Expression of 15 Glutamate Receptor Subunits and Various Splice Variants in Tissue Slices and Single Neurons of Brainstem Nuclei and Potential Functional Implications

Authors

  • I. Paarmann,

  • D. Frermann,

  • B. U. Keller,

  • M. Hollmann


  • Abbreviations used: AMPA, α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid; IO, inferior olive, KA, kainate; NH, nucleus hypoglossus; NR, NMDA receptor; NTS, nucleus tractus solitarius; PBC, pre-Bötzinger complex.

Address correspondence and reprint requests to Dr. M. Hollmann at Glutamate Receptor Laboratory, Max-Planck Institute for Experimental Medicine Hermann-Rein Strasse 3, D-37075 Göttingen, Germany. E-mail: Hollmann@mail.mpiem.gwdg.de

Abstract

Abstract: Brainstem nuclei serve a diverse array of functions in many of which ionotropic glutamate receptors are known to be involved. However, little detailed information is available on the expression of different glutamate receptor subunits in specific nuclei. We used RT-PCR in mice to analyze the glutamate receptor subunit composition of the pre-Bötzinger complex, the hypoglossal nucleus, the nucleus of the solitary tract, and the inferior olive. Analyzing 15 receptor subunits and five variants, we found all four α-amino-3-hydroxy-5-methyl-4-propionic acid (AMPA) and six NMDA receptor (NR) subunits as well as three of five kainate (KA) receptors (GluR5, GluR6, and KA1) to be expressed in all nuclei. However, some distinct differences were observed: The inferior olive preferentially expresses flop variants of AMPA receptors, GluR7 is more abundant in the pre-Bötzinger complex than in the other nuclei, and NR2C is most prominent in the nucleus of the solitary tract. In single hypoglossal motoneurons and interneurons of the pre-Bötzinger complex investigation of GluR2 editing revealed strong expression of the GluR2-R editing variant, suggesting low Ca2+ permeability of AMPA receptors. Thus, Ca2+ -permeable AMPA receptors are unlikely to be the cause for the reported selective vulnerability of hypoglossal motoneurons during excitotoxic events.

The area of the pre-Bötzinger complex (PBC), the nucleus hypoglossus (NH), the nucleus tractus solitarius (NTS), and the inferior olive (IO) are localized in the brainstem. Their major functions are respiratory rhythm generation [PBC (Smith et al., 1991; Koshiya and Guyenet, 1996)], movement of the tongue [NH (Lowe, 1980; Greer et al., 1992)], taste perception and regulation of the blood pressure [NTS (Blomquist and Antem, 1965; Palkovits and Zaborsky, 1977; Ogawa et al., 1980)], and normal initiation of all bodily movement as well as motor learning [IO (Marr, 1969; Albus, 1971; Lamarre, 1984)]. Glutamate receptors have been shown to be essential for many brainstem functions (Morino et al., 1994; Pierrefiche et al., 1994; Katakura et al., 1995). They are found throughout the mammalian brain, where they constitute the major excitatory neurotransmitter system. In mammals 18 different ionotropic glutamate receptor subunits and numerous splice variants have been identified (for review, see Hollmann and Heinemann, 1994; Hollmann, 1999). They can be divided in three subfamilies: the α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptors (GluR1-GluR4), kainate (KA) receptors (GluR5-GluR7, KA1, and KA2), and NMDA receptors (NRs) (NMDAR1, NR2A-NR2D, and NR3A).

Several studies have been performed to investigate the expression of glutamate receptors in the brainstem, but they did not distinguish between GluR2 and GluR3 or between flip and flop variants of the AMPA receptors. Expression of KA receptors in the brainstem is mostly unknown. NRs have been studied in more detail (Watanabe et al., 1994; Petralia et al., 1994b), except for NR3A.

Considering that the brainstem nuclei have quite distinct functions, a detailed knowledge of the glutamate receptor subunit composition in the PBC, the NH, the NTS, and the IO is a prerequisite to understanding if the heterogeneity in function is followed by heterogeneity in glutamate receptor subunit expression patterns.

MATERIALS AND METHODS

Preparation of brainstem slices

The brains of 5-8-day-old mice were removed into cold artificial CSF (118 mM NaCl, 3 mM KCl, 1 mM MgCl2, 25 mM NaHCO3, 1 mM NaH2PO4, 1.5 mM CaCl2, and 30 mM glucose), which was bubbled continuously with carbogen (95% O2/5% CO2). The brainstem was isolated, fastened on an agar block, and mounted in an upright position with the rostral side upward and the dorsal side facing the slicer blade. The brainstem and the agar block were inclined 20° in the dorsal direction. Under visual control, brainstem slices 200 μm thick were cut. The rostral cutting edge was determined by topographic landmarks like the facial nucleus, the IO, the pars compacta of the nucleus ambiguus, the NTS, and the NH. After a 20-min recovery period in artificial CSF at room temperature, the slices were transferred to the recording chamber and immediately harvested for RT-PCR experiments. By using infrared differential interference contrast optics (Dodt and Zieglgänsberger, 1994), individual cells could be visualized with infrared-sensitive video equipment. The experiments were carried out in accordance with the guidelines of the Ethics Committee of the Medical Faculty of the University of Göttingen.

