with the minor groove of DNA. The recombinant GATA-1 DNA binding domain makes specific contact with eight bases, seven in the major groove and one in the minor groove of DNA (Omichinski et al., 1993). The mode of specific DNA interactions of other GATA members has not yet been clarified. It is thought that they make contact to DNA similar to GATA-1, because the amino acid sequences in the DNA binding domains of all GATA members are highly conserved.

By using EMSA, we showed that complexes I and II formed between the -310/-220 hTPH probe and P815-HTR extract were both disrupted by distamycin A at concentrations of 50-200 μM (Fig. 6A, lanes 3-5), indicating that both complexes interact with the minor groove of DNA. By contrast, the same concentrations of distamycin A had no effect on a complex formed between the GATA oligonucleotide probe and P815-HTR extract (Fig. 6B, lanes 3-5). This is further evidence that a protein other than a GATA family protein is a component of complex II.

image

Figure 6. Effect of distamycin A on the formation of protein-DNA complexes (A) -310/-220 hTPH probe and (B) GATA oligonucleotide probe. A and B : Lane 1, probe only ; lane 2, probe with nuclear extract ; lanes 3-5, various concentrations of distamycin A were added as indicated.

Download figure to PowerPoint

The -270 TCGATAAT -263 hTPH sequence is essential for complex I and complex II formation

  1. Top of page
  2. Abstract
  3. MATERIALS AND METHODS
  4. Construction of TPH/luciferase reporter plasmids
  5. Construction of pTPH/luciferase reporter plasmids
  6. In vitro coupled transcription-translation of human GATA-2
  7. EMSA
  8. Preparation of DNA and oligonucleotide probes.
  9. RESULTS
  10. Identification of nuclear protein binding sites in the -429/-169 hTPH sequence
  11. Multiple proteins bind to the -310/-220 hTPH sequence
  12. The -270 TCGATAAT -263 hTPH sequence is essential for complex I and complex II formation
  13. Interaction of CDP/Cut with hTPH requires FP-I and additional 5′ flanking sequences
  14. Functional importance of the CDP/Cut binding site in hTPH gene transcription
  15. DISCUSSION
  16. Acknowledgements

To further assess whether CDP/Cut is indeed interacting with the hTPH -270 TCGATAAT -263 sequence, a mutant -310/-220 hTPH fragment, containing three base-pair mutations in the CDP/Cut consensus motif (-270 TCGATAAT -263 mutated to -270 TCTC-TACT -263), was tested by EMSA (Fig. 7). In competition experiments, a 100-fold molar excess unlabeled mutant fragment was unable to eliminate either of the two complexes (lane 4). Likewise, in the reciprocal experiment in which the mutant fragment was used as a probe, no protein-DNA complex was formed (lane 6).

image

Figure 7. Mutations in the core CDP/Cut binding site disrupted both complexes I and II. EMSAs were performed with either the wild-type (WT ; lanes 1-4) or mutant (MUT ; lanes 5 and 6) -310/-220 hTPH probes, using P815-HTR nuclear extract. Competitions with 100-fold molar excess of unlabeled oligonucleotides are indicated.

Download figure to PowerPoint

Interaction of CDP/Cut with hTPH requires FP-I and additional 5′ flanking sequences

  1. Top of page
  2. Abstract
  3. MATERIALS AND METHODS
  4. Construction of TPH/luciferase reporter plasmids
  5. Construction of pTPH/luciferase reporter plasmids
  6. In vitro coupled transcription-translation of human GATA-2
  7. EMSA
  8. Preparation of DNA and oligonucleotide probes.
  9. RESULTS
  10. Identification of nuclear protein binding sites in the -429/-169 hTPH sequence
  11. Multiple proteins bind to the -310/-220 hTPH sequence
  12. The -270 TCGATAAT -263 hTPH sequence is essential for complex I and complex II formation
  13. Interaction of CDP/Cut with hTPH requires FP-I and additional 5′ flanking sequences
  14. Functional importance of the CDP/Cut binding site in hTPH gene transcription
  15. DISCUSSION
  16. Acknowledgements

