Dibutyryl-cAMP (dbcAMP) up-regulates astrocytic chloride-dependent l-[3H]glutamate transport and expression of both system xc subunits

Authors

  • Gordon E. Gochenauer,

    1. Departments of Pediatrics and Pharmacology, Children's Hospital of Philadelphia, University of Pennsylvania, Philadelphia, Pennsylvania, USA
    Search for more papers by this author
  • Michael B. Robinson

    1. Departments of Pediatrics and Pharmacology, Children's Hospital of Philadelphia, University of Pennsylvania, Philadelphia, Pennsylvania, USA
    Search for more papers by this author

Address correspondence and reprints requests to Michael B. Robinson, 502 Abramson Pediatric Research Building, 3516 Civic Center Blvd, Philadelphia, PA 19104-4318, USA. E-mail: Robinson@pharm.med.upenn.edu

Abstract

Recent studies have shown that N6,2′-O-dibutyryladenosine 3′:5′ cyclic monophosphate (dbcAMP) increases the expression of specific subtypes of Na+-dependent glutamate transporters in cultured astrocytes. Our group also found that treatment of astrocytes with dbcAMP for several days increases the Na+-independent accumulation of l-[3H]glutamate. In this study, the properties of this Na+-independent accumulation were characterized, and the mechanism by which dbcAMP up-regulates this process was investigated. This accumulation was markedly reduced in the absence of Cl and was also inhibited by several anion-exchange inhibitors, including 4,4′-diisothiocyanatostilbene-2,2′-disulfonic acid, 4,4′-dinitrostilbene-2,2′-disulfonic acid and 4-acetamido-4′-isothiocyanatostilbene-2,2′-disulfonic acid, suggesting that this activity is mediated by a Cl-dependent transporter. In addition, this activity was inhibited by micromolar concentrations of several inhibitors of another Cl-dependent (Na+-independent) transport activity frequently referred to as system xc (l-cystine, l-α-aminoadipate, l-homocysteate, quisqualate, β-N-oxalyl-l-α,β-diaminopropionate, ibotenate). This activity was competitively inhibited by several phenylglycine derivatives previously characterized as inhibitors of metabotropic glutamate receptor activation. The concentration-dependence for Na+-independent, Cl-dependent l-[3H]glutamate uptake activity was compared for dbcAMP-treated and untreated astrocytes. Treatment with dbcAMP increased the Vmax of this Cl-dependent transport activity by sixfold but had no effect on the Km value. System xc requires two subunits, xCT and 4F2hc/CD98, to reconstitute functional activity. We found that dbcAMP caused a twofold increase in the levels of xCT mRNA and a sevenfold increase in the levels of 4F2hc/CD98 protein. This study indicates that dbcAMP up-regulates Cl-dependent l-[3H]glutamate transport activity in astrocytes and suggests that this effect is related to increased expression of both subunits of system xc. Because this activity is thought to be important for the synthesis of glutathione and protection from oxidant injury, understanding the regulation of system xc may provide alternate approaches to limit this form of injury.

Abbreviations used
l-AP4

l-2-amino-4-phosphonobutyrate

4C3HPG

(S)-4-carboxy-3-hydroxyphenylglycine

4CPG

(S)-4-carboxyphenylglycine

dbcAMP

N6,2′-O-dibutyryladenosine 3′:5′ cyclic monophosphate

DIDS

4,4′-diisothiocyanatostilbene-2,2′-disulfonic acid

DNDS

4,4′-dinitrostilbene-2,2′-disulfonic acid

ltrans-PDC

ltrans-pyrrolidine-2,4-dicarboxylate

SITS

4-acetamido-4′-isothiocyanatostilbene-2,2′-disulfonic acid.

Effective clearance of glutamate, a major excitatory amino acid in the mammalian CNS, from the synaptic cleft is necessary to maintain efficient synaptic transmission. It is thought that the main mechanism of the removal of glutamate is a family of five recently cloned high-affinity Na+-dependent transporters (for review, see Danbolt 1994; Sims and Robinson 1999). The transporters GLT-1 and GLAST are primarily found in astrocytes, EAAC1 and EAAT4 are predominantly found in neurons and EAAT5 is found only in retina. These transporters are responsible for preventing the accumulation of excitotoxic levels of glutamate as well as limiting synaptic transmission (for review, see Gegelashvili and Schousboe 1997; Sims and Robinson 1999).