Identification of neurons

For RT-PCR experiments, neurons were initially identified by their location within the brainstem slice preparation. Identification was confirmed using electrophysiological and anatomical criteria as previously described: PBC interneurons, Frermann et al. (1999); NH motoneurons, Lips and Keller (1998); and NTS interneurons, Titz and Keller (1997) (see also Watanabe et al., 1994; Korematsu and Redies, 1997).

Harvesting of tissue slices

The brainstem nuclei were identified using an upright Zeiss microscope with 63× magnification and infrared differential interference contrast optics. Parts of the NH, the NTS, the IO, and the PBC were harvested using a pipette with a tip diameter of 40 μm. Multiple cells of a given nucleus were sucked into the pipette. The contents of the pipette were blown out with a sterile syringe into a prepared tube. The RNA was isolated according to a standard protocol (RNeasy Kit; Qiagen). Five microliters of the final volume of 30 μl was used as template for RT. The RT was performed using a standard protocol (SuperscriptII; BRL). Five microliters of the 20-μl RT reaction was used as template for the multiplex PCR.

Harvesting of neurons

Single neurons of the PBC and the NH were whole-cell patch-clamped and immediately aspirated into the pipette. The tips of the patch-clamp pipettes were broken on the bottom of a siliconized tube, and the contents were expelled. Subsequently, RT was performed in a final volume of 10 μl, as described by Lambolez et al. (1992). The entire reaction was used as template for the multiplex PCR.

Multiplex PCR

The glutamate receptors and actin were amplified simultaneously using the following sets of primers (from 5′ to 3′): GluR1-flip/flop sense, GGACCACAGAGGAAGGCATGATC; GluR1-flip/flop antisense, CAGTCCCAGCCCTCCAATC; GluR2-flip/flop sense, TGTGTTTGTGAGGACTACGGCA; GluR2-flip/flop antisense, GGATTCTTTGCCACCTTCATTC; GluR2-Q/R sense, AGCAGATTTAGCCCCTACGAG; GluR2-Q/R antisense, TAAGTTAGCCGTGTAGGAGGA; GluR3-flip/flop sense, GCAGAGCCATCTGTGTTTACCAA; GluR3-flip/flop antisense, AGTTTTGGGTGTTCTTTGTGAGTT; GluR4-flip/flop sense, GCAGAGCCGTCTGTGTTCACTAG; GluR4-flip antisense, CGGCAAGGTTTACAGGAGTTCTT; GluR4-flop antisense, GCGAGGTTAACAGCATTTCCT; GluR5 sense, GCCCCTCTCACCATCACGTAT; GluR5 antisense, TGGTCGATAGAGCCTTGGGCA; GluR6 sense, TTCCTGAATCCTCTCTCCCCT; GluR6 antisense, CACCAAATGCCTCCCACTATC; GluR7 sense, GCAGAGTCAGGCCTGCTGGA; GluR7 antisense, ACTCCACACCCCGACCTTCT; KA1 sense, CCCATCGAGTCTGTGGATGA; KA2 sense, TGGGCCTTCACCTTGATCATCA; KA1-KA2 antisense, CTGTGGTCCTCCTCCTTGGG; NMDAR1 sense, GCTGTACCTGCTGGACCGCT; NMDAR1 antisense, GCAGTGTAGGAAGCCACTATGATC; NR2A sense, GCTACGGGCAGACAGAGAAG; NR2A antisense, GTGGTTGTCATCTGGCTCAC; NR2B sense, GCTACAACACCCACGAGAAGAG; NR2B antisense, GAGAGGGTCCACGCTTTCC; NR2C sense, AACCACACCTTCAGCAGCG; NR2C antisense, GACTTCTTGCCCTTGGTGAG; NR2D sense, CGATGGCGTCTGGAATGG; NR2D antisense, AGATGAAAACTGTGACGGCG; NR3A sense, CCGCGGGATGCCCTACTGTTC; NR3A antisense, CCAGTTGTTCATGGTCAGGAT; β-actin sense, GGGAAATCGTGCGTGACATT; and β-actin antisense, CGGATGTCAACGTCACACTT.