Because methylation interference (Fig. 3) and mutational analyses of the binding site (Fig. 7) indicate that CDP/Cut binds to the -270 TCGATAAT -263 motif in FP-I (-282/-220), we wanted to test whether the FP-I oligonucleotide is sufficient for CDP/Cut binding. EMSAs were performed with the FP-I probe, using P815-HTR extract (Fig. 8A). The complex formed with this probe exhibited features similar to that of complex II formed with the -310/-220 probe ; i.e., it was disrupted by the addition of a 100-fold molar excess unlabeled GATA consensus oligonucleotide (lane 4), there was a slight reduction with E36 (lane 5), and anti-CDP antiserum had no effect (lane 6). Obviously, CDP/Cut does not bind to the FP-I probe that contains the CDP/Cut core binding motif. To test whether sequences flanking the FP-I probe are necessary for CDP/Cut binding, the -291/-220 hTPH probe, which contains nine additional base pairs at the 5′ end of FP-I and overlaps 19 bp with FP-II, was used in EMSA (Fig. 8B). Similar to the FP-I probe, a single complex corresponding to complex II was observed, and thus, these additional sequences are not sufficient to support CDP/Cut binding. Furthermore, EMSA performed with the FP-II probe (-310/-272) exhibited no protein binding (Fig. 8C, lane 2). These results are consistent with our previous competition results (Fig. 2), which suggest that neither FP-I nor FP-II alone is sufficient for CDP/Cut binding and further suggest that there are sequences in FP-II required for CDP/Cut binding.

image

Figure 8. EMSA with FP-I (-282/-220) hTPH probe (A), -291/-220 hTPH probe (B), and FP-II (-310/-272) probe (C). Lane 1, probe only ; lane 2, probe with nuclear extract ; lanes 3-5, 100-fold molar excess unlabeled competitors as indicated ; lane 6, anti-CDP antiserum.

Download figure to PowerPoint

Functional importance of the CDP/Cut binding site in hTPH gene transcription

  1. Top of page
  2. Abstract
  3. MATERIALS AND METHODS
  4. Construction of TPH/luciferase reporter plasmids
  5. Construction of pTPH/luciferase reporter plasmids
  6. In vitro coupled transcription-translation of human GATA-2
  7. EMSA
  8. Preparation of DNA and oligonucleotide probes.
  9. RESULTS
  10. Identification of nuclear protein binding sites in the -429/-169 hTPH sequence
  11. Multiple proteins bind to the -310/-220 hTPH sequence
  12. The -270 TCGATAAT -263 hTPH sequence is essential for complex I and complex II formation
  13. Interaction of CDP/Cut with hTPH requires FP-I and additional 5′ flanking sequences
  14. Functional importance of the CDP/Cut binding site in hTPH gene transcription
  15. DISCUSSION
  16. Acknowledgements

The functional importance of the CDP/Cut binding site was assessed in the context of the pTPH(-429)/luc plasmid. A mutant plasmid, carrying three altered base pairs in the core CDP/Cut binding site, was created from pTPH(-429)/luc by PCR mutagenesis. Transcriptional activities of the wild-type and mutant pTPH(-429)/luc plasmids were assessed by transient transfection assays in P815-HTR cells.

The RLA of the wild-type plasmid was arbitrarily set at 1.00 and served as a reference for comparison. As shown in Fig. 9, mutations in the core CDP/Cut binding element markedly increased the RLA (mean ± SEM = 4.13 ± 0.10) in P815-HTR cells, indicating that the protein(s) that binds to this regulatory element functions as a repressor. Because CDP/Cut has been shown to repress transcription of many target genes, we speculate that disruption of CDP/Cut binding was responsible, at least in part, for the activation of the hTPH gene.

image

Figure 9. Mutations in the core CDP/Cut binding element caused the activation of hTPH gene transcription. The wild-type (WT) and mutant (MUT) pTPH (-429)/luc plasmids were individually contransfected with the internal control plasmid pRL-TK into P815-HTR cells. The RLA of the WT is arbitrarily set at 1.00. Each value represents the mean ± SEM from nine transfections (three transfections per independent experiment). Statistical analysis was performed by Student's unpaired t test. Difference between WT and MUT RLAs is significant (p < 0.001).