In addition to this family of Na+-dependent transporters, a Cl-dependent/Na+-independent process designated as system xc, which exchanges anionic cystine for glutamate at a ratio of 1:1, has been described (Bannai 1986; Ishii et al. 1992). This activity is observed in peripheral tissues and is thought to be expressed by both astrocytes (Waniewski and Martin 1984; Cho and Bannai 1990; Ye et al. 1999) and neurons (Murphy et al. 1990). It is generally thought that under physiologic conditions this system exchanges extracellular cystine for intracellular glutamate. The intracellular cystine is then rapidly reduced to cysteine, which is the rate-limiting step for the production of the antioxidant glutathione (Bannai and Ishii 1982; Christensen 1990). There is evidence that an extracellular accumulation of glutamate competitively inhibits cystine uptake and causes neurotoxicity by depleting intracellular stores of glutathione (Murphy et al. 1990). In addition, reversed operation of system xc may contribute to the rise in extracellular glutamate that accompanies ischemic brain injury (Seki et al. 1999; Warr et al. 1999).

There has been a limited number of studies of the regulation of system xc. Depletion of cystine and exposure to electrophilic agents increase the activity of this system (Bannai et al. 1989; Sato et al. 1998). System xc activity increases in brain slice preparations after ischemic insults (Koyama et al. 1995) and is up-regulated in human glioma cell lines (Ye et al. 1999). At least some of these effects occur within minutes and are not therefore likely to be related to increased protein expression. Unlike many other transporters, which function as homomeric proteins, system xc is a heteromer consisting of two subunits. The first subunit was identified as a surface antigen called 4F2hc (the mouse homolog is called CD98) (Haynes et al. 1981; Parmacek et al. 1989). The second subunit has been named xCT (Sato et al. 1999). The availability of these clones now makes it possible to begin to examine mechanisms that regulate this transporter.

N6,2′-O-dibutyryladenosine 3′:5′ cyclic monophosphate (dbcAMP) causes an increase in the expression of both GLT-1 and GLAST in astrocyte cultures that correlates with a shift in astrocyte morphology that may resemble differentiation (Eng et al. 1997; Swanson et al. 1997; Schlag et al. 1998). We also noticed that dbcAMP caused an increase in the Na+-independent accumulation of l-[3H]glutamate. In this study, the properties of this transport activity were characterized and were noted to be similar to those of system xc. Evidence is presented that dbcAMP also increases the expression of both system xc subunits, xCT and 4F2hc. A preliminary report of this work has appeared in abstract form.

Materials and methods

Materials

Rats were obtained from Charles River Laboratories (Wilmington, MA, USA). All tissue culture media were obtained from Gibco BRL (Gaithersburg, MD, USA) except fetal bovine serum which was from Hyclone (Logan, UT, USA). The l-[3H]Glutamate, [γ-32P]ATP and [α-32P]dCTP were obtained from DuPont-New England Nuclear (Boston, MA, USA). N6,2′-O-dibutyryladenosine 3′:5′ cyclic monophosphate, 4,4′-diisothiocyanatostilbene-2,2′-disulfonic acid (DIDS), 4-acetamido-4′-isothiocyanatostilbene-2,2′-disulfonic acid (SITS) and antiactin antibody were purchased from Sigma Chemical Co. (St. Louis, MO, USA). 4,4′-Dinitrostilbene-2,2′-disulfonic acid (DNDS) was purchased from Molecular Probes (Eugene, OR, USA). The sources for all of the excitatory amino acid analogs are indicated in Tables 1 and 2. Rabbit complement was purchased from ICN Biomedicals (Aurora, OH, USA). A2B5 hybridoma to produce anti-A2B5 monoclonal antibody was purchased from American Type Culture Company (Manassas, VA, USA). Anti-CD98 antibody and CD98 peptide were purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA, USA). Rapid-hyb buffer was purchased from Amersham Pharmacia Biotech (Piscataway, NJ, USA). Intracellular GSH levels were measured using an assay kit purchased from Calbiochem (La Jolla, CA, USA). The use of animals for these studies was approved by the Institutional Animal Care and Use Committee, and experimental procedures were performed in accordance with the NIH Guide for the Care and Use of Laboratory Animals.

