Extracellular-Regulated Kinases and Phosphatidylinositol 3-Kinase Are Involved in Brain-Derived Neurotrophic Factor-Mediated Survival and neuritogenesis of the Neuroblastoma Cell Line SH-SY5Y

Authors

  • M. Encinas,

    1. Grup de Neurobiologia Molecular, Department de Ciències Mèdiques Bàsiques, Facultat de Medicina, Universitat de Lleida, Lleida, Catalonia, Spain
    Search for more papers by this author
  • M. Iglesias,

    1. Grup de Neurobiologia Molecular, Department de Ciències Mèdiques Bàsiques, Facultat de Medicina, Universitat de Lleida, Lleida, Catalonia, Spain
    Search for more papers by this author
  • N. Llecha,

    1. Grup de Neurobiologia Molecular, Department de Ciències Mèdiques Bàsiques, Facultat de Medicina, Universitat de Lleida, Lleida, Catalonia, Spain
    Search for more papers by this author
  • J. X. Comella

    1. Grup de Neurobiologia Molecular, Department de Ciències Mèdiques Bàsiques, Facultat de Medicina, Universitat de Lleida, Lleida, Catalonia, Spain
    Search for more papers by this author

  • The present address of Dr. N. Llecha is Servei d'Anàlisi Clíniques, Hospital Universitari Arnau de Vilanova, Lleida, Catalonia, Spain.

  • Abbreviations used : BDNF, brain-derived neurotrophic factor ; DMEM, Dulbecco's modified Eagle's medium ; ERK, extracellular signal-regulated kinase ; GAP-43, growth-associated protein-43 ; MAPK, mitogen-activated protein kinase ; MEK, MAPK and ERK kinase ; NGF, nerve growth factor ; NT-3, neurotrophin-3 ; NT-4/5, neurotrophin-4/5 ; PAGE, polyacrylamide gel electrophoresis ; PBS, phosphate-buffered saline ; PI 3-K, phosphatidylinositol 3-kinase ; PLCγ, phospholipase Cγ ; RA, retinoic acid ; SDS, sodium dodecyl sulfate ; Trk, tropomyosin receptor kinase.

Address correspondence and reprint requests to Dr. J. X. Comella at Unit of Molecular Neurobiology, Department de Ciències Mèdiques Bàsiques, Universitat de Lleida, Rovira Roure 44, E-25198 Lleida, Spain.

Abstract

Abstract : Retinoic acid (RA) induces the differentiation of many cell lines, including those derived from neuroblastoma. RA treatment of SH-SY5Y cells induces the appearance of functional Trk B and Trk C receptors. Acute stimulation of RA-predifferentiated SH-SY5Y cells with brain-derived neurotrophic factor (BDNF), neurotrophin 3 (NT-3), or neurotrophin 4/5 (NT-4/5), but not nerve growth factor (NGF), induces Trk autophosphorylation, followed by phosphorylation of Akt and the extracellular signal-regulated kinases (ERKs) 1 and 2. In addition, BDNF, NT-3, or NT-4/5, but not NGF, promotes cell survival and neurite outgrowth in serum-free medium. The mitogen-activated protein kinase and ERK kinase (MEK) inhibitor PD98059 blocks BDNF-induced neurite outgrowth and growth-associated protein-43 expression but has no effects on cell survival. On the other hand, the phosphatidylinositol 3-kinase inhibitor LY249002 reverses the survival response elicited by BDNF, leading to a cell death with morphological features of apoptosis.

Neurotrophins constitute a family of structurally related growth factors that regulate neuronal survival, maturation, and function of several populations of neurons. This family includes nerve growth factor (NGF), brain-derived neurotrophic factor (BDNF), neurotrophin-3 (NT-3), neurotrophin-4/5 (NT-4/5), and neurotrophin-6 (Lewin and Barde, 1996). Increasing evidence suggests that the survival of defined populations of neurons is promoted by specific neurotrophins (Davies, 1994, 1996). The biological effects of neurotrophins on neuronal cells are mediated by two classes of specific receptors. The first, p75NTR, does not show any binding preference for the different neurotrophins (reviewed by Bothwell, 1995) and has been recently found to be involved in the regulation of neuronal survival due to its ability to induce apoptosis (Bunone et al., 1997 ; reviewed by Kaplan and Miller, 1997). The second, the tropomyosin receptor kinase (Trk) family of tyrosine kinase receptors, binds neurotrophins in a specific manner. Trk A is predominantly activated by NGF, Trk B by BDNF or NT-4/5, and Trk C by NT-3. NT-3, however, can also activate Trk B and Trk A to a lesser extent than their specific ligands (Barbacid, 1995 ; Chao and Hempstead, 1995).

Continuously dividing cell lines such as the neuroblastoma SH-SY5Y have been widely used as a model to study neurodegenerative disorders such as Alzheimer's (Lambert et al., 1994 ; Li et al., 1996 ; Hartmann et al., 1997 ; Peraus et al., 1997) and Parkinson's (Sheehan et al., 1997) diseases. Neuroblastoma cell lines differentiate into cells that are biochemically, ultrastructurally, and electrophysiologically similar to neurons (Abemayor and Sidell, 1989) after being treated with different agents such as neurotrophic factors (Kaplan et al., 1993), retinoic acid (RA) or phorbol ester (Pahlman et al., 1995), or staurosporine (Jalava et al., 1992, 1993). RA causes the differentiation of SH-SY5Y cells and mediates biological responsiveness of the cells to the Trk B ligands BDNF and NT-3 by stimulating the expression of Trk B receptors (Kaplan et al., 1993). Several signal transduction pathways are used by the neurotrophins to mediate cellular events such as survival and differentiation (reviewed by Segal and Greenberg, 1996 ; Kaplan and Miller, 1997). Some proteins are known to associate with NGF-activated Trk ; among them are Shc, phospholipase Cγ1 (PLCγ1), phosphatidylinositol 3-kinase (PI 3-K), and SHP. These proteins are thought to couple Trk to different intracellular signaling pathways (Barbacid, 1995). Thus, for example, tyrosine phosphorylation of Shc due to its interaction to Trk results in a rapid activation of the Ras/mitogen-activated protein kinase (MAPK) pathway (reviewed by Segal and Greenberg, 1996). The use of neutralizing Ras antibodies (Nobes and Tolkovsky, 1995), dominant-positive and -negative variants of MAPK and extracellular signal-regulated kinase (ERK) kinase (MEK) (Cowley et al., 1994), or the selective MEK inhibitor PD98059 (Pang et al., 1995) has shown that Ras and MEK are necessary for NGF-induced neuritogenesis or survival in PC12 cells and rat sympathetic neurons (reviewed by Kaplan and Stephens, 1994 ; Kaplan and Miller, 1997). However, PD98059 was unable to block NGF-mediated neurite outgrowth from chick sensory and sympathetic neurons, indicating that MEK and MAPK might not be necessary for neuritogenesis in peripheral neurons (Klinz et al., 1996). NGF-activated Trk can also stimulate the PI 3-K/Akt pathway (Ohmichi et al., 1992 ; Burgering and Coffer, 1995 ; Franke et al., 1995). This pathway has been involved in neurotrophic factor-induced cell survival in different systems (Yao and Cooper, 1995, 1996 ; Vemuri and McMorris, 1996 ; D'Mello et al., 1997 ; Dudek et al., 1997 ; Miller et al., 1997).

