SEARCH

SEARCH BY CITATION

Keywords:

  • Lithium;
  • Valproate;
  • Bcl-2;
  • Manic-depressive illness;
  • Transcription factors;
  • Polyomavirus enhancer;
  • binding protein 2;
  • Differential display

Abstract

  1. Top of page
  2. Abstract
  3. MATERIALS AND METHODS
  4. PEBP2 DNA-binding activity
  5. RESULTS AND DISCUSSION
  6. Acknowledgements
  7. REFERENCES

Abstract : Differential display of mRNA was used to identify concordant changes in gene expression induced by two mood-stabilizing agents, lithium and valproate (VPA). Both treatments, on chronic administration, increased mRNA levels of the transcription factor polyomavirus enhancer-binding protein (PEBP) 2β in frontal cortex (FCx). Both treatments also increased the DNA binding activity of PEBP2αβ and robustly increased the levels of bcl-2 (known to be transcriptionally regulated by PEBP2) in FCx. Immunohistochemical studies revealed a marked increase in the number of bcl-2-immunoreactive cells in layers 2 and 3 of FCx. These novel findings represent the first report of medication-induced increases in CNS bcl-2 levels and may have implications not only for mood disorders, but also for long-term treatment of various neurodegenerative disorders.

Bipolar affective disorder (BD ; manic-depressive illness) is a common, severe, chronic, life-threatening illness (Goodwin and Jamison, 1990). Despite much research, however, there is a dearthof knowledge concerning the etiology of this disorder. The discovery of the efficacy of lithium (Li) as a mood-stabilizing agent revolutionized the treatment of patients with BD, but despite the role of Li as one of psychiatry's most important treatments, the molecular basis for its mood-stabilizing actions remains to be fully elucidated (Jope and Williams, 1994 ; Manji et al., 1995).In recent years, it has become increasingly appreciated that anyrelevant biochemical model proposed for the effects of mood stabilizers must attempt toaccount for their special temporal clinicalprofile—in particular, that the therapeutic effects require a lag period for onset of action and are generally not immediately reversed on discontinuation. Patterns of effects requiring such prolonged administration of the drug suggest alterations at the genomic level (Manji et al., 1995 ; Hyman and Nestler, 1996).

To identify changes in gene expression that may be associated with the therapeutic efficacy of mood stabilizers, we have concurrently investigated the effects of Li and valproate (VPA), the only two medications approved by the Food and Drug Administration for treatment of BD. These are two structurallyhighly dissimilar agents ; although they likely do not exert their therapeutic effects y Precisely the same mechanisms, identifying the genes that are regulated in concrt bythese two agents, when administered ina therapeutically relevant paradigm, may provide important clues about the molecular mechanisms underlyingmood stabilization. We report here the novel findings that both treatments robustly increase the levels of theneuroprotecive protein B cell lymphoma protein-2 (bcl-2) in frontal cortex (FCx), findings that may have implications for various neurodegenerative disorders.

MATERIALS AND METHODS

  1. Top of page
  2. Abstract
  3. MATERIALS AND METHODS
  4. PEBP2 DNA-binding activity
  5. RESULTS AND DISCUSSION
  6. Acknowledgements
  7. REFERENCES

Differential display

Inbred make Wistar Kyoto ratts (selected to reduce potential false-positives due to individual differences), at a starting weight of 150-200 g, were treated with Li2CO3 (4 Eq/kg/day), sodium VPA (400 mg/dg/day), or saline by twice daily intraperitoneal injections for 9 days or 4 weeks. Rat brains were dissected on ice, and FCxs [an area of the brain implicated in the pathophysiology of BD (Drevets et al., 1997 ; Ketter et al., 1997)] were directly frozen on dry ice and stored at -80°C. Trunk blood was collected for determination of Li (0.7 ± 0.3 mM) and VPA (39 ± 3 μg/ml) levels, both of which approximated the plasma levels attained clinically. Total RNA was isolated from cortex using Trizol reagent (GibcoBRL), and trace DNA was removed. DD was performed using the Gene Hunter kit, with the extension time increased to 50 s. Reactions (150) were performed with the combination of three one baseanchored 3' primers and 50 5' arbitary primers (Liang et al., 1995) ; on average, 270 bands were obtained in each reaction. Two samples from individual rats in each treatment group were assayed side by side for comparison (Fig. 1A). cDNA bands were cut out from the gel, reamplified by PCR using the same primer set, and cloned into a pCR2.1 vecotr. Three clones were sequenced from T7 and MI3 priming sites using an automated sequencer. BLAST searches were conducted for each clone obtained, andthe homology with known sequences in the GenBank database was further evaluated using the BESTFIT program from the Genetic Computer Group's Sequence Analysis Software Package.