Table 1.   Potency of excitatory amino acid analogues for inhibition of Cl-dependent l-[3H]Glu transport into dbcAMP-treated cultured astrocytes
InhibitorIC50m)Hill slope
  1. The chloride-dependent transport of l-[3H]Glu (0.5 µm) was measured in the absence and presence of increasing concentrations of inhibitor. Values are expressed as the concentration (µm) of each compound that was required to inhibit transport activity by 50% (IC50 values). Data are mean ± SEM of 4–6 independent observations. Hill slope values (in parentheses) were determined from the means of all data points between 10% and 90% inhibition. Control uptake for these studies was 16 ± 1 pmol/mg protein/min (n = 49). The sources of the compounds used in this study are abbreviated in parentheses after the name of the compound: S, Sigma; T, Tocris.

(S)-4CPG (T)2.13 ± 0.4(1.28)
(S)-4C3HPG (T)5.75 ± 2.8(0.81)
l-serine-O-sulfate (T)6.42 ± 1.4(0.89)
l-quisqualate (T)6.56 ± 2.3(1.04)
(RS)-4-bromohomoibotenate (T)11.2 ± 1.4(1.19)
β-N-oxalyl-l-α,β-diaminopropionate (T)14.1 ± 3.8(1.01)
l-cystine (S)14.4 ± 4.1(1.22)
lα-aminoadipate (T)14.9 ± 3.9(0.90)
(2S,1′S,2′S)-2-(carboxycyclopropyl)glycine (T)16.4 ± 1.5(1.07)
(S)-3-carboxy-4-hydroxyphenylglycine (T)18.3 ± 5.3(1.35)
l-homocysteinesulfinate (T)18.5 ± 2.0(1.29)
ibotenate (T)26.6 ± 6.1(0.91)
l-homocysteate (S)26.9 ± 12(1.23)
l-cysteine (S)33.0 ± 0.4(1.29)
(1S,3R)-1-aminocyclopentane-1,3-dicarboxylate (T)156 ± 15(1.20)
L-AP4 (T)212 ± 56(1.15)
l-glutamate-γ-hydroxamate (S)386 ± 100(1.45)
l-cysteate (S)487 ± 140(0.96)
Table 2.   Weak inhibitiors of Cl-dependent l-[3H]Glu uptake into cultures of dbcAMP-treated astrocytes
Inhibitor% inhibition at 1 mm
  1. The chloride-dependent transport of l-[3H]Glu (0.5 µm) was measured in the absence and presence of 1 mm inhibitor. Data are expressed as a percent inhibition of control values and are expressed as mean ± SEM of 3 or 4 independent observations. Control uptake for these studies was 18 ± 1 pmol/mg protein/min (n = 19). The sources of the compounds used in this study are abbreviated in parentheses after the name of the compound: C, Calbiochem; S, Sigma; T, Tocris.

l-cysteinesulfinate (S)75 ± 8%
α-amino-3-hydroxy-5-methylisoxazole-4-propionate (T)74 ± 13%
l-aspartate (S)72 ± 2%
l-AP6 (T)69 ± 4%
d-glutamate (S)62 ± 3%
(2S,3S)-β-p-chlorophenylglutamate (T)62 ± 5%
(2S,1′S,2′R′)-2-(carboxycyclopropyl)glycine (T)43 ± 21%
6-cyano-7-nitroquinoxaline-2,3-dione (T)41 ± 8%
(RS)-2-chloro-5-hydroxyphenylglycine (T)27 ± 28%
(RS)-3,5-dihydrophenylglycine (T)25 ± 5%
d-aspartate (S)25 ± 3%
(2S,1′R,2′R)-2-(carboxycyclopropyl)glycine (T)23 ± 23%
l-glutamine (S)18 ± 8%
(RS)-1-aminoindan-1,5-dicarboxylate (T)12 ± 10%
l-aspartate-β-hydroxamate (S)12 ± 9%
(2S,1′R,2′S)-2-(carboxycyclopropyl)glycine (T)11 ± 19%
ltrans-PDC (T)5 ± 3%
dlthreo-βhydroxyaspartate (C)2 ± 10%
dl-2-amino-5-phosphonopentanoate (T)− 6 ± 14%
glycine (S)− 6 ± 15%
glutathione ethyl ester (reduced, S)− 6 ± 20%
dihydrokainate (T)− 10 ± 9%
(S)-α-methyl-4-carboxyphenylglycine (T)− 12 ± 12%
NMDA (T)− 13 ± 1%
glutathione (reduced, S)− 14 ± 9%
N-acetyl-l-cysteine (S)− 15 ± 3%
(2S,3S,4S)-2-methyl-2-(carboxycyclopropyl)glycine (T)− 15 ± 12%
kainate (S)− 17 ± 4%
l-2-amino-3-phosphonopropionate (T)− 20 ± 9%
trans-azetidine-2,4-dicarboxylate (T)− 21 ± 6%
(RS)-1-amino-trans-3-− 26 ± 2%
phosphonocyclohexanecarboxylate (T)