The results described above have been mainly obtained using the PC12 cell line, which responds to NGF through Trk A (Greene and Tischler, 1976). Little information is available about the intracellular pathways triggered by Trk B or Trk C as a result of activation by BDNF, NT-3, or NT-4/5. Furthermore, few results have been reported about the role of the PI 3-K/Akt or Ras/MAPK pathway on the survival and differentiation of BDNF-dependent neurons. In the present report we tried to elucidate the role of these pathways in neuritogenesis and cell survival of BDNF-dependent SH-SY5Y cells. We have observed that BDNF is able to activate both pathways (PI 3-K/Akt and Ras/MAPK) in SH-SY5Y cells that have been preexposed to RA for 5 days. Moreover, we report that PI 3-K/Akt is involved in BDNF-mediated cell survival, whereas ERK/MAPK is involved in BDNF-induced neuritogenesis.

MATERIALS AND METHODS

Materials

all-trans-RA, l-α-phosphatidylinositol, and l-α-phosphatidylserine were purchased from Sigma (St. Louis, MO, U.S.A.). Human recombinant BDNF, NT-3, and NT-4/5 were from Alomone Laboratories (Jerusalem, Israel). NGF 7S was purified at our laboratory from mouse submaxillary glands as previously described (Mobley et al., 1976). [γ-32P]ATP was from Amersham Pharmacia Biotech (Amersham Ibérica, Madrid, Spain). The MEK inhibitor PD98059 and the PI 3-K inhibitor LY294002 were from Calbiochem-Novabiochem (Läufelfingen, Switzerland). Both drugs were dissolved in dimethyl sulfoxide ; the final concentration of this solvent never exceeded 0.1% (vol/vol).

The 4G10 anti-phosphotyrosine and the 203 anti-pan-Trk antibodies were generous gifts of Dr. D. Martin-Zanca (Salamanca, Spain). Anti-phospho-ERK and anti-phospho-Akt antibodies were from New England Biolabs (Beverly, MA, U.S.A.). Anti-Akt, anti-Trk A, anti-Trk B, and anti-Trk C were from Santa Cruz Biotechnology (Santa Cruz, CA, U.S.A.). Anti-pan-ERK antibody was from Transduction Laboratories (Lexington, KY, U.S.A.). Rabbit anti-mouse IgG was from Sigma, and peroxidase-conjugated secondary antibodies were from Sigma or Amersham Ibérica.

Cell culture

The SH-SY5Y neuroblastoma cell line was from ATCC. Cells were grown in Dulbecco's modified Eagle's medium (DMEM) supplemented with 2mMl-glutamine, penicillin (20 units/ml), and streptomycin (20 mg/ml) (basal DMEM) and 15% (vol/vol) heat-inactivated fetal calf serum (GIBCO, Gaithersburg, MD, U.S.A.). Cells were maintained at 37°C in a saturated humidity atmosphere containing 95% air and 5% CO2. all-trans-RA was added to the medium to a final concentration of 10 μM. The medium was changed every 3 days. For cell survival, neurite outgrowth, and Hoechst staining, cells were plated in 35-mm-diameter (Corning, Corning, NY, U.S.A.) at an initial density of 5 × 104-1 × 105 cells per well.

Survival assays

The number of living cells was established after scraping the cells from the culture plate, staining them with trypan blue (Sigma), and counting them in the hemocytometer (Bürker). Cells were treated for 5 days with RA at 10 μM, washed three times with basal DMEM, and switched to basal DMEM containing 2 nM neurotrophin plus the indicated drugs for different additional intervals. Each experiment was performed in quadruplicate. Before switching to neurotrophin-containing medium, four different wells (each from a different six-well culture plate) were counted, and the resulting value was defined as 100% survival, i.e., the initial number of cells. Results were therefore expressed as a mean ± SEM percentage of this value. Differences were considered to be significant for p < 0.05. The morphological features of the cell death caused by LY249002 were examined by Hoechst 33258 staining. After 48 h in the presence of BDNF alone or BDNF plus LY249002 (1, 5, and 10 μM), cells were fixed with paraformaldehyde for 15 min and then stained with Hoechst 33258 [0.05 μg/ml in phosphate-buffered saline (PBS)] for 30 min. They were rinsed twice with PBS, mounted with Fluoprep (BioMerieux, Marcy l'Etoile, France), and counted using an Olympus fluorescence microscope equipped with UV illumination. Apoptotic cell death was expressed as the mean ± SEM value of apoptotic cells, and differences were considered to be significant when p < 0.05.

Evaluation of neuritogenesis

SH-SY5Y cells were treated for 5 days with 10 μM RA. Then they were washed three times with basal DMEM and switched to basal DMEM containing one of the neurotrophins at a 2 nM concentration and, when required, the indicated drugs. After 24 h, cultures were observed in a phase-contrast microscope (Olympus DXC-107AP) connected through a video camera to a Pentium MMX PC running an adequate image analyzer software (PC-Image ; Foster Findlay Associates Ltd., Newcastle upon Tyne, U.K.). The cell bodies and neurites present in 10 randomly selected fields were counted. The ratio between cell bodies and neurites was calculated yielding the average of neurites per neuron and was expressed as the mean ± SEM value. Differences were considered to be significant when p < 0.05.