image

Figure 1. . Li- and VPA-induced increases in PEBP2 β mRNA levels in FCx. A : Rats were treated chronically with Li, VPA, or saline, and RT-PCR DD was conducted with FCx mRNA using 5'-AAGCTTTTTTTTTTTC-3' as the 3' primer and 5' -AAGCTT-TAGTCCA-3' as the 5' primer. The cDNA obtained from this band (clone 12 ; GenBank accession no. AF087437) shows very high sequence homology to the mouse PEBP2β 3' end (92%) and the human CBFβ 3' end (85%). B and C : Autoradiogram with results of RNase protection assays performed with FCx total RNA. Chronic Li and VPA increased PRBP2β mRNA levels but were without effect on β-actin mRNA levels *p < 0.005 compared with saline-treated animals.

Download figure to PowerPoint

RNase protection assays

Both polyomavirus enhancer-binding protein (PEBP) 2β and β-actin 32P-RNA probes were synthesized using MAXIscript an in vitro transcription kit from Ambion (Austin, TX, U.S.A.), using T7 RNA polymerase. A clone encoding the PEBP2β 3' end obtained from DD was used as the template for PEBP2β probe synthesis ;the β-actin probe was synthesized using pTRI-β-actin (Ambion) as the template. The probes were purified on 6%polyacrylamide 8 M urea gels, and Nase protection assaywas conducted (HybSpeed RPR kit ; Ambion)using stabndard assay protocols,except that the hybridization time was extended to 3 h and T1 RNase was used inthe digestion.

PEBP2 DNA-binding activity

  1. Top of page
  2. Abstract
  3. MATERIALS AND METHODS
  4. PEBP2 DNA-binding activity
  5. RESULTS AND DISCUSSION
  6. Acknowledgements
  7. REFERENCES

FCx samples were homogenized by sonication in a protein extraction buffer containing 20 mM HEPES (pH 7.8), 124 mM NaCl, 5 mM MgCl2, 0.2 mM phenylmethylsulfonylfuoride, 10 μg/ml leupeptin, 10 μg/ml aprotinin, and 5 mM dithiothreitol. The homogenates were centrifugated at 14,000 g for 10 min to remove debris. DNA-bindig assays were conducted with 32P end-labeled double-standed oligonucleotides containing the consensus PEBP2-binding element (agctaactgaccgcagctggccgt) (Kanno et al., 1998). Ten microliters of the binding mixture contained 10 mM HEPES (pH 7.8), 1 mM sperimidine, 3 mM MgCl2, 7% glycerol, 0.015% Nonidet P-40, and 1.5 μg/μl poly(dI : dC). The binding reaction,initiated by addition of 10 μg of extracted proteins, was done at room temperature for 20 min and terminated by addition of 6 × sample loading buffer. The binding mixture was then elecrophoresed on 6% DNA reardation gels (Novex) at 100 V for 1.5 h for 0.5× Tris-borate-EDTA. The gel was vacuum-dried and then exposed to x-rayfilm. The intensity of the bands was measured using an image analysis system with NIH Image 1.55 software.

Immunoblottin of bcl-2

Rats were chronically treated with Li, VPA, or saline,and FCx samples described above were prepared for immunoblotting, conducted using established methods (Chen et al., 1998) with monoclonal antibodies aganst bcl-2 (N-19 ; 1 : 100 dilution ; Santa Cruz Biotechnology, Santa Cruz,CA, U.S.A.) using protein concentrations (20 μg) verified to be in the linear range for the assay. The specificity of the bcl-2 antibody was verified with blocking experiments using saturaing concentrations of a bcl-2 peptide (data not shown). The immunocomplex was detected withan Amersham ECL kit. Immunoblots were quantitated bydensitometric scanning of the film using an Image Analysis system (NIH Image 1.55 software). an aliquot of pooled “standard” rat brain fraction was assayed on one lane of eachgel. Data were normalized against the rat brain standard, to minmize between-blot variability.

Immunoistochemical studies of bcl-2

Immunohistochemical studies were conducted using established methods (Hsu et al., 1981). In brief, rat brains were cut at 30 μm, and serial sections were cut coronally through the anterior portion of the brain, mounted on gelatin-coated glass slides, and stained with thionin. The sections of the second and third sets were incubated free-floating for 3 days at 4°C in 0.1 M phosphate-buffered saline containing a polyclonal antibody against bcl-2 (N-19 ; 1 : 3,000 ; Santa Cruz Biotechnology), 1% normal goat serum, and 0.3% Triton X-100 (Sigma, St. Louis, MO, U.S.A.). Subsequently, the immunoreaction product was visualized according to the avidin-biotin complex method, and the specificity of the antibody used was verified.