To analyze flip and flop variants of the AMPA receptors, specific primers were used for detection of both flip and flop variants for GluR1, GluR2, and GluR3 [after the procedure of Porter et al. (1998), modified for the mouse]. For GluR4, the same sense primer was used for both splice variants but different antisense primers. GluR2-Q/R primers (Paschen and Djuricic, 1995) were used to amplify the pore region of GluR2. To the RT reaction, 5 nmol of each deoxyribonucleotide triphosphate (Pharmacia), 2.5 U of Taq DNA polymerase (Qiagen), and the buffer supplied by the manufacturer were added to a final volume of 80 μl. Two drops of mineral oil was used as overlay, and after 30 s at 85°C in the preheated thermocycler (MJ Research model PTC-100), 20 μl containing the primer pairs (10 pmol each) was included. The initial denaturation (2 min at 94°C) was followed by 20 cycles (94°C for 30 s, 60°C for 30 s, 72°C for 35 s) of PCR and a final elongation of 5 min at 72°C. Two microliters of the first PCR product was used as a template in the second round of PCR amplification. In this second round, each subunit was amplified individually using its specific primer pair and the same PCR program as for multiplex PCR but with 35 cycles instead of 20. Ten microliters of each amplification product was electrophoresed on a 2% agarose gel in parallel with a molecular weight marker (100-bp ladder; MBI) and stained with ethidium bromide. As a positive control for the multiplex PCR, 25 ng of reverse-transcribed cerebellum RNA was used as template. The predicted sizes (in bp) of the PCR-generated fragments were as follows: 365 (GluR1-flip/flop), 453 (GluR2-flip/flop), 231 (GluR2-Q/R), 472 (GluR3-flip/flop), 220 (GluR-4flip), 218 (GluR4-flop), 358 (GluR5), 259 (GluR6), 300 (GluR7), 434 (KA1), 512 (KA2), 219 (NMDAR1), 257 (NR2A), 314 (NR2B), 464 (NR2C), 265 (NR2D), 417 (NR3A), and 255 (actin).

Restriction analysis

To confirm the results, the remaining 90 μl of the second PCR was extracted once with chloroform/isoamyl alcohol (24:1 vol/vol) and finally dissolved in 20 μl of water. The purified PCR products were cut with appropriate restriction enzymes and analyzed by agarose gel electrophoresis as described above. The predicted fragment sizes (in bp) and the corresponding restriction enzymes were as follows: 164/201 (MseI, GluR1-flop), 179/186 (PpuMI, GluR1-flip), 199/254 (HpaI, GluR2-flop), 160/293 (AvaI, GluR2-flip), 231 (Bbvl, GluR2-R), 92/139 (Bbvl, GluR2-Q), 114/117 (NlaIV, GluR2-Q/R), 210/262 (HpaI, GluR3-flop), 178/294 (NlaIV, GluR3-flip), 31/187 (PvuII, GluR4-flop), 31/189 (PvuII, GluR4-flip), 171/185 (BlnI, GluR5), 24/235 (EcoRV, GluR6), 23/277 (AvaI, GluR7), 189/245 (EcoRI, KA1), 177/335 (KpnI, KA2), 52/167 (BlnI, NMDAR1), 44/213 (MscI, NR2A), 55/259 (BclI, NR2B), 229/235 (Eco47III, NR2C), 107/158 (DrdI, NR2D), and 144/273 (XcmI, NR3A).

Comparison of RT-PCR efficiency for different glutamate receptor clones

The template for cRNA synthesis was prepared from circular plasmid cDNA by linearizing each clone with a suitable restriction enzyme. The cRNA was prepared from 1 μg of linearized template using an in vitro transcription kit (Stratagene) with a modified standard protocol that uses each of the nucleotides at 800 μM (except for GTP, 200 μM), 400 μM GpppG (Pharmacia) for capping, and an extended reaction time of 4 h with T3 or T7 RNA polymerase. All cRNAs were trace-labeled with [32P]UTP (Amersham) to allow for quality checks by gel electrophoresis and calculation of the yield. To remove all traces of template DNA, 1 μg of each cRNA was treated additionally with DNase I (10 U/μl; Boehringer) for 25 min at 37°C, extracted once with phenol/chloroform/isoamyl alcohol (25:24:1 by volume), and finally dissolved to a concentration of 1 ng/μl. Equal amounts (in ng) of cRNA from the glutamate receptor clones to be analyzed were mixed. In a dilution series of the mix the detectability of subunits was checked for 100, 10, 1, 0.1, and 0.01 fg of each RNA. RT, multiplex PCR, and the second round of PCR were performed as described.

RESULTS

Expression of glutamate receptor subunits in slices of brainstem nuclei

To investigate the glutamate receptor subunit composition of brainstem nuclei, five tissue sections from the PBC and the IO and four from the NTS and the NH were analyzed.

GluR1 was detected in all four nuclei in all slices analyzed: the NTS (Fig. 1A, lanes NTS 2-4), the IO (Fig. 1A, lanes IO 1 and 2), the PBC, and the NH (data not shown). Restriction digests of the GluR1 PCR products revealed that both splice variants are present in similar amounts in the NH and in the NTS (data not shown). In contrast, the IO (see Fig. 1B, lanes IO 1 and 2) and the PBC (data not shown) showed a preference for the flop over the flip splice variant of GluR1. In the cerebellum as a positive control, both splice variants were seen (see Fig. 1B, lane cerebellum). Like GluR1 GluR2 was detected in all four nuclei in all experiments (data not shown). Restriction analysis of the GluR2 PCR products showed that the GluR2-flip variant is the least prominent in the IO and that the GluR2-flop variant is the least prominent in the NH. GluR3 also was found to be present in all four nuclei. In the IO (see Fig. 1C, lanes IO 1 and 2), in contrast to the NTS (see Fig. 1C, lanes NTS 2-4), the PBC, and the NH (data not shown), GluR3 was always detectable. In the NTS and in the IO both splice variants are present in similar amounts (data not shown). The PBC and the NH showed a slight preference for the flop over the flip splice variant of GluR3 (data not shown). The expression of GluR4, like the expression of GluR1 and GluR2, was detected in all slices of the PBC, the NH, the NTS, and the IO. Only in the NTS, however, were both splice variants of GluR4 always detectable (see Fig. 1D, lanes NTS 2-4, and E, lanes NTS 2-4). The flop variant of GluR4 is abundant in the IO (see Fig. 1D, lanes IO 1 and 2) but not the flip splice variant. Conversely, in the PBC and the NH the flip variant, but not the flop variant, was always detectable (data not shown).