Trk immunoprecipitation experiments

At the end of each RA treatment period, cells were washed three times and incubated for an additional 3 h in basal DMEM. Cells were then acutely stimulated with the corresponding neurotrophin (2 nM) for 5 min, rinsed rapidly with ice-cold PBS, and solubilized with immunoprecipitation buffer [20 mM Tris (pH 7.4), 150 mM NaCl, 2 mM EDTA, 1 mM EGTA, 1% Nonidet P-40, 1 mM sodium orthovanadate, 1 mM phenylmethylsulfonyl fluoride, 10 μg/ml aprotinin, 2 mM benzamidine, and 20 μg/ml leupeptin] for 15 min. Cells were then scraped off and orbitally rotated for an additional 15-min period at 4°C. Nuclei and cellular debris were removed by microfuge centrifugation at 10,000 g and 4°C for 15 min. Protein concentration in the resulting supernatant was quantified by a modified Lowry assay as described by the manufacturer (DC protein assay ; Bio-Rad, Hercules, CA, U.S.A.).

Immunoprecipitation assays were performed in nondenaturing conditions. Five hundred micrograms of total protein was incubated with an anti-pan-Trk polyclonal antibody (203) at 4°C either for 1 h or overnight. The immunocomplexes were collected with protein A-Sepharose, washed two times with immunoprecipitation buffer and once with PBS containing 1 mM sodium orthovanadate, and finally boiled for 5 min. Samples were resolved by sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis (PAGE), transferred to polyvinylidene difluoride Immobilon-P transfer membrane filters (Millipore, Bedford, MA, U.S.A.), and probed with anti-phosphotyrosine antibody as described below.

For immunoprecipitates using the anti-Trk A, anti-Trk B, or anti-Trk C antibodies, the procedure was similar to the one described above except for the immunoprecipitation buffer [1% Nonidet P-40, 20 mM Tris (pH 7.4), 10 mM EGTA, 40 mMβ-glycerophosphate, 2.5 mM MgCl2, 2 mM orthovanadate, 1 mM dithiothreitol, 1 mM phenylmethylsulfonyl fluoride, 20 μg/ml aprotinin, and 20 μg/ml leupeptin], the amount of total protein used (~1 mg per condition), and the amount of antibody (8 μg per condition).

Western blot

For MAPK and Akt immunodetection, cells were treated with 10 μM RA for 5 days and then serum-starved for 5 h. When needed, a 30-min preincubation step with PD98059, LY249002, or serum-free medium without drugs was included. Cells were then stimulated for 5 min with the corresponding neurotrophin at 2 nM, rinsed rapidly in ice-cold PBS, and lysed in 2% SDS and 125 mM Tris (pH 6.8) buffer. Lysates were sonicated, and protein was quantified by means of the Bio-Rad DC protein assay. Immunoprecipitates or cell lysates (50 μg of protein per lane) were resolved in SDS-PAGE. The proteins were transferred onto polyvinylidene difluoride membrane filters using a Pharmacia semidry Trans-Blot according to the manufacturer's instructions. Membranes were blocked with Tris-buffered saline with Tween 20 [20 mM Tris-HCl (pH 7.4), 150 mM NaCl, and 0.05% Tween 20] containing 5% nonfat dry milk (5% bovine serum albumin when anti-phosphotyrosine antibody was used) for 1 h at room temperature. Membranes were probed with the different antibodies at the dilutions recommended by the manufacturer for 1 h at room temperature and subsequently incubated with peroxidase-conjugated secondary antibodies. Blots were finally developed with the enhanced chemiluminescence western blotting detection system (Amersham, Little Chalfont, U.K.). Alternatively, the Super-Signal chemiluminescent substrate (Pierce, Rockford, IL, U.S.A.) was used.

When needed, membranes were stripped with 100 mM 2-mercaptoethanol, 2% SDS, and 62.5 mM Tris-HCl (pH 6.8) for 30 min at 70°C. Filters were reprobed using anti-pan-ERK, anti-pan-Akt, or anti-pan-Trk antibodies.

PI 3-K activity assay

Cells were incubated for 5 days in the presence of 10 μM RA, washed, and subsequently incubated with basal DMEM for 5 h. Cells were then stimulated for 1 min with 2 nM BDNF, rinsed rapidly in ice-cold PBS, and solubilized in 1% Nonidet P-40 buffer [20 mM Tris (pH 7.4), 150 mM NaCl, 5 mM EDTA, 1% Nonidet P-40, 1 mM sodium orthovanadate, 1 mM phenylmethylsulfonyl fluoride, 10 μg/ml aprotinin, 2 mM benzamidine, and 20 μg/ml leupeptin] for 15 min. Cells were then scraped off from the dishes, orbitally rotated for 15 min, and centrifuged at 10,000 g for an additional 15 min. Cells were then scraped off from the dishes, orbitally rotated for 15 min, and centrifuged at 10,000 g for an additional 15 min to remove cellular debris. Protein in the supernatant was quantified, and 500 μg of protein was immunoprecipitated overnight at 4°C with anti-phosphotyrosine antibody (4G10). Immunocomplexes were collected with protein A-Sepharose preconjugated with an anti-mouse IgG (Sigma) and sequentially washed with lysis buffer, LiCl buffer [100 mM Tris (pH 7.5), 0.5 M LiCl, 1 mM EDTA, and 1 mM sodium orthovanadate], and TNE buffer [25 mM Tris (pH 7.5), 100 mM NaCl, and 1 mM EDTA]. Immunocomplexes were incubated with a mixture of L-α-phosphatidylinositol and L-α-phosphatidylserine (final concentration, 0.5 mg/ml each) and 10 μCi of [γ-32P]ATP. LY249002 or TNE buffer alone was added at the indicated concentrations directly to the reaction mixture. Incubation was allowed to proceed for 20 min at room temperature. Phosphorylated lipids were then extracted and resolved by TLC using n-propanol/water/acetic acid (66:33:2, by volume) as a solvent. Radioactive spots were detected by autoradiography by exposing the TLC plate to Fuji Medical x-ray film (Fuji Photo Film Co. Ltd., Tokyo, Japan) overnight at -70°C.