Download figure to PowerPoint

DISCUSSION

  1. Top of page
  2. Abstract
  3. MATERIALS AND METHODS
  4. Construction of TPH/luciferase reporter plasmids
  5. Construction of pTPH/luciferase reporter plasmids
  6. In vitro coupled transcription-translation of human GATA-2
  7. EMSA
  8. Preparation of DNA and oligonucleotide probes.
  9. RESULTS
  10. Identification of nuclear protein binding sites in the -429/-169 hTPH sequence
  11. Multiple proteins bind to the -310/-220 hTPH sequence
  12. The -270 TCGATAAT -263 hTPH sequence is essential for complex I and complex II formation
  13. Interaction of CDP/Cut with hTPH requires FP-I and additional 5′ flanking sequences
  14. Functional importance of the CDP/Cut binding site in hTPH gene transcription
  15. DISCUSSION
  16. Acknowledgements

In this study, we have identified a negative regulatory element in the -310 to -220 hTPH sequence. This region is recognized by at least two distinct nuclear proteins, one of which is CDP/Cut (Fig. 2, complex I). CDP/Cut is a protein of 180-190 kDa and is a human homologue of the Drosophilia cut homeoprotein (Neufeld et al., 1992). CDP/Cut contains four evolutionary conserved DNA binding domains (DBDs), three Cut repeats (CR I, CR II, and CR III) and a homeodomain (HD). Each domain, expressed individually as a fusion protein, can bind to related but distinct DNA sequences (Andres et al., 1994 ; Aufiero et al., 1994 ; Harada et al., 1995). How the native CDP/Cut protein interacts with DNA is not clear. It is believed that multiple DBDs are involved in the binding of this protein. In the gp91phox gene, CDP/Cut binds to multiple sites, having strong affinity to one site and weaker affinities to at least three more distal binding sites (Luo and Skalnik, 1996). Also, binding of CDP/Cut may require cooperative binding of multiple DBDs to multiple sites within the same promoter (Harada et al., 1995). This is consistent with our finding that at least two regions, FP-I and FP-II, are required for CDP/Cut to bind the hTPH promoter.

We showed by methylation interference and mutational analyses that the CDP/Cut core binding motif -270 TCGATAAT -263 is located in FP-I (-282/-220). However, CDP/Cut did not bind to the FP-I (Fig. 8A) or the -291/-220 probes (Fig. 8B). These results led us to believe that CDP/Cut requires an additional extended region of the hTPH promoter to form a stable protein-DNA complex. In contrast, CDP/Cut can bind to the E36 oligonucleotide (Fig. 5B), which contains the same CDP/Cut core motif, flanked by 14 and 7 bp in the 5′ and 3′ ends, respectively. The E36 oligonucleotide was determined by PCR-mediated random site selection as an optimal binding site for CDP/mClox (Andres et al., 1994). The HD and Cut repeat II (CR II), expressed individually as fusion proteins, bound independently to the E36 oligonucleotide, but CR I and CR III did not bind. The consensus binding motifs for individual HD and CR II are distinct but partially overlapping and also overlap with the binding motif of native CDP/mClox, indicating that CDP/mClox is a bipartite DNA binding protein in which the two subdomains HD and CR II contribute to the binding specificity of this protein to the target sites (Andres et al., 1994). Thus, it appears that the E36 oligonucleotide can form a stable CDP-DNA complex because it binds to at least two DBDs. Accordingly, we speculate that FP-I contains only a single binding site for one of the four CDP/Cut DBDs, which is not sufficient to support CDP/Cut binding. Additional contact points for CDP/Cut are likely located in the FP-II region, because CDP/Cut binds strongly to the -310/-220 hTPH probe containing both FP-I and II. The precise CDP/Cut binding sequences in FP-II are not known because methylation interference analysis revealed no protection over this region. CDP/Cut can bind many diverse sequences that are AT-rich and contain a minimal ATTA or ATA core sequence (Andres et al., 1994). The FP-II sequence is not AT-rich, but it does contain an ATA motif at nucleotides -286 to -284. This core ATA and its flanking sequences do not resemble the optimal binding motif but could serve as a degenerate binding site.

In the FP-I region, there is one GATA motif that is adjacent (-257 TTATCT -252) to the hTPH CDP/Cut binding site and another that overlaps (-269 CGATAA -264) it. P815 cells express high levels of GATA-2 (Martin et al., 1990 ; Zon et al., 1991). Although P815-HTR extract formed a complex II with the -310/-220 hTPH probe, which was eliminated by a 100-fold molar excess GATA consensus oligonucleotide, in vitro translated hGATA-2 protein failed to bind to this probe. Experiments using distamycin A also suggest to us that a protein other than GATA is a component of complex II. Distamycin A, a compound that selectively binds to the minor groove of AT-rich DNA sequences, did not affect formation of the GATA complex (Fig. 6B). That distamycin A was unable to disrupt the GATA complex would be explained by the finding that GATA makes contact mostly with bases in the major groove of DNA (Omichinski et al., 1993). In contrast, the same concentrations of distamycin A effectively disrupted both complexes I and II (Fig. 6A), indicating that the proteins in these two complexes interact with the minor groove of DNA. The difference in the pattern of displacement by distamycin A between complex II and the GATA complex indicates that GATA is not a protein component of complex II.