Astrocyte culture

Primary cultures of astrocytes were prepared from the cortices of rat pups (1–4 days old) as described previously (Zelenaia et al. 2000). After dissection from the meninges, the cortical tissue was gently triturated by aspiration into a pipette and then incubated with trypsin for 20 min. The cells were cultured in 80% Dulbecco's modified Eagle's medium (DMEM), 10% Ham's F12, 10% heat-inactivated fetal bovine serum and 0.24% penicillin/streptomycin (10 000 U/mL penicillin, 10 000 µg/mL streptomycin). Cells were plated at a uniform density of 2.5 × 105 cells/mL (3.0 × 104 cells/cm2) onto sterile 12-well polystyrene dishes. Cells were fed by changing the media completely every 3 or 4 days until cultures were confluent after 12–14 days in vitro. These cultures were then either fed with media supplemented with 0.25 mm dbcAMP or standard glial medium every 3 or 4 days for 10 days. The cultures were maintained at 37°C in a humid atmosphere of 5% CO2 and were > 95% astrocytes (based on expression of glial fibrillary acidic protein) upon experimentation (Garlin et al. 1995). In a subset of experiments, the small numbers of oligodendrocyte precursors (A2B5-positive cells) were eliminated using A2B5 hybridoma supernatant and complement-mediated cell lysis (Zelenaia et al. 2000). The cultures were washed three times with HEPES-buffered saline solution and incubated for 24 h in culture medium prior to addition of dbcAMP supplemented media. After complement-mediated cell lysis, essentially all of the remaining cells are glial fibrillary acidic protein-positive and no A2B5-postive cells (oligodenodroglial precursors) can be detected (Zelenaia et al. 2000).

L-[3H]Glutamate transport assay

The Na+-independent/Cl-dependent transport of l-[3H]glutamate into primary cortical astrocytes was measured at 22–24 days in vitro. Sodium-free buffer contained 5 mm Tris base, 10 mm HEPES, 140 mm choline chloride, 2.5 mm KCl, 1.2 mm CaCl2, 1.2 mm MgCl2, 1.2 mm K2PO4 and 10 mm dextrose, with a final pH of 7.4. Na+- and Cl-free buffer contained 5 mm Tris base, 10 mm HEPES, 140 mm choline gluconate, 2.5 mm potassium gluconate, 1.2 mm calcium gluconate, 1.2 mm magnesium gluconate, 1.2 mm K2PO4 and 10 mm dextrose, with a final pH of 7.4. Triplicate transport assays were performed as described previously (Garlin et al. 1995). Sodium-independent/chloride-dependent transport was calculated as the difference between the radioactivity accumulated in cells incubated with Na+-free buffer and that accumulated in cells incubated with Na+ and Cl-free buffer. Uptake was measured in dbcAMP-treated cultures at various times (1, 2, 5 and 10 min) and was linear to at least 10 min (r2 = 1.00, n = 2). Therefore, 5 min incubations were used for our studies. In studies of the effects of the anion transport inhibitors, the cultures were rinsed in DMEM and pre-incubated for 15 min with these inhibitors. Cells were then rinsed into a cocktail that contained buffer, substrate and either vehicle or inhibitor. In the other pharmacological studies, the cultures were not pre-incubated with excitatory amino acid analogs, but were rinsed into a cocktail that contained both substrate and the inhibitor. All stock solutions of amino acids were neutralized with a molar equivalent of 10 m KOH. These studies were performed using 0.5 µm l-[3H]glutamate. Activity was normalized to protein (Lowry et al. 1951).