RT-PCR

A semiquantitative RT-PCR assay was used to analyze the expression pattern of growth-associated protein-43 (GAP-43). One microgram of total RNA Chomczynski and Sacchi, 1987), was treated with 2 U of RNase-free DNase I (Pharmacia) and reverse-transcribed using 1 nmol of random hexamers (Boehringer Mannheim) and 200 U of Moloney murine leukemia virus reverse transcriptase (Promega) for 1 h at 37°C. Ten nanograms of cDNA was used to perform a multiplex PCR amplification, with each of the GAP-43 set of primers at 400 nM and each of the housekeeping L27 ribosomal proteins at 40 nM as an internal control. Samples were subjected to 32 cycles of 94°C for 20 s, 55°C for 20 s, and 72°C for 45 s on a Perkin Elmer thermal cycler, with hot start at 94°C. Products were analyzed on 2% ethidium bromidestained gels. Care was taken to arrest the amplification to the linear phase. To achieve this, the amount of product was plotted against number of cycles and amount of starting sample. Primer sequences were as follows : GAP-43 forward (GAP-43-F), AGGCCGCAACCAAAATTCAGG ; GAP-43 reverse (GAP-43-R), TCCGTTGGAGGCTGGGCTGTT ; L27 forward (L27F), AGCTGTCATCGTGAAGAACAT ; L27 reverse (L27R), CTTGGCGATCTTCTTCTTGCC.

RESULTS

RA induces the appearance of functional Trk B and Trk C but not Trk A in SH-SY5Y cells

As previously reported (Pahlman et al., 1984), we observed that SH-SY5Y cells reduced their growth rate and differentiated toward a neuronal phenotype when exposed to 10 μM RA (data not shown). Kaplan et al. (1993) reported that RA induces Trk B expression on SH-SY5Y cells, making them responsive to BDNF. Based on this information we decided to study the appearance of functionally active Trk receptors on the cell surface during RA treatment. We first incubated the cells for different intervals in the presence of 10 μM RA, and then we acutely stimulated them with NGF, BDNF, NT-3, or NT-4/5. PC12 cells stimulated with NGF were included as a positive control. Cells were lysed, and the extracts were immunoprecipitated with an anti-pan-Trk antiserum (G203). Immunoprecipitates were subsequently subjected to western blot using an anti-phosphotyrosine-specific antibody (4G10). In RA-untreated cells, NGF-mediated Trk autophosphorylation was barely detectable. After 1 day of RA treatment, a slight increase of Trk A phosphorylation was observed, which remained nearly constant up to day 7 (Fig. 1A, left panel). In contrast, naive cells did not show significant Trk phosphorylation when treated with BDNF. However, the induction of Trk phosphorylation by BDNF greatly increased on RA treatment, being evident after 3 days of treatment, reaching a peak after 5 days, and remaining constant up to day 7 (Fig. 1A, left panel). The kinetics and intensity of NT-3-induced Trk activation were very similar to those observed for BDNF (Fig. 1A, left panel). Reprobing those filters with a pan-Trk antibody (203) showed that the increase in the phosphorylation signal correlated with an increase of the total amount of Trk. In addition, bands with reduced mobility appeared during the RA treatment, possibly due to progressive glycosylation of the protein (Fig. 1B, left panel). Of note is that the apparent molecular weight of the Trk receptor from PC12 cells was slightly higher than the one observed for human Trks. This phenomenon has been previously described and is due to interspecific differences in glycosylation (Kaplan et al., 1991 ; Nakagawara et al., 1994).

Figure 1a,letpanel.

: RA induces the appearance of functional Trk B and Trk C but not Trk A receptors. Cells were cultured in the presence of 10 μM RA for the indicated times and then stimulated (5 min, 2 nM) with NGF (top), BDNF (middle), or NT-3 (bottom). Trk receptors were immunoprecipitated (IP) with an anti-pan-Trk antiserum, and tyrosine phosphorylation was analyzed by western blotting (WB). V, cells treated for 7 days with vehicle, 0.2% dimethyl sulfoxide. A, right panel : Dose-response curve of neurotrophin-induced Trk phosphorylation. Cells were incubated for 5 days with 10 μM RA and then stimulated with the indicated concentrations of each neurotrophin for 5 min. Trk receptors were immunoprecipitated with an anti-pan-Trk antiserum, and tyrosine phosphorylation was analyzed by western blotting. PC12 cells stimulated with 2 nM NGF were used as a positive control. B : Filters corresponding to the NT-3 condition in A were stripped and reprobed with the anti-pan-Trk antiserum as described in Materials and Methods to assess the total quantity of Trk. Note that in the left panel there is an increase in the quantity of Trk over time of RA treatment.

FIG. 1. A, left panel

Another important aspect was to elucidate whether NT-3 was acting through its cognate receptor Trk C or through Trk B, because this neurotrophin can bind Trk B with low affinity in a neuronal context (Ip et al., 1993). For this purpose, we tested the minimal concentration of NT-3 required to induce Trk autophosphorylation. Concentrations of 0.2 nM NT-3 were enough to stimulate Trk phosphorylation, thus reflecting a highly specific interaction between NT-3 and the Trk receptor (Fig. 1A, right panel). This threshold concentration was similar to the one observed for NGF, BDNF (Fig. 1A, right panel), and NT-4/5 (data not shown). Moreover, immunoprecipitates using either anti-Trk B- or anti-Trk C-specific antibodies revealed that NT-3 induced autophosphorylation of Trk C but not of Trk B (Fig. 2). Taken together, these data strongly suggest that RA is promoting the appearance of functional Trk B and Trk C receptors.

Figure 2.

Neurotrophin-induced Trk phosphorylation is mediated by specific Trk receptors. Cells were treated with 10 μM RA for 5 days and then were stimulated with the indicated neurotrophins (5 min, 2 nM). Trk receptors were immunoprecipitated (IP) with specific antibodies against Trk A (top), Trk B (middle), or Trk C (bottom), and tyrosine phosphorylation was analyzed by western blot (WB). Note that NGF-induced Trk A phosphorylation is not detectable, probably owing to a reduced immunoprecipitation efficiency of this antibody with respect to the 203 antiserum. NS, nonstimulated cells.