Figure 1.

Detection of AMPA receptor subunits in tissue slices from brainstem. GluR1 (A), GluR3 (C), GluR4-flop (D), and GluR4-flip (E) were detected in most nuclei. Restriction digest of GluR1 PCR products of IO reveals preferential expression of the flop variant (B). PCR products were analyzed on ethidium bromide-stained agarose gels. Reagent controls 1-4 represent contamination checks for reagents used in RNA preparation and RT-PCR for different batches of tissue slices and were performed in parallel with the analyzed slices. Reagent control S is a contamination check for the reagents used in the second round of PCR.

FIG. 1.

Like AMPA receptor subunits, GluR5 was found to be present in all four nuclei analyzed. In the NTS, GluR5 was always detectable (Fig. 2A, lanes NTS 1-4), being slightly more prominent than in the PBC and the IO (data not shown). The weakest expression of GluR5 among the four nuclei investigated was observed in the NH, where GluR5 was only detectable in half of the experiments (Fig. 2A, lanes NH 1-4). GluR6 was always detectable in the PBC (Fig. 2B, lanes PBC 1-4), the NH, the NTS, and the IO (data not shown). In contrast, expression of GluR7 was undetectable in the NTS and hardly detectable in the NH and the IO (data not shown). GluR7 is much more abundant in the PBC (Fig. 2C, lanes PBC 1-5). KA1 was found to be very prominent in the IO (Fig. 2D, lanes IO 1 and 2) and in the NTS (data not shown). In the NH, KA1 is slightly less abundant (data not shown). The weakest expression among all four nuclei analyzed was observed in the PBC, where KA1 was detectable only in about half of the experiments (Fig. 2D, lanes PBC 1-4). Among all glutamate receptor subunits analyzed, KA2 was detected least frequently. In the PBC and in the NH, KA2 was undetectable. Weak expression of KA2 was seen in the NTS (data not shown). KA2 expression was most prominent in the IO, where it was detected in 40% of the slices analyzed (data not shown).

Figure 2.

Detection of KA receptor subunits in tissue slices from brainstem. GluR5 is most prominent in the NTS (A; lanes NTS 1-4) and much less abundant in the NH (A; lanes NH 1-4). GluR6 was detected in all four nuclei in all experiments (B; lanes PBC 1-4). GluR7 is most prominent in the PBC (C; lanes PBC 1-5) and barely detectable in the other nuclei. KA1 is easily detectable in the IO (D; lanes IO 1 and 2) and less prominent in the PBC (D; lanes PBC 1-4). For other details, see the legend of Fig. 1.

FIG. 2.

NMDAR1 was detectable in all four nuclei in every slice analyzed (Fig. 3A, lanes PBC 1-3 for PBC). NR2A was also found to be expressed in the PBC (Fig. 3A, lane PBC 1), in the NH (Fig. 3A, lane NH 1), in the NTS (Fig. 3A, lane NTS 1), and in the IO (data not shown). In the PBC, the NTS, and the IO, in contrast to the NH, NR2A was detectable in all slices (data not shown). NR2B, like NMDAR1, was always detectable in the four nuclei. A subset of the experiments is shown in Fig. 3B, lanes PBC 1, NH 1, and NTS 1. Compared with NR2B, the expression of NR2C was detected less often. Among all four nuclei, only in the NTS was NR2C always detectable (data not shown). In the PBC, the NH, and the IO, NR2C appeared less abundant (data not shown). NR2D turned out to be abundant in the NH (Fig. 3D, lanes NH 3 and 4), the IO (Fig. 3D, lanes IO 3-5), the PBC, and the NTS (data not shown). Expression of NR3A was seen less often than the expression of the other NMDA receptor subunits except for NR2C. In particular, NR3A could never be detected in all slices analyzed, irrespective of which nucleus was investigated. NR3A expression was demonstrated in ∼75% of the experiments in the NH (Fig. 3E, lanes NH 1-4), the NTS (Fig. 3E, lanes NTS 1-4), the PBC, and the IO (data not shown). These results are summarized in Table 1.

Figure 3.