RESULTS AND DISCUSSION

  1. Top of page
  2. Abstract
  3. MATERIALS AND METHODS
  4. PEBP2 DNA-binding activity
  5. RESULTS AND DISCUSSION
  6. Acknowledgements
  7. REFERENCES

Figure 1A shows a DD gel demonstrating that levels of a particular mRNA species were markedly increased by both treatments ; the cDNA was cloned from this gel and named clone 12. Clone 12 (GenBank accession no. AF087437) is 355 bp long and contains a poly(A) tail ; a BLAST search revealed that it shows very high sequence homology to the 3′ end of the mouse (92% identical sequences) and human (85%) transcription factor PEBP2β subunit (also known as core-binding factor β and acute myelogenous leukemia 1 β) (Liu et al., 1993 ; Wang et al., 1993 ; Kanno et al., 1998). To verify the DD results, RNase protection assays were conducted with a 32PRNA probe generated using clone 12 as the template. Consistent with the DD results, chronic treatment with both Li and VPA increased the levels of PEBP2β mRNA in FCx (Fig. 1B and C). In the absence of available antibodies to PEBP2β, we next sought to determine if the treatments induced functional changes in PEBP2 transcription factor activity.

image

Figure 2. Effects of psychotropic drugs on PEBP2α and PEBP2αβ DNA-binding activity in FCx. As previously observed (Kanno et al., 1998), the gel shift assay with oligonucleotides containing the consensus PEBP2-binding element revealed two major bands, representing PEBP2α (lower) and PEBP2αβ (upper) DNA binding. PEBP2β does not bind to DNA by itself but forms a PEBP2αβ complex that displays high-affinity DNA binding (upper band). A and C : Autoradiograms of FCx PEBP2-binding assays from rats treated with Li, VPA, chlordiazepoxide (CDZ), amphetamine (AMPH), or saline. B and D : Effects of treatment on PEBP2 DNA-binding activity. Chronic Li and VPA increased PEBP2αβ DNA-binding activity ; increases were also observed at 9 days of treatment with VPA. CDZ and AMPH did not affect PEBP2αβ DNA binding. Data are mean ± SE (bars) values from five to 10 rats. *p < 0.05 compared with saline-treated rats.

Download figure to PowerPoint

Although PEBP2β does not directly bind to DNA, binding of PEBP2β to PEBP2α (the DNA-binding subunit of the PEBP2 transcription factor) forms a high-affinity DNA-binding complex that results in a dramatic increase in transcription (Wang et al., 1993 ; Kagoshima et al., 1996). The PEBPαβ complex is observed as the top band in DNA binding assays, migrating quite distinctly from PEBPα (Ogawa et al., 1993 ; Wang et al., 1996). Chronic treatment of rats with either Li or VPA significantly increased the DNA-binding activity of PEBPαβ in FCx (Fig. 2A and B). These results indicate that the Li- and VPA-induced increases in PEBP2β mRNA levels do have functional consequences. To determine if these effects are specific for mood-stabilizing agents, we investigated the effects of other psychotropic agents. Chronic treatment of rats with either d-amphetamine sulfate (5 mg/kg/day) or chlordiazepoxide (5 mg/kg/day) did not produce any detectable changes in the DNA-binding activity of PEBP2αβ in FCx (Fig. 2C and D).