FIG. 2.

BDNF, NT-4/5, and NT-3 but not NGF support differentiation and survival of RA-treated SH-SY5Y cells

To test whether these Trk receptors were able to mediate any biological effect, we cultured SH-SY5Y cells for 5 days in the presence of 10 μM RA, and then we switched them to serum-free medium supplemented with each of the neurotrophins at 2 nM. After an additional 48 h in culture, we evaluated cell survival by means of the trypan blue staining. We defined 100% survival as the amount of living cells present at the time of switching from RA to the neurotrophin, that is, after 5 days in the presence of RA (referred to as initial cells). We observed a potent cell survival effect when either BDNF or NT-4/5 was present in the medium. NT-3 also supported cell survival but to a significantly lesser extent, whereas NGF had no significant effect (Fig. 3A). These results were consistent with the expression of Trk receptors after RA treatment reported above (Fig. 1).

Figure 3.

Effects of neurotrophins on RA-pretreated SH-SY5Y cells. A : Cells were treated for 5 days with 10 μM RA and then cultured in serum-free medium containing no additives (NA) or the indicated neurotrophin (2 nM). After an additional period of 48 h, cell survival was assessed by trypan blue staining. Data are mean ± SEM values. B : Cells were treated in a similar way as in A, and after 24 h in the presence of the corresponding neurotrophin, neurite outgrowth was scored as described in Materials and Methods. *p < 0.05 in A and B indicates significant differences between the indicated treatments and the control condition (NA) by the unpaired, two-tailed Student's t test. C : Representative fields of each condition established in B were photographed under a phase-contrast microscope.

FIG. 3.

An additional effect of BDNF and NT-4/5 was an enhancement of neuritogenesis. After 24 h in the presence of the neurotrophin, RA-pretreated cells acquired rounded, phase-bright bodies and displayed long neurites. Cells were scattered over the culture plate, and their neurites tended to connect to each other, forming a neuritic network on the surface of the culture plate (Fig. 3B and C). NT-3 induced a modest, although significant, degree of differentiation. However, the percentage of cells exhibiting neuritic processes was lower than that observed with BDNF or NT-4/5 (Fig. 3B and C). Finally, NGF or cultures without neurotrophin appeared to undergo little if any neuritic outgrowth (Fig. 3B and C).

BDNF, NT-3, and NT-4/5 but not NGF activate the MAPK and PI 3-K/Akt pathways

To elucidate which intracellular pathways could be involved in the biological effects of BDNF, NT-3, and NT-4/5, we assessed the degree of activation of the Ras/MAPK and PI 3-K/Akt pathways after neurotrophin stimulation. These pathways are activated on neurotrophin activation of Trk receptors and have been shown to be relevant for neuronal survival and differentiation (Kaplan and Miller, 1997). SH-SY5Y cells treated for 5 days with RA were acutely stimulated (5 min) with 2 nM NGF, BDNF, NT-3, or NT-4/5. The phosphorylation of ERK1 and 2 was assessed by means of western blot using an anti-phospho-ERK-specific antibody because a good correlation between the activity of this enzyme and its state of tryosine phosphorylation has been reported (Egea et al., 1998, 1999). BDNF, NT-3, and NT-4/5 promoted tryosine phosphorylation of ERK 1 and 2, whereas NGF did not (Fig. 4). Reprobing of the membrane with an anti-pan-ERK antibody showed that protein loading between the different lanes was similar. In our system, this antibody failed to recognize ERK1, but the total amount of ERK2 was similar for all the gel lanes (Fig. 4).

Figure 4.

Western blot of relevant phosphoproteins activated after neurotrophin stimulation. Cells were cultured for 5 days with 10 μM RA and then exposed for 5 min to the indicated neurotrophin (2 nM). Trk receptors were immunoprecipitated and probed with an anti-phosphotyrosine antibody as described in Materials and Methods. The phosphorylated forms of Akt (P-Akt) and ERKs 1 (P-ERK1) and 2 (P-ERK2) were detected were detected with specific antibodies. Reprobing with an anti-pan-ERK antibody (ERK2), which fails to recognize ERK1 in our system, and anti-pan-Akt (Akt) was used as controls of protein loading. NS, nonstimulated cells. A lane containing lysates from PC12 cells stimulated for 5 min with 2 nM NGF was included as a positive control.

FIG. 4.

Akt phosphorylation was assessed in the same cellular extracts using a specific anti-phospho-Akt-specific antibody. The results were similar to the ones obtained for ERKs. That is, BDNF, NT-3, or NT-4/5, but not NGF, induced a strong phosphorylation of Akt (Fig. 4). Reprobing of the membrane with an anti-pan-ERK antibody showed that protein loading between the different lanes was similar (Fig. 4). Therefore, the activation of both ERK 1 and 2 and Akt in response to neurotrophins showed a good correlation with Trk autophosphorylation.

The MEK inhibitor PD98059 blocks BDNF-mediated neuritogenesis

As has been described in other systems, we have observed that BDNF activates the MAPK pathway. This pathway has been shown to be involved in NGF-induced neuritogenesis in PC12 pheochromocytoma cells (Cowley et al., 1994) and also in neurite outgrowth induced by insulin-like growth factor-I on SH-SY5Y cells (Kim et al., 1997). Based on these previous results, we studied the neuritogenic effect of BDNF in correlation with ERK activation in our system by using the MEK-specific inhibitor PD98059. MEK is a dual-specificity protein kinase that can activate ERKs by phosphorylating them on both threonine and tyrosine residues. PD98059 blocks the activation of MEK without affecting other known serine/threonine kinases or tyrosine kinases (Dudley et al., 1995 ; Pang et al., 1995). RA-predifferentiated SH-SY5Y cells were exposed to increasing concentrations (2, 20, and 50 μM) of PD98059 in the presence of BDNF. After 24 h of treatment, neurite outgrowth was scored. Exposure to PD98059 caused cells to become flattened, exhibit short processes, and aggregate (Fig. 5B), whereas in cultures without PD98059 cells appeared to extend long neurites and scatter over the culture plate surface (Fig. 5A). At the concentrations assayed, PD98059 caused a significant dose-dependent reduction of the average number of neurites per cell (Fig. 5C). This reduction correlated with a decreased tyrosine phosphorylation of the ERKs and MAPK after exposure to PD98059, as revealed by western blotting (Fig. 5D). Stripping and reprobing with an anti-pan-ERK antibody showed no differences in the total amount of ERK 2, indicating that such a decrease was not due to gel loading differences.