Detection of NMDA receptor subunits in tissue slices from brainstem. NMDAR1 (A; lanes PBC 1-3) and NR2B (C; lanes PBC 1, NH 1, and NTS 1) were detectable in all four nuclei in all slices analyzed. NR2A (B; lanes PBC 1, NH 1, and NTS 1) and NR2D (D; lanes NH 3 and 4 and IO 3-5) are also very abundant. In most experiments, expression of NR3A was also detected and showed no differences among the four nuclei analyzed (E; lanes NH 1-4 and NTS 1-4). For other details, see the legend of Fig. 1.

Table 1. Detection of glutamate receptor subunits by RT-PCR in tissue slices from different brainstem nuclei
 Nucleus
 PBCNHNTSIO
 Detection rate (%)No. of slices analyzedDetection rate (%)No. of slices analyzedDetection rate (%)No. of slices analyzedDetection rate (%)No. of slices analyzed
  1. The detection rate is the number of positive slices divided by the total number of slices analyzed (%). Flip and flop are different splice variants of the AMPA receptors. β-Actin was used as a positive control for the RNA preparation, RT, and the first round of PCR.

  2. aAt least one order of magnitude less abundant than the corresponding flop variant.

GluR1-flop1005100410041005
GluR1-flip60510041004 100a5
GluR2-flop100575410041005
GluR2-flip100510041004 60a5
GluR3-flop8057547541005
GluR3-flip6055047541005
GluR4-flop80550410041005
GluR4-flip100510041004405
GluR58055041004805
GluR61005100410041005
GluR760525404205
KA140575410041005
KA20504254405
NMDAR11005100410041005
NR2A100575410041005
NR2B1005100410041005
NR2C6052541004605
NR2D805100410041005
NR3A605754754805
β-Actin 1005100410041003

FIG. 3.

TABLE 1.

Glutamate receptor subunit expression in single neurons of the PBC

To investigate the glutamate receptor subunit composition of single PBC neurons, nine to 19 cells were analyzed for the expression of 14 subunits and four splice variants. GluR1 was detected the most often of all the AMPA receptor subunits, in almost all neurons (Fig. 4A, lanes PBC 11-16). GluR3 expression was observed less often than the expression of the other AMPA receptor subunits, in one-third of the neurons (data not shown). At the single-cell level, the flip splice variants of GluR1 and GluR4 were more often detected than the corresponding flop splice variants. Moreover, almost exclusively the flip but not the flop variants of GluR2 and GluR3 were found (data not shown). GluR6 was detectable in almost every neuron (Fig. 4B, lanes PBC 1-5). Expression of GluR7 was observed in one-third of the cells; KA2 was undetectable. In addition, GluR5 and KA1 were barely detectable at the single-cell level (data not shown). Compared with tissue slices of the PBC, detection of NMDAR1 was rather poor in the single neurons (Table 2). NR2C was detected as frequently as NR2A and NR2B in ∼25% of the neurons. In contrast, NR2D expression was seen in ∼70% of the neurons. The results of the single neurons are summarized in Table 2.

Figure 4.

Detection of glutamate receptor subunits in single respiratory-related interneurons of the PBC. GluR1 (A; lanes PBC 11-16), GluR2 (C; lanes PBC 1-5), and GluR6 (B; lanes PBC 1-5) were detected in most cells. GluR2 PCR products were digested with Bbvl to distinguish between R and Q editing variants. Almost exclusively the R variant of GluR2 was detected (D; lanes PBC 4 and 6-10). GluR2-Q and GluR2-R plasmids were used as controls.

Table 2. Detection of glutamate receptor subunits in single neurons of the PBC
 Detection rate (%)No. of cells analyzed
  1. The detection rate is the number of positive cells divided by the total number of cells analyzed (%). Flip and flop are different splice variants of the AMPA receptors. β-Actin was used as a positive control for the RNA preparation, RT, and the first round of PCR.

GluR1-flop3719
GluR1-flip6319
GluR2-flop015
GluR2-flip5315
GluR3-flop519
GluR3-flip3219
GluR4-flop2114
GluR4-flip5511
GluR5010
GluR6899
GluR73315
KA11010
KA2010
NMDAR1715
NR2A2010
NR2B3010
NR2C3010
NR2D7010
β-Actin 10014

FIG. 4.

TABLE 2.

GluR2 editing analysis in single neurons of the PBC and NH

To investigate which GluR2 editing variants are expressed in the PBC and NH, 24 cells of the PBC and 11 cells of the NH were analyzed. Using a primer pair specific for the GluR2 pore region, GluR2 was detected in many PBC neurons (Fig. 4C, lanes PBC 1-5) and NH neurons (data not shown). In all cells that contained GluR2 the presence of the R editing variant was revealed by restriction analysis of the PCR products (Fig. 4D, lanes PBC 4 and PBC 6-10 for PBC). Only in one PBC neuron was the Q variant of GluR2 detected, in addition to the R variant (data not shown). The results of the editing analysis are summarized in Table 3.