CDP/Cut and related proteins have been shown to repress transcription of many genes, including sea urchin histone H2B (Barberis et al., 1987), human gp91phox (Skalnik et al., 1991 ; Luo and Skalnik, 1996), human γ-globin (McDonagh and Nienhuis, 1991), mouse neural cell adhesion molecule (N-CAM) (Valarche et al., 1993), human c-myc (Dufort and Nepveu, 1994), rat c-mos (Higgy et al., 1997), and human lactoferrin (Khanna-Gupta et al., 1997). In addition, it is likely that the cut-like protein CDP2 represses tyrosine hydroxylase expression in the rat (Yoon and Chikaraishi, 1994). Tyrosine hydroxylase, like TPH, is a member of the aromatic amino acid hydroxylase family and the two enzymes share many of the same properties. It is interesting that both the tyrosine and TPH genes are bound and possibly regulated by CDP/Cut. Mutations in the hTPH CDP/Cut binding site resulted in an approximately fourfold increase in relative luciferase activity in P815-HTR (Fig. 9), suggesting that this element negatively regulates hTPH gene transcription.

The mechanism through which CDP/Cut mediates transcriptional repression is not fully understood, but several mechanisms have been proposed (Aufiero et al., 1994 ; Mailly et al., 1996 ; Banan et al., 1997 ; Khanna-Gupta et al., 1997). One proposed mechanism involves direct interaction of the CDP/Cut repression domain with the basal transcriptional machinery to prevent the assembly of the preinitiation complex (Mailly et al., 1996). A second mechanism may involve alteration in gene structure, which places the gene in an inactive configuration. The precise way CDP/Cut alters gene structure is not completely understood, but it may involve enhancing or altering association of the DNA with the nuclear matrix (Banan et al., 1997). A third mechanism involves competition with an activator protein(s) that binds to an adjacent or overlapping binding site, which prevents transactivation. This mechanism was evident in the sea urchin histone H2B (Barberis et al., 1987) and gp91phox (Skalnik et al., 1991 ; Luo and Skalnik, 1996) genes where negative regulation by CDP/Cut was shown to be mediated through displacement of the adjacent CCAAT box binding factor. The hTPH gene contains an inverted CCAAT box (-67 ATTGG -63) in the proximal promoter but no obvious CCAAT box near the CDP/Cut binding site.

Because mutagenesis of the CDP/Cut site eliminated formation of both complexes I and II, we were not able to definitively determine the functional contribution of each of the protein-DNA interactions identified in this study. Although loss of CDP/Cut binding resulted in increased expression, deletion of the TPH sequence from -429 to -164 had no significant effect on activity in P815-HTR cells (Teerawatanasuk and Carr, 1998). A possible explanation for this inconsistency is that while deletion of the fragment simultaneously removed all the regulatory elements in this region, mutations selectively removed the CDP/Cut binding site, leaving other regulatory elements intact. Our preliminary study by EMSA, using the -429/-312 hTPH probe, which contains FP-III (-366 to -310), revealed multiple protein-DNA complexes formed with P815-HTR nuclear extract (data not shown). As FP-III (-366 to -310) lies very close to the CDP/Cut binding site (Fig. 1), it is possible that the protein(s) that binds to this region is a target for displacement by CDP/Cut. It remains to be investigated whether this protein(s) is a likely transcriptional activator candidate whose function is suppressed by CDP/Cut.

In summary, we have identified two overlapping protein binding sites in the hTPH promoter, one of which is a CDP/Cut binding site. Mutations in the CDP/Cut core motif, which disrupted protein binding in EMSA, resulted in a marked increase in hTPH gene transcription in a TPH-expressing cell line. Because CDP/Cut has been shown to repress transcription of many target genes, we speculate that the disruption of CDP/Cut binding was responsible, at least in part, for hTPH gene activation.