Figure 5.

Effects of PD98059 (PD) on BDNF-mediated differentiation of RA-pretreated SH-SY5Y cells. Cells were exposed for 5 days to 10 μM RA and then switched to serum-free medium containing 2 nM BDNF plus different concentrations of PD for 24 h. A and B : Phase-contrast micrographs of cultures exposed to BDNF alone of BDNF plus 20 μM PD, respectively. C : Neurite outgrowth was scored by the ratio of the number of neurites : number of cells in serum-free medium containing no additives (NA) or 2 nM BDNF plus different concentrations of PD. *p < 0.05 indicates significant differences between the asterisk-labeled condition and BDNF without PD. Data are mean ± SEM (bars) values. D : Effect of PD on the activation of ERK1 and 2 MAPKs measured as the degree of tyrosine kinase phosphorylation. Cells were maintained in 10 μM RA for 5 days, preincubated for 30 min with the indicated doses of PD, and then stimulated with 2 nM BDNF for 5 min. Tyrosine phosphorylation of ERKs was assessed by western blotting with specific anti-phospho-ERK antibody (top). Reprobing the filter with anti-pan-ERK was used as a control of gel loading (bottom). NS, nonstimulated control cells.

FIG. 5.

The effects of PD98059 on neuronal survival were evaluated by culturing RA-predifferentiated SH-SY5Y cells with BDNF plus PD98059 in serum-free medium for 48 h. No significant differences between control and PD98059-treated cells were found (data not shown). Accordingly, PD98059 did not show any significant effect on Akt phosphorylation (data not shown).

BDNF induces GAP-43 expression through a MEK-dependent mechanism

GAP-43 is the most abundant neuron-specific protein in the growth cones, and its expression is regulated during neuronal differentiation (Lavenius et al., 1994 ; Kim et al., 1997). Because BDNF showed neurite-promoting effects in RA-treated SH-SY5Y cells, we examined the expression of GAP-43 by semiquantitative RTPCR. Pretreatment with 10 μM RA had no effect on GAP-43 expression. However, after 6 h in the presence of BDNF, GAP-43 expression was dramatically increased. This increase was completely inhibited by PD98059, suggesting that the Ras/MAPK pathway is necessary for the expression of this neuronal marker (Fig. 6). The expression was attenuated after 12 h, but the blocking effect of PD98059 was persistent. Finally, parallel cultures maintained with RA for the total length of the experiment (5.5 days) did not express detectable levels of GAP-43, indicating that the expression of this gene is due to addition of BDNF.

Figure 6.

Agarose gel shows the RT-PCR product for GAP-43 (upper) coamplified with the control protein L27 (lower). Cells were treated for 5 days with 10 μM RA and then were cultured in serum-free medium containing 2 nM BDNF alone (lane 3, 6 h of incubation ; lane 5, 12 h of incubation) or BDNF plus 20 μM PD98059 (lane 4, 6 h of incubation, lane 6, 12 h of incubation). Lanes 2 and 7 correspond to cells treated for 5 and 5.5 days with RA, respectively, whereas lane 1 corresponds to naive cells, i.e., cells not pretreated with RA. The same results were obtained without L27 amplification. MW, 50-bp Molecular Size Marker ladder (Pharmacia).

FIG. 6.

The PI 3-K inhibitor LY294002 blocks BDNF-mediated survival

PI 3-K is a heterodimer composed of an 85-kDa regulatory subunit and a 110-kDa catalytic subunit that phosphorylates phosphatidylinositol, phosphatidylinositol 4-phosphate, and phosphatidylinositol 4,5-bisphosphate on the D3 position of the inositol ring, leading to the formation of phosphatidylinositol 3-phosphate, phosphatidylinositol 3,4-bisphosphate, and phosphatidylinositol 3,4,5-trisphosphate, respectively (Kapeller and Cantley, 1994). In PC12 cells these lipids have been shown to activate the Akt/PKB pathway after NGF stimulation (reviewed by Marte and Downward, 1997). PI 3-K Akt have been involved in the survival-promoting effect of NGF (Yao and Cooper, 1995) and other growth factors (Yao and Cooper, 1996 ; D'Mello et al., 1997 ; Dudek et al., 1997 ; Miller et al., 1997). Cells pretreated for 5 days with 10 μM RA were switched to serum-free medium containing BDNF (2 nM) plus increasing concentrations (1, 5, and 10 μM) of LY294002, a specific inhibitor of PI 3-K (Vlahos et al., 1994). After 48 h in culture, cell survival was evaluated. LY294002 reduced the number of surviving cells in a dose-dependent manner when compared with cultures treated with BDNF alone (Fig. 7A).

Figure 7.

A : Effects of LY294002 (LY) on BDNF-mediated survival of RA-pretreated SH-SY5Y cells. Cells were exposed for 5 days to 10 μM RA and then switched to serum-free medium containing 2 nM BDNF plus different doses of LY for an additional period of 48 h. *p < 0.05 indicates significant differences between the asterisk-labeled condition and BDNF without PD98059. Data are mean ± SEM (bars) values. B : Effects of LY on Akt phosphorylation. Cells were exposed to 10 μM RA for 5 days and preincubated with the indicated doses of the drug for 30 min. Stimulation with 2 nM BDNF was performed, and the state of Akt phosphorylation was assessed by western blot using a specific anti-phospho-Akt antibody (top). The filter was reprobed with an anti-pan-Akt antibody to control the protein content per lane (bottom). NS, nonstimulated cells. C : Effects of LY on PI 3-K activity. Cells treated and stimulated as in A were lysed, and anti-phosphotyrosine immunoprecipitates were obtained. The PI 3-K activity was measured as described in Materials and Methods, including the indicated doses of LY in the reaction mixture. The arrowheads indicate the point of application of the samples (ORI) and the position of the phosphatidylinositol 3-phosphate (PIP3) standard.