Table 3. Detection of GluR2 Q/R editing variants in single neurons
 Nucleus
 PBCNH
 Detection rate (%)No. of cells analyzedDetection rate (%)No. of cells analyzed
  1. The detection rate is the number of positive cells divided by the total number of cells analyzed (%). GluR2-R and GluR2-Q are RNA editing variants of GluR2.

GluR2-R79248211
GluR2-Q424011

TABLE 3.

DISCUSSION

Comparison with in situ hybridization and immunocytochemical studies

We have simultaneously investigated the expression of 15 glutamate receptor genes plus five splice or editing variants in the mouse. The analysis included all four AMPA receptor subunits including flip and flop splice variants as well as the R and Q editing variants of GluR2, all five KA receptor subunits, and six NMDA receptor subunits. This is the first time that the expression of all known functional glutamate receptor subunits was investigated in parallel in the brainstem.

The expression of GluR1 in the brainstem has previously been investigated (Petralia and Wenthold, 1992; Bahr et al., 1996; Williams et al., 1996; Ambalavanar et al., 1998) in immunocytochemical studies indicating weak to moderate expression of GluR1 in the PBC, the NH, and the NTS and strong expression of GluR1 in the IO. These findings are confirmed by the detection of GluR1 in all four nuclei in the present study (see Table 1). In contrast to GluR1, the expression of GluR2 in identified brainstem nuclei has not yet been studied in detail. GluR2 has been described as being weakly expressed in the lower brainstem of the adult rat (Pellegrini-Giampietro et al., 1991; Petralia et al., 1997). Using an antibody specific for both GluR2 and GluR3, moderate immunoreactivity has been detected in the PBC and in the NH. In contrast to the NH and the IO, in the NTS differences between the species have been encountered. Strong immunoreactivity for GluR2/3 has been found in the cat but only moderate signals in the rat and none at all in human tissue (Petralia and Wenthold, 1992; Williams et al., 1996; Ambalavanar et al., 1998). Our findings of strong GluR2 expression in all four nuclei (see Table 1) suggest that the immunoreactivity in the immunocytochemical studies mentioned is at least partially caused by the presence of GluR2 and not exclusively by GluR3. Similar to GluR2, weak expression of GluR3 in the brainstem has been revealed in an in situ hybridization study (Pellegrini-Giampietro et al., 1991). Our findings indicate the presence of GluR3 in all four nuclei, most prominently in the IO and the PBC (see Table 1). Compared with GluR2 and GluR3, much more is known about the expression of GluR4 in the brainstem. GluR4 is expressed in the brainstem of postnatal day 7 mice (Bettler et al., 1990) and adult rats (Bahr et al., 1996). Expression of GluR4 has been described in the PBC, the NH, the NTS, and the IO (Petralia and Wenthold, 1992; Williams et al., 1996; Ambalavanar et al., 1998). Because the present study revealed strong expression of GluR4 in all four nuclei investigated (see Table 1), qualitatively our findings are in agreement with the data obtained from the rat, cat, and human.

The expression of flip and flop splice variants of the AMPA receptors has been investigated in earlier studies in most parts of the brain but not in the brainstem (Sommer et al., 1990; Monyer et al., 1991; Tölle et al., 1995). Flip splice variants are prominent throughout early postnatal brain development. In contrast, flop splice variants appear later in development, being still less prominent than flip variants at postnatal day 8 (Monyer et al., 1991). Assuming that similar developmental changes occur in the rat and the mouse, the strong predominance of the flop over the flip splice variants in the IO seen in the present study (see Table 1) is quite extraordinary. In contrast to the IO, no preferential splicing of the AMPA receptor subunits was detected in the NTS, the PBC, and the NH in tissue slices (see Table 1). For the AMPA receptor GluR2 editing variants exist in addition to the splice variants. Low levels of the Q variant of GluR2 have been shown to be present in fetal but not in adult brain (Burnashev et al., 1992; Paschen and Djuricic, 1995). In the present study, single respiratory-related neurons of the PBC and the NH motoneurons almost exclusively contained the R editing variant but not the Q editing variant of GluR2 (see Table 3); this fits well with previous findings in the rat.