Acknowledgements

  1. Top of page
  2. Abstract
  3. MATERIALS AND METHODS
  4. Construction of TPH/luciferase reporter plasmids
  5. Construction of pTPH/luciferase reporter plasmids
  6. In vitro coupled transcription-translation of human GATA-2
  7. EMSA
  8. Preparation of DNA and oligonucleotide probes.
  9. RESULTS
  10. Identification of nuclear protein binding sites in the -429/-169 hTPH sequence
  11. Multiple proteins bind to the -310/-220 hTPH sequence
  12. The -270 TCGATAAT -263 hTPH sequence is essential for complex I and complex II formation
  13. Interaction of CDP/Cut with hTPH requires FP-I and additional 5′ flanking sequences
  14. Functional importance of the CDP/Cut binding site in hTPH gene transcription
  15. DISCUSSION
  16. Acknowledgements

This study was supported by Public Service grants AA07611, AA10707, and CA58947 and the Arthritis Foundation. We gratefully acknowledge W. Biddison, National Institute for Neurological Disorders and Stroke, National Institutes of Health, MD, U.S.A., for P815-HTR cells. We are grateful to E. J. Neufeld, Harvard University, Boston, MA, U.S.A., for anti-CDP antiserum. We also express our gratitude to D. F. Gordon, University of Colorado Health Sciences Center, Denver, CO, U.S.A., and S. H. Orkin, Harvard University, Boston, MA, U.S.A., for the hGATA-2 expression plasmid. We thank Dr. Ann Roman, Indiana University School of Medicine, Indianapolis, IN, U.S.A., for critical reading of the manuscript.