FIG. 7.

When the state of phosphorylation of Akt was monitored in cultures treated with BDNF or BDNF plus different concentrations of LY294002, a clear dose-dependent decrease in Akt phosphorylation was observed for increasing concentrations (1, 5, and 10 μM) of the drug. At 10 μM, the Akt phosphorylation was inhibited to values similar to the ones observed for nonstimulated controls (Fig. 7B). Reprobing of the membrane with an anti-pan-Akt antibody showed that protein loading between the different lanes was similar (Fig. 7B). To elucidate whether these changes in Akt phosphorylation correlated with a decrease in PI 3-K activity, we measured the generation of phosphatidylinositol 3-phosphate from L-α-phosphatidylinositol and L-α-phosphatidylserine precursors on anti-phosphotyrosine immunoprecipitates. Increasing concentrations of LY294002 caused a gradual decrease in the amount of phosphatidylinositol 3-phosphate generated (Fig. 7B), thus revealing a strong correlation between PI 3-K activity and phosphorylation of Akt.

LY294002 causes cell death with morphological features of apoptosis

To analyze the morphological features of the cell death induced by LY294002, cells were stained with the DNA dye Hoechst 33258. LY294002 caused cells to exhibit condensed and fragmented chromatin characteristic of apoptosis. These morphological features were also present in cells cultured in a medium without additives (Fig. 8).

Figure 8.

LY294002 (LY) prevents the anti-apoptotic effect of BDNF. Top : Cells were exposed to 10 μM RA for 5 days and then switched to a serum-free medium containing no additives (NA), BDNF (2 nM), or BDNF plus the indicated doses of LY for an additional 48 h. Nuclei were stained with Hoechst 33258, and apoptotic cells were counted (top). *p < 0.05 indicates significant differences between the asterisk-labeled condition and BDNF without LY by unpaired, two-tailed Student's t test. Data are mean ± SEM (bars) values. Bottom : Representative fields were photographed under UV illumination with a fluorescence microscope. A : No additives. B : BNDF. C : BDNF plus 1 μM LY. D : BDNF plus 10 μM LY. Arrowheads indicate apoptotic nuclei.

FIG. 8.

When the number of apoptotic nuclei was quantified, no significant effects of LY294002 were found at 1 μM compared with BDNF alone. However, the number of apoptotic nuclei progressively increased with 5 and 10 μM LY294002. At 10 μM, the amount of apoptotic, nuclei was similar to that obtained for cells cultured in basal medium, i.e., without either BDNF or LY294002 (Fig. 8).

DISCUSSION

In this study we have examined the biological effects of neurotrophins in SH-SY5Y cells induced to present high levels of functional Trk B, Trk C, and, to a much lesser extent, Trk A receptors on their surface. Previous studies have demonstrated that SH-SY5Y cells express high levels of Trk B after exposure to RA. These receptors undergo autophosphorylation when stimulated with BDNF, NT-3, or NT-4/5 (Kaplan et al., 1993). In agreement with these data, we have detected the appearance of functional Trk receptors in these cells over a period of 7 days of RA treatment. NGF-induced Trk phosphorylation was very weak when compared with BDNF, NT-3, and NT-4/5, which strongly stimulated Trk autophosphorylation. NT-3 was able to induce Trk autophosphorylation at doses as low as 200 pM, suggesting that Trk C is present on the surface of these cells. NT-3 has been reported to stimulate with similar affinity Trk B and Trk C in nonneuronal systems such as fibroblasts. In contrast, in a neuronal context, the affinity of NT-3 for Trk B decreases >100-fold (Ip et al., 1993). However, recent data indicate that NT-3 is able to mediate neuronal survival responses in vivo through a direct interaction with Trk B (Fariñas et al., 1998). In our system, NT-3 seems to be acting through Trk C rather than through Trk B or Trk A, because only the Trk C-specific antibody is able to immunoprecipitate the Trk phosphorylated by NT-3.

Our data show that neurotrophins support cell survival under serum-free conditions to very different extents. BDNF and NT-4/5 exerted the most striking effects on cell survival. The differences in the number of viable cells between cultures containing BDNF compared with those lacking trophic support are not due to a proliferative effect of this neurotrophin, because the values for survival are similar (~90%) to the number of initial cells, i.e., 5 days of RA treatment. Moreover, it has been reported that BDNF does not alter [3H]thymidine uptake in RA-pretreated SH-SY5Y cells (Matsumoto et al., 1995). On the other hand, NT-3 showed a moderate effect on cell survival, with this value being significantly lower than that observed with BDNF or NT-4/5. Several authors have found that BDNF or NT-4/5 but not NGF or NT-3 could promote neuronal survival in primary cultures of rat cerebellar granule cells, although they express both Trk B and Trk C (Segal and Greenberg, 1992 ; Lindholm et al., 1993 ; Gao et al., 1995 ; Kubo et al., 1995 ; Zirrgiebel et al., 1995 ; Nonomura et al., 1996 ; Zirrgiebel and Lindholm, 1996). However, in these cells differences in the phosphorylation of PLCγ have been reported. PLCγ is phosphorylated by BDNF or NT-4/5 but not by NT-3 (Nonomura et al., 1996 ; Zirrgiebel and Lindholm, 1996). When other intracellular signaling proteins were analyzed, including the receptor autophosphorylation, PI 3-K, ERKs, or c-fos, no clear differences could be found between NT-3 and BDNF or NT-4/5 (Lindholm et al., 1993 ; Zirrgiebel and Lindholm, 1995 ; Nonomura et al., 1996). In our system, the level of Trk C autophosphorylation induced by NT-3 was comparable to the Trk B phosphorylation induced by either BDNF or NT-4/5. Moreover, NT-3 induced ERKs and Akt phosphorylation to the same extent as BDNF or NT-4/5. Therefore, the limited ability of NT-3 to support neuronal survival did not correlate with the level of activation of the signaling pathways triggered by Trk C that are probably involved in cell survival (see below). A possible explanation for this phenomenon could be a differential element in the transduction pathways initiated by BDNF and NT-3 such as PLCγ (Nonomura et al., 1996 ; Zirrgiebel and Lindholm, 1996). Another possibility could be differences in the transient or sustained activation of the intracellular pathways elicited by each neurotrophin. In any case, further studies are required to elucidate which is the molecular basis of this differential behavior.