We next sought to investigate putative targets of the PEBP2 transcription factor that may be of therapeutic relevance in treatment of BD. The promoter of the human bcl-2 gene (both rat and human genes) has a PEBP2-binding site, and this site has been clearly demonstrated to increase the expression of a reporter gene driven by the bcl-2 promoter (Klampfer et al., 1996). A neuroprotective role for bcl-2 is well established, and constitutive expression of high levels of bcl-2 protein enhances the survival of cells when exposed to adverse stimuli (Jacobson and Raff, 1995 ; Merry and Korsmeyer, 1997). Also, the in vivo delivery of a bcl-2 expression vector protects neurons against focal ischemia (Lawrence et al., 1996), and bcl-2 has also been demonstrated to promote neuronal regeneration in the mammalian CNS (Chen et al., 1997). In this context, it is noteworthy that recent studies have shown that mood disorders, including BD, are associated with volumetric changes on magnetic resonance imaging and computed tomography, suggestive of neuronal atrophy or loss (Drevets et al., 1997 ; Ketter et al., 1997). Furthermore, both brain imaging studies and postmortem morphometric three-dimensional cell counting studies have implicated the FCx as one of the sites of neuronal atrophy or loss in BD (Drevets et al., 1997 ; Rajkowska, 1997). We therefore next sought to determine if the treatment-induced increase in PEBP2αβ DNA-binding activity in FCx was accompanied by changes in levels of the neuroprotective protein bcl-2. Immunoblotting studies showed that chronic treatment of rats with both Li and VPA resulted in a doubling of bcl-2 levels in FCx (Fig. 3A and B). To localize further the medication-induced increases in bcl-2 levels, immunohistochemical studies were conducted (Hsu et al., 1981). Both treatments resulted in a marked increase in the number of bcl-2-immunoreactive cells in FCx layers 2 and 3 (Fig. 3C-H). It is noteworthy that neuroprotective effects have recently been reported for both Li and VPA (Bruno et al., 1995 ; Nonaka et al., 1998) ; the robust increases in bcl-2 levels that we have demonstrated may play a major role in mediating these effects.

image

Figure 3. Effects of chronic Li and VPA on bcl-2 immunolabeling in FCx. A and B : Immunoblotting. Chronic Li and VPA treatment resulted in a doubling of bcl-2 levels in FCx. Data are mean ± SE (bars) values from 10 rats. *p < 0.05 compared with the saline group. C-H : Immunohistochemistry of bcl-2 in FCx. Rats were chronically treated with saline (C and D), Li (E and F), or VPA (G and H), and immunohistochemistry of bcl-2 was performed in parallel for each of the groups. Li and VPA markedly increased the number of bcl-2-immunoreactive cells in FCx layers 2 and 3.

Download figure to PowerPoint

In summary, we report here the novel observation that chronic administration of two structurally dissimilar mood-stabilizing agents, Li and VPA, robustly increases bcl-2 levels in FCx. These results suggest that mood-stabilizing agents may bring about some of their long-term beneficial effects via hitherto underappreciated neuroprotective effects (Smith et al., 1995 ; Duman et al., 1997). Also, these novel findings represent the first demonstration of medication-induced increases in the levels of bcl-2 in the CNS and may have implications for the long-term treatment of various neurodegenerative disorders.

Acknowledgements

  1. Top of page
  2. Abstract
  3. MATERIALS AND METHODS
  4. PEBP2 DNA-binding activity
  5. RESULTS AND DISCUSSION
  6. Acknowledgements
  7. REFERENCES

We thank Gregory Moore, Donald Kuhn, and Gregory Kapatos for their thoughtful critique of the manuscript. This work was supported in part by Stanley Foundation and Joseph Young Senior Research Awards.