  • 1
    Andres V., Nadal-Ginard B., Mahdavi V. (1992) Clox, a mammalian homeobox gene related to Drosophila cut, encodes DNA-binding regulatory proteins differentially expressed during development.Development 116,321334.
  • 2
    Andres V., Chiara M.D., Mahdavi V. (1994) A new bipartite DNA-binding domain : cooperative interaction between the cut repeat and homeo domain of the cut homeo proteins.Genes Dev. 8,245257.
  • 3
    Aufiero B., Neufeld E.J., Orkin S.H. (1994) Sequence-specific DNA binding of individual cut repeats of the human CCAAT displacement/cut homeodomain protein.Proc. Natl. Acad. Sci. USA 91,77577761.
  • 4
    Ausubel F.M., Brent R., Kingston R.E., Moore D.D., Seidman J.G., Smith J.A., Struhl K. , eds (1994) Methylation and uracil interference assays for analysis of protein-DNA interactions, inCurrent Protocols in Molecular Biology, pp. 12.13.1112.13.17. Green Publishing Associates and John Wiley and Sons, New York.
  • 5
    Banan M., Rojas I.C., Lee W.H., King H.L., Harriss J.V., Kobayashi R., Webb C.F., Gottlieb P.D. (1997) Interaction of the nuclear matrix-associated region (MAR)-binding proteins, SATB1 and CDP/Cux, with a MAR element (L2a) in an upstream regulatory region of the mouse CD8a gene.J. Biol. Chem. 272,1844018452.
  • 6
    Barberis A., Superti-Furga G., Busslinger M. (1987) Mutually exclusive interaction of the CCAAT-binding factor and of a displacement protein with overlapping sequences of a histone gene promoter.Cell 50,347359.
  • 7
    Blier P. & De Montigny C. (1994) Current advances and trends in the treatment of depression.Trends Pharmacol. Sci. 15,220226.
  • 8
    Boularand S., Darmon M.C., Ravassard P., Mallet J. (1995) Characterization of the human tryptophan hydroxylase gene promoter. Transcriptional regulation by cAMP requires a new motif distinct from the cAMP-responsive element.J. Biol. Chem. 270,37573764.
  • 9
    Crow T.J., Baker H.F., Cross A.J., Joseph M.H., Lofthouse R., Longden A., Owen F., Riley G.J., Glover V., Killpack W.S. (1979) Monoamine mechanisms in chronic schizophrenia : post-mortem neurochemical findings.Br. J. Psychiatry 134,249256.
  • 10
    Deguchi T. (1977) Tryptophan hydroxylase in pineal gland of rat : postsynaptic localization and absence of circadian change.J. Neurochem. 28,667668.
  • 11
    DeVeaugh-Geiss J. (1993) Diagnosis and treatment of obsessive compulsive disorder.Annu. Rev. Med. 44,5361.
  • 12
    Dorfman D.M., Wilson D.B., Bruns G.A., Orkin S.H. (1992) Human transcription factor GATA-2. Evidence for regulation of preproendothelin-1 gene expression in endothelial cells.J. Biol. Chem. 267,12791285.
  • 13
    Dufort D. & Nepveu A. (1994) The human cut homeodomain protein represses transcription from the c-myc promoter.Mol. Cell. Biol. 14,42514257.
  • 14
    Gershon M.D., Dreyfus C.F., Pickel V.M., Joh T.H., Reis D.J. (1977) Serotonergic neurons in the peripheral nervous system : identification in gut by immunohistochemical localization of tryptophan hydroxylase.Proc. Natl. Acad. Sci. USA 74,30863089.
  • 15
    Gordon D.F., Lewis S.R., Haugen B.R., James R.A., McDermott M.T., Wood W.M., Ridgway E.C. (1997) Pit-1 and GATA-2 interact and functionally cooperate to activate the thyrotropin beta-subunit promoter.J. Biol. Chem. 272,2433924347.
  • 16
    Gorski K., Carneiro M., Schibler U. (1986) Tissue-specific in vitro transcription from the mouse albumin promoter.Cell 47,767776.
  • 17
    Graham F.L. & Van Der Eb A.J. (1973) A new technique for the assay of infectivity of human adenovirus 5 DNA.Virology 52,456467.
  • 18
    Grahame-Smith D.G. (1964) Tryptophan hydroxylation in brain.Biochem. Biophys. Res. Commun. 16,586592.
  • 19
    Harada R., Berube G., Tamplin O.J., Denis-Larose C., Nepveu A. (1995) DNA-binding specificity of the cut repeats from the human cut-like protein.Mol. Cell. Biol. 15,129140.
  • 20
    Higgy N.A., Tarnasky H.A., Valarche I., Nepveu A., Van Der Hoorn F.A. (1997) Cux/CDP homeodomain protein binds to an enhancer in the rat c-mos locus and represses its activity.Biochim. Biophys. Acta 1351,313324.
  • 21
    Higuchi R. (1989) Using PCR to engineer DNA, inPCR Technology : Principles and Applications for DNA Amplification (Erlich H. A., ed), pp. 6170. Stockton Press, New York.
  • 22
    Huh S.O., Park D.H., Cho J.Y., Joh T.H., Son J.H. (1994) A 6.1 kb 5′ upstream region of the mouse tryptophan hydroxylase gene directs expression of E. coli lacZ to major serotonergic brain regions and pineal gland in transgenic mice.Mol. Brain Res. 24,145152.
  • 23
    Jequier E., Lovenberg W., Sjoerdsma A. (1967) Tryptophan hydroxylase inhibition : the mechanism by which p-chlorophenylalanine depletes rat brain serotonin. Mol. Pharmacol. 3,274278.
  • 24
    Khanna-Gupta A., Zibello T., Kolla S., Neufeld J., Berlinder N. (1997) CCAAT displacement protein (CDP/Cut) recognizes a silencer element within the lactoferin gene promoter.Blood 90,27842795.