Neuritic outgrowth was also affected in different ways by neurotrophins. We have found that BDNF and NT-4/5 can induce a profuse neuritogenic response on RA-treated SH-SY5Y cells. Moreover. GAP-43, a neuronal marker that has been widely used as an indicator of cell differentiation, is rapidly expressed after addition of BDNF (6 h). In agreement with these results it has been demonstrated that PC12 cells stably transfected with Trk B can differentiate after addition of BDNF (Iwasaki et al., 1997). On the other hand, NT-3-treated cells showed an intermediate phenotype, and NGF-treated cells display little if any change in neuritic outgrowth. Matsumoto et al. (1995) reported a similar behavior of these cells when exposed simultaneously to RA and each of these neurotrophins.

To date, little is known about the signaling events that are initiated by Trk B and Trk C, when compared with the more abundant information available for Trk A. NT-3 has been shown to induce phosphorylation of MAPK in oligodendrocytes (Cohen et al., 1996). In cultures of cerebellar granule cells, BDNF, NT-3, and NT-4/5 triggered the phosphorylation of Shc, PI 3-K, and ERK/MAPKs, and the expression of c-fos, whereas only BDNF and NT-4/5 seemed to activate PLCγ (Lindholm et al., 1993 ; Zirrgiebel et al., 1995 ; Nonomura et al., 1996 ; Zirrgiebel and Lindholm, 1996). In hippocampal pyramidal neurons, BDNF and NT-3 induce various signal transduction events, such as activation of p21ras, MAPK, or PLCγ. However, none of these neurotrophins is able to support the survival of these neurons (Marsh and Palfrey, 1996). We show here that BDNF, NT-3, or NT-4/5 induces the phosphorylation of both ERKs and Akt. Moreover, we also show that at least BDNF is able to increase the PI 3-K activity in RA-treated cultures.

The main goal of this work was to elucidate the relative significance of the Ras/MAPK and PI 3-K/Akt pathways in neuritogenesis and survival. The role of the Ras/MAPK pathway in differentiation and survival is controversial (reviewed by Kaplan and Miller, 1997). Various reports, based in the PC12 cell line, which spontaneously expresses high levels of Trk A, have shown that a persistent activation of Ras/MAPK pathway is necessary for differentiation responses in this system. Transfection of oncogenic ras in PC12 cells leads to sustained ERK activation and neuronal differentiation (Qiu and Green, 1992), whereas the expression of dominant-negative MEK mutants blocks the growth factor-mediated differentiation of PC12 cells (Cowley et al., 1994). Moreover, the selective MEK inhibitor PD98059 blocks the differentiation of PC12 cells induced by NGF (Pang, et al., 1995). However, Borasio et al. (1993) have demonstrated that the activity of Ras is neither necessary nor sufficient for NGF-mediated neuritogenesis of chick sympathetic neurons. In addition, PD98059 failed to block NGF-induced neurite outgrowth in outgrowth in chick sensory and sympathetic neurons (Klinz et al., 1996). Moreover, very little information exists regarding the intracellular pathways involved in neuritogenesis induced by BDNF through Trk B receptors. Our results suggest that the Ras/MAPK pathway is necessary for BDNF-mediated neuritogenesis in RA-pretreated SH-SY5Y cells. PD98059 blocked neuritic outgrowth in a dose-dependent manner, at a range of concentrations that effectively prevented the activation of ERK1 and ERK2 by BDNF. Moreover, the expression of GAP-43 was affected in the same way by this inhibitor. These findings are in agreement with those reported by Kim et al. (1997), who described the requirement of MAPK activation for neuritogenesis in SH-SY5Y cells using a related growth factor, insulin-like growth factor-I.

On the other hand, PD98059 failed to block the survival-promoting effect of BDNF, suggesting that MAPK activity is not needed for this effect. In agreement with this, MAPK activation is not necessary for survival of sympathetic neurons (Creedon et al., 1996 ; Virdee and Tolkovsky, 1996), hippocampal pyramidal neurons (Marsh and Palfrey, 1996), and chicken spinal motor neurons (Soler et al., 1998 ; Dolcet et al., 1999). Neutralizing Ras antibodies, however, block neuronal survival (Borasio et al., 1993 ; Nobes and Tolkovsky, 1995), suggesting that a neuronal survival pathway branches from the MAPK pathway at the level of Ras.

Increasing numbers of reports show the connection between neuronal survival and the activation of PI 3-K and Akt (Yao and Cooper, 1995 ; D'Mello et al., 1997 ; Dudek et al., 1997). We present evidence for an antiapoptotic function of the PI 3-K/Akt pathway. Inhibition of PI 3-K by LY294002 in the presence of BDNF resulted in the reversal of the survival effect of this neurotrophin, at concentrations that reduced BDNF-induced PI 3-K activity and Akt phosphorylation to levels comparable to the one obtained in nonstimulated cells. In the absence of BDNF or when treated with BDNF plus LY294002, cells underwent an apoptotic cell death that was morphologically indistinguishable between both conditions.

Acknowledgements

We thank our colleagues from the Molecular Neurobiology Group of Lleida and Dr. Fletcher White and Dr. Marga Behrens (Washington University, St. Louis, MO, U.S.A.) for many discussions and critical reading of the manuscript. Dr. Dionisio Martin-Zanca is acknowledged for his many comments and the gift of antibodies. We thank Isu Sanchez for her technical support, Dr. Almudena Porras for helping with the PI 3-K activity assays, and Dr. José R. Bayascas for technical support with the RT-PCR. We also thank Dr. J. Fibla for the purification of NGF. We especially want to thank J. Egea, V. J. Yuste, M. Guerrero, and X. Dolcet for their many suggestions and technical support. This work was funded by Spanish Govern CICYT PN-SAF (grant 97-0094), EU Biotech (contract BIO4-CT96-0433), Telemarató de TV3, and Ajuntament de Lleida. M.E. is a predoctoral fellow of Generalitat de Catalunya.

Ancillary