REFERENCES

  1. Top of page
  2. Abstract
  3. MATERIALS AND METHODS
  4. PEBP2 DNA-binding activity
  5. RESULTS AND DISCUSSION
  6. Acknowledgements
  7. REFERENCES
  • 1
    Bruno V., Sortino M.A., Scapagnini U., Nicoletti F., and Canonico P. (1995) Antidegenerative effects of Mg(2+)-valproate in cultured cerebellar neurons.Funct. Neurol. 10,121130.
  • 2
    Chen D.F., Schneider G.E., Martinou J.C., and Tonegawa S. (1997) Bcl-2 promotes regeneration of severed axons in mammalian CNS.Nature 385,434439.
  • 3
    Chen G., Yuan P.-X., Jiang Y.-M., Huang L.-D., and Manji H.K. (1998) Lithium increases tyrosine hydroxylase levels both in vivo and in vitro.J. Neurochem. 70,17681771.
  • 4
    Drevets W.C., Price J.L., Simpson J.R.Jr., Todd R.D., Reich T., Vannier M., and Raichle M.E. (1997) Subgenual prefrontal cortex abnormalities in mood disorders.Nature 38,824827.
  • 5
    Duman R.S., Heninger G.R., and Nestler E.J. (1997) A molecular and cellular theory of depression.Arch. Gen. Psychiatry 54,597606.
  • 6
    Goodwin F.K. and Jamison K.R. (1990) Manic-Depressive Illness. Oxford University Press, New York.
  • 7
    Hsu S.M., Raine L., and Fanger H. (1981) Use of avidin-biotin-peroxidase complex (ABC) in immunoperoxidase techniques : a comparison between ABC and unlabeled antibody (PAP) procedures.J. Histochem. Cytochem. 29,577580.
  • 8
    Hyman S.E. and Nestler E.J. (1996) Initiation and adaptation : a paradigm for understanding psychotropic drug action.Am. J. Psychiatry 153,151162.
  • 9
    Jacobson M.D. and Raff M. (1995) Programmed cell death and Bcl-2 protection in very low oxygen.Nature 374,814816.
  • 10
    Jope R.S. and Williams M.B. (1994) Lithium and brain signal transduction systems.Biochem. Pharmacol. 77,429441.
  • 11
    Kanno T., Kanno Y., Chen L.F., Ogawa E., Kim W.Y., and Ito Y. (1998) Intrinsic transcriptional activation-inhibition domains of the polyomavirus enhanced binding protein 2/core binding factor alpha subunit revealed in the presence of the beta subunit.Mol. Cell. Biol. 18,24442454.
  • 12
    Ketter T.A., George M.S., Kimbrell T.A., Willis M., Willis M.W., Benson B.E., and Post R.M. (1997) Bipolar Disorder : Biological Models and Their Clinical Application, pp. 179217. Marcel Dekker, New York.
  • 13
    Klampfer L., Zhang J., Zelenetz A.O., Uchida H., and Nimer S.D. (1996) The AML1/ETO fusion protein activates transcription of Bcl-2.Proc. Natl. Acad. Sci. USA 26,1405914064.
  • 14
    Lawrence M.S., Ho D.Y., Sun G.H., Steinberg G.K., and Sapolsky R.M. (1996) Overexpression of Bcl-2 with herpes simplex virus vectors protects CNS neurons against neurological insults in vitro and in vivo.J. Neurosci. 16,486496.
  • 15
    Liang P., Bauer D., Averboukh L., Warthoe P., Rohrwild M., Muller H., Strauss M., and pardee A.B. (1995) Analysis of altered gene expression by differential display.Methods Enzymol. 254,304321.
  • 16
    Liu P., Tarle S.A., Hajra A., Claxton D.F., Marlton P., Freedman M., Siciliano M.J., and Collins F.S. (1993) Fusion between transcription factor CBF beta/PEBP2 beta and a myosin heavy chain in acute myeloid leukemia.Science 261,10411044.
  • 17
    Manji H.K., Potter W.Z., and Lenox R.H. (1995) Signal transduction pathways. Molecular targets for lithium's actions.Arch. Gen. Psychiatry 52,531543.
  • 18
    Merry D.E. and Korsmeyer S.J. (1997) Bcl-2 gene family in the nervous system.Annu. Rev. Neurosci. 20,245267.
  • 19
    Nonaka S., Hough C.J., and Chuang D.M. (1998) Chronic lithium treatment robustly protects neurons in the central nervous system against excitotoxicity by inhibiting N-methyl-d-aspartate receptor-mediated calcium influx. Proc. Natl. Acad. Sci. USA 95,26422647.
  • 20
    Ogawa E., Inuzuka M., Maruyama M., Satake M., Naito-Fujimoto M., Ito Y., and Shigesada K. (1993) Molecular cloning and characterization of PEBP2 beta, the heterodimeric partner of a novel Drosophila runt-related DNA binding protein PEBP2 alpha.Virology 194,314331.DOI: 10.1006/viro.1993.1262
  • 21
    Rajkowska G. (1997) Morphometric methods for studying the prefrontal cortex in suicide victims and psychiatric patients.Ann. NY Acad. Sci. 836,253268.
  • 22
    Smith M.A., Makino S., Altemus M., Michelson D., Hong S.K., Kvetnansky R., and Post R.M. (1995) Stress and antidepressants differentially regulate neurotrophin 3 mRNA expression in the locus coeruleus.Proc. Natl. Acad. Sci. USA 92,87888792.
  • 23
    Wang Q., Stacy T., Miller J.D., Lewis A.F., Gu T.L., Huang X., Bushweller J.H., Bories J.C., Alt F.W., Ryan G., Liu P.P., Wynshaw-Boris A., Binder M., Marin-Padilla M., Sharpe A.H., and Speck N.A. (1996) The CBFbeta subunit is essential for CBFalpha2 (AML1) function in vivo.Cell 87,697708.
  • 24
    Wang S., Wang Q., Crute B.E., Melnikova I.N., Keller S.R., and Speck N.A. (1993) Cloning and characterization of subunits of the T-cell receptor and murine leukemia virus enhancer corebinding factor.Mol. Cell. Biol. 13,33243339.