  • 25
    Korpi E.R., Kleinman J.E., Goodman S.I., Phillips I., DeLisi L.E., Linnoila M., Wyatt R.J. (1986) Serotonin and 5-hydroxyindoleacetic acid in brains of suicide victims. Comparison in chronic schizophrenic patients with suicide as cause of death.Arch. Gen. Psychiatry 43,594600.
  • 26
    Kuhar M.J., Aghajanian G.K., Roth R.H. (1972) Tryptophan hydroxylase activity and synaptosomal uptake of serotonin in discrete brain regions after midbrain raphe lesions : correlations with serotonin levels and histochemical fluorescence.Brain Res. 44,165176.
  • 27
    Legacy C., Faudon M., Hery F., Ternaux J.P. (1983) 5-HT metabolism in the intestinal wall of the rat. I. The mucosa.Neurochem. Int. 5,721727.
  • 28
    Lovenberg W., Levine R.J., Sjoerdsma A. (1965) A tryptophan hydroxylase in cell-free extracts of malignant mouse mast cells.Biochem. Pharmacol. 14,887889.
  • 29
    Luo W. & Skalnik D.G. (1996) CCAAT displacement protein competes with multiple transcriptional activators for binding to four sites in the proximal gp91 phox promoter.J. Biol. Chem. 271,1820318210.
  • 30
    Mailly F., Berube G., Harada R., Mao P.L., Phillips S., Nepveu A. (1996) The human cut homeodomain protein can repress gene expression by two distinct mechanisms : active repression and competition for binding site occupancy.Mol. Cell. Biol. 16,53465357.
  • 31
    Martin D.I., Zon L.I., Mutter G., Orkin S.H. (1990) Expression of an erythroid transcription factor in megakaryocytic and mast cell lineages.Nature 344,444447.
  • 32
    McDonagh K.T. & Nienhuis A.W. (1991) Induction of the human γ-globin gene promoter in K562 cells by sodium butyrate : reversal of repression by CCAAT displacement protein. Blood 78,255a.
  • 33
    Neufeld E.J., Skalnik D.G., Lievens P.M., Orkin S.H. (1992) Human CCAAT displacement protein is homologous to the Drosophila homeoprotein, cut.Nat. Genet. 1,5055.
  • 34
    Nordeen S.K. (1988) Luciferase reporter gene vectors for analysis of promoters and enhancers.Biotechniques 6,454458.
  • 35
    Omichinski J.G., Clore G.M., Schaad O., Felsenfeld G., Trainor C., Appella E., Stahl S.J., Gronenborn A.M. (1993) NMR structure of a specific DNA complex of Zn-containing DNA binding domain of GATA-1.Science 261,438446.
  • 36
    Reed G.E., Kirchner J.E., Carr L.G. (1995) NF-Y activates mouse tryptophan hydroxylase transcription.Brain Res. 682,112.
  • 37
    Ronchi A., Bellorini M., Mongelli N., Mantovani R. (1995) CCAAT-box binding protein NF-Y (CBF, CP1) recognizes the minor groove and distorts DNA.Nucleic Acids Res. 23,45654572.
  • 38
    Sato T.L., Jequier E., Lovenberg W., Sjoerdsma A. (1967) Characterization of a tryptophan hydroxylating enzyme from malignant mouse mast cell.Eur. J. Pharmacol. 1,1825.
  • 39
    Sellers E.M., Higgins G.A., Sobell M.B. (1992) 5-HT and alcohol abuse.Trends Pharmacol. Sci. 13,6975.
  • 40
    Shapiro D.J., Sharp P.A., Wahli W.W., Keller M.J. (1988) A high-efficiency HeLa cell nuclear transcription extract.DNA 7,4755.
  • 41
    Skalnik D.G., Strauss E.C., Orkin S.H. (1991) CCAAT displacement protein as a repressor of the myelomonocytic-specific gp91-phox gene promoter.J. Biol. Chem. 266,1673616744.
  • 42
    Song C.S., Jung M.H., Chen S., Chatterjee B. (1997) A rapid one-step procedure for preparation of G plus A sequence markers by acid-induced apurinization and DNA cleavage.Elsevier Trends Journals Technical Tips Online : http://www.tto.trends.com. T40074.
  • 43
    Teerawatanasuk N. & Carr L.G. (1998) CBF/NF-Y activates transcription of the human tryptophan hydroxylase gene through an inverted CCAAT box.Mol. Brain Res. 55,6170.
  • 44
    Thomas K.B. & Invone P.M. (1991) Circadian rhythm of tryptophan hydroxylase activity in chicken retina.Cell. Mol. Neurobiol. 11,511527.
  • 45
    Tong J.H. & Kaufman S. (1975) Tryptophan hydroxylase. Purification and some properties of the enzyme from rabbit hindbrain.J. Biol. Chem. 250,41524158.
  • 46
    Valarche I., Tissier-Seta J.P., Hirsch M.R., Martinez S., Goridis C., Brunet J.F. (1993) The mouse homeodomain protein Phox2 regulates Ncam promoter activity in concert with Cux/CDP and is a putative determinant of neurotransmitter phenotype.Development 119,881896.
  • 47
    Whyatt D.J., De Boer E., Grosveld F. (1993) The two zinc fingerlike domains of GATA-1 have different DNA binding specificities.EMBO J. 12,49935005.
  • 48
    Yoon S.O. & Chikaraishi D.M. (1994) Isolation of two E-box binding factors that interact with the rat tyrosine hydroxylase enhancer.J. Biol. Chem. 269,1845318462.
  • 49
    Zon L.I., Gurish M.F., Stevens R.L., Mather C., Reynolds D.S., Austen K.F., Orkin S.H. (1991) GATA-binding transcription factors in mast cells regulate the promoter of the mast cell carboxypeptidase A gene.J. Biol. Chem. 266,2294822953.