Compared with the AMPA receptor subunits, much less is known about the expression of KA receptor subunits in the PBC, the NH, the NTS, and the IO. In our study, we observed GluR5 expression in all nuclei analyzed, being most prominent in the NTS. This fits well with the strong expression of GluR5 in the brainstem in embryonic day 12 to postnatal day 12 mice as shown by in situ hybridization (Bettler et al., 1990). More attention has been paid to GluR6 than to GluR5. Weak hybridization signals were found in several mouse brainstem nuclei (Egebjerg et al., 1991), and immunoreactivity was detected in young rats in all four nuclei by an antibody recognizing both GluR6 and GluR7 (Petralia et al., 1994a). Because the present study revealed the presence of GluR6 mRNA in all four nuclei, our findings suggest that the immunoreactivity described by Petralia et al. (1994a) was due at least partially to the presence of the GluR6 protein. Similar to GluR6, the expression of GluR7 has not yet been extensively studied in the brainstem. GluR7 is expressed in the entire CNS in embryonic day 15 rats and in the brainstem of adult rats (Lomeli et al., 1992). This fits well with the detection of GluR7 in the PBC demonstrated in our study. Like GluR7, weak expression of KA1 RNA in the brainstem of adult and embryonic rats has been described (Herb et al., 1992; Wisden and Seeburg, 1993). This might partly be due to the presence of KA1 in the NTS and the IO, but also in the NH, as shown in the present study. In contrast to the other KA receptor subunits, the expression of KA2 has been previously studied in identified brainstem nuclei. Weak expression of KA2 was detected in the PBC, the NH, the NTS, and the IO of rats (Petralia et al., 1994a). In this study, the reported expression of KA2 in the PBC and the NH could not be confirmed in mice (see Table 1). The same primers used for KA2 in the present study have been successfully used by others to detect both KA1 and KA2 at the single-cell level in the rat (Ruano et al., 1995); furthermore, the KA2 primers have no mismatches with the mouse KA2 sequence, and the detection limit of KA2 is similar to that of other glutamate receptor subunits (see Table 4). Therefore, the difference in KA2 expression observed in this study as compared with the study by Petralia et al. (1994a) might be due to species differences or the different developmental stages used [5-8-day-old mice in the present study versus rats of 120-250 g in the study by Petralia et al. (1994a)].

Table 4. Comparison of efficiency of RT-PCR for different glutamate receptor subunits
 Detectable RNA molecules
 Tissue slices 
SubunitIIISingle cells
  1. The detection limits of different glutamate receptor subunits were determined using cRNA as template (see Materials and Methods for details). I and II represent two independent experiments to determine the detection limits. Note that the RT-PCR technique for tissue slices is slightly more efficient than the technique used for single cells. The detection limit of KA2, which was rarely found in slices or single neurons, is similar to the detection limits of other subunits.

GluR1-flip/flop6060600
GluR2-flip/flop4,000400400
GluR3-flip/flop600606,000
GluR4-flip5050500
GluR4-flop50050500
KA25005005,000
NMDAR14,0004004,000
NR2A15150150
NR2B3,0003003,000

TABLE 4.

The expression of NMDAR1 in the PBC, the NH, the NTS, and the IO has been investigated in prior studies that revealed the presence of NMDAR1 both at the RNA and at the protein level (Petralia et al., 1994b; Watanabe et al., 1994; Ambalavanar et al., 1998). The detection of NMDAR1 at the RNA level was confirmed in the present study. Like NMDAR1, NR2A is expressed in the brainstem. The expression of NR2A in mouse brainstem is known to start between postnatal day 0 and 21 (Watanabe et al., 1992). NR2A was detectable in the PBC, the NH, the NTS, and the IO (Watanabe et al., 1994). These findings were confirmed in the present study, in which strong expression of NR2A was shown in all four nuclei. This suggests that the immunoreactivity found with an antibody specific for both NR2A and NR2B (Petralia et al., 1994c) in young rats in all four nuclei is at least partially caused by the presence of NR2A. The expression of NR2B in the mouse brainstem starts before NR2A expression, but between postnatal day 1 and 21 a developmental shift in the expression pattern occurs, and NR2B is largely replaced by NR2A (Watanabe et al., 1992). In the NTS, the IO, and the NH, but not in the PBC, in postnatal day 21 mice weak expression of NR2B was described by Watanabe et al. (1994). Because in our study strong NR2B expression was demonstrated in postnatal day 5-8 mice in all four nuclei, our findings are in agreement with an incomplete developmental switch from NR2B to NR2A between postnatal day 0 and 21 in the brainstem. In contrast to NR2A and NR2B, NR2C reportedly is not expressed in the PBC, the NH, the NTS, and the IO (Watanabe et al., 1994). In the present study, however, NR2C expression was observed in all four nuclei (see Table 1). The differences between the two studies might be caused by a higher sensitivity of the RT-PCR technique compared with in situ hybridization. The presence of NR2D in the brainstem has been shown at the RNA level (Nakanishi, 1992; Watanabe et al., 1992; Monyer et al., 1994) and also at the protein level (Wenzel et al., 1996; Laurie et al., 1997). Nevertheless, Watanabe et al. (1994) failed to detect NR2D in the PBC, NH, NTS, and IO of mice. In contrast, in our study NR2D turned out to be very prominent in all four nuclei (see Table 1). These differences again might be caused by different sensitivities of the methods used. Compared with the other NMDA receptor subunits, much less is known about the modulatory subunit NR3A. The expression of NR3A in the brainstem has been mentioned in one study (Ciabarra et al., 1995). NR3A expression is high in mouse in the first 2 weeks after birth but subsequently decreases (Sucher et al., 1995). This accords well with the detection of NR3A in all four nuclei from 5-8-day-old mice in the present study.

Glutamate receptor subunits in nonneuronal cells

Glutamate receptor subunits have been detected in glial cells of the postnatal cortical layer I and of the corpus callosum (Monyer et al., 1994), in tanycytes (Molnar et al., 1993; Petralia et al., 1994a), pituitary gland cells (Petralia et al., 1994a, b), and Bergmann glial cells (Monyer et al., 1991). Comparing the data in the present study obtained from tissue slices of the PBC (Table 1) with the data from single neurons of the PBC (Table 2), an obvious difference is the strong preferential splicing of the flip variants of the AMPA receptors, which is only seen in single neurons but not in tissue slices. This observation is most likely explained by the expression of flop variants in nonneuronal cells located within the PBC.

Additional differences have been observed between glutamate receptor expression data obtained from PBC tissue slices and single respiratory-related interneurons harvested from the PBC. Because at the single-cell level detection of GluR5, KA1, and the NMDA receptor subunits (except NR2D) was rather poor (see Table 2) compared with the tissue slices (see Table 1), these differences might reflect an overall lower detection rate for the single-cell RT-PCR as compared with whole-tissue RT-PCR. This might be due to less template material, a slightly less efficient RT-PCR technique (Table 4), or different cell types in the area of the PBC expressing different glutamate receptor subunits. For NR2D, but not for NMDAR1, based on investigation of both NMDAR1 and NR2D at the RNA and protein level with development, a posttranscriptional mechanism regulating the amount of NR2D protein has been postulated (Wenzel et al., 1996). Therefore, the observed excess of NR2D over NMDAR1 at the RNA level might not necessarily lead to excess amounts of NR2D over NMDAR1 proteins.

Functional implications of glutamate receptor subunit expression pattern

Functional NRs are not necessary for the prenatal development of the circuits that generate the respiratory rhythm (Funk et al., 1997). However, the respiratory network continues to develop postnatally (Ramirez et al., 1996, 1997). Also, critical periods for NR-mediated activity-dependent development have been demonstrated postnatally in many systems [visual cortex (Shatz, 1990), trigeminal system (Li et al., 1994), and spinal cord motoneurons (Kalb and Hockfield, 1990)]. Because NR3A is thought to be involved in the development of synaptic elements (Das et al., 1998), NR3A in postnatal day 5-8 mouse brainstem nuclei might serve to down-regulate the NR function in these nuclei and thereby reduce the number of newly formed spines.

Because the mice used in this study were 5-8 days old, only the R editing variant of GluR2 is expected to be present (Burnashev et al., 1992; Paschen and Djuricic, 1995). This has been confirmed for the PBC and the NH at the single-cell level (see Table 3). Only the R editing variant, but not the Q editing variant, of GluR2 confers Ca2+ impermeability to AMPA receptors (Hume et al., 1991; Verdoorn et al., 1991). Therefore, the abundant expression of edited GluR2 in all four nuclei suggests formation of AMPA receptors with low Ca2+ permeabilities. For this reason the AMPA receptors of the respiratory-related interneurons of the area of the PBC are unlikely to be highly Ca2+-permeable and thus may contribute only small amounts of calcium influx to activity-related Ca2+ oscillations in these neurons (Frermann et al., 1999).

Selective vulnerability of motoneurons due to excitotoxic events is associated with motoneuron diseases such as amyotrophic lateral sclerosis in humans (DePaul et al., 1988; Rothstein and Kuncl, 1995), and hypoglossal motoneurons are among the motoneuron populations most notably affected (Reiner et al., 1995). Several mechanisms have been discussed to explain this selective vulnerability. These include lack of calcium homeostasis resulting from rapid calcium signaling (Lips and Keller, 1998; Palecek et al., 1999) and/or weak expression of Ca2+-binding proteins with concomitant low endogenous Ca2+ buffering capacity (Reiner et al., 1995; Shaw and Ince, 1997; Lips and Keller, 1998), as well as selective vulnerability of axonal neurofilaments resulting from long-distance axonal projections in motoneurons (Morrison et al., 1998). One particularly attractive hypothesis for the cause of this differential vulnerability is the expression of an extraordinary collection of Ca2+-permeable ion channels, including Ca2+-permeable AMPA receptors, which leads to significant amounts of calcium influx on small membrane depolarizations (Pellegrini-Giampietro et al., 1997; Williams et al., 1997). In fact, expression of Ca2+-permeable AMPA receptors lacking GluR2 has been described as enhancing neuronal susceptibility to glutamate toxicity (Choi and Rothman, 1990; Bennett et al., 1996; Shaw et al., 1999). In contrast to this view, we found that the edited GluR2 variant is strongly expressed in NH motoneurons (see Table 3). Accordingly, these neurons are unlikely to possess a significant population of highly Ca2+-permeable AMPA receptors. Thus, our data suggest that mechanisms other than the expression of AMPA receptors lacking GluR2 might be responsible for Ca2+-mediated selective damage of NH motoneurons.

Acknowledgements

We thank B. Lambolez and B. Cauli for their help in setting up the multiplex PCR and D. W. Richter for valuable discussions. This work was supported by the Graduiertenkolleg “Organization and Dynamics of Neuronal Networks,” grant SFB 406, and a Ph.D. fellowship from the Max-Planck Society to I.P.

Ancillary