Western analysis

Parallel control and dbcAMP-treated cultures were rinsed twice with cold phosphate-buffered saline prior to being scraped and suspended in the same buffer containing 0.5 mm EDTA. The cells were centrifuged at 15 000 g (12 000 r.p.m.) for 5 min The resulting pellet was sonified in 20 mm HEPES, pH 7.5, 2 mm MgCl2 and 1 mm EDTA. After an aliquot was removed for protein analysis (Lowry et al. 1951), protease inhibitors were added (final concentrations: 1 µm phenylmethylsulfonyl fluoride, 100 ng/mL leupeptin, 11 ng/mL aprotinin). The samples were then diluted 1:1 with sample buffer containing 2% sodium dodecyl sulfate, 10% β-mercaptoethanol, 5% glycerol, 0.01% bromophenol blue and 50 mm Tris, pH 7.0, boiled for 5 min, and frozen until analysis. Crude synaptosomes (P2) from cortex were prepared as described previously (Robinson et al. 1991).

Protein samples were separated using 8% sodium dodecyl sulfate/polyacrylamide gels and transferred to poly(vinylidene difluoride) membranes (Immobilon P). Blots were probed with goat anti-CD98 (1:2000, 100 ng/mL), stripped and reprobed with anti-actin (diluted 1:5000). Peptide neutralization of anti-CD98 was performed by incubating the antibody (500 ng) with peptide (2.5 µg) overnight at 4°C. This mixture was diluted to give the same final dilution of antibody. Bands were detected visually using enhanced chemiluminescence. The density of immunoreactive bands was quantified using Image (National Institutes of Health, Bethesda, MD, USA). Differences in CD98 immunoreactivity between cortex, control cultures and dbcAMP-treated cultures were calculated both as a ratio of the amount of protein loaded and as a ratio of the immunoreactivity of actin. The results of both of these calculations were similar.

Northern analysis

Total RNA was extracted from primary astrocytes and cortex by the single-step guanidium thiocyanate−phenol−chloroform method as described previously (Ausubel et al. 1995). Samples were separated by electrophoresis in a 1% agarose/6.6% formaldehyde gel in 1 × 3-(N-morpholino)propanesulfonic acid buffer. RNA was transferred by capillary method to Hybond N+ positively charged nylon membrane and was immobilized by baking the membrane at 80°C for 2.5 h. Membranes were pre-hybridized with Rapid-hyb buffer at 42°C for 2 h and hybridized at 42°C for 18 h with the probe diluted in Rapid-hyb buffer. Membranes were then sequentially washed with 2, 0.4 and 0.1× standard saline citrate at 42°C. After exposing the membrane for 18 h to a phosphor plate, radioactive bands were visualized with a PhosphoImager SI. The density of bands was quantified using ImageQuant. As observed previously (Schlag et al. 1998), dbcAMP had no effect on the levels of cyclophilin mRNA. Therefore, data are expressed as a ratio of xCT mRNA to cyclophilin mRNA. The sequence of the xCT probe was GGTCTTACATACACATTACTGG, which is complementary to nucleotides 644–665 of the previously published mouse xCT sequence (Sato et al. 1999). The oligonucleotide was radiolabeled with [γ-32P]ATP by T4 polynucleotide kinase (Promega, Madison WI, USA). The BamHI−HindIII fragment of rat cyclophilin cDNA (0.7 kb) was used as a probe and was radiolabeled with [α-32P]dCTP by random priming with Prime-it II kit (Stratagene).

Curve fitting and statistical analysis

Linear regression analysis was used to fit the Eadie-Hofstee transformations of the concentration dependence. IC50 values and Hill slopes for compounds that inhibited transport activity by > 75% at 1 mm were calculated using non-linear regression analysis and graphpad prism (GraphPad Software, Inc.) Data were fit assuming a single homogeneous population of sites; the analyses were constrained between 0 and 100% inhibition. All data are reported as the mean ± SEM of at least three independent observations.

Results

N6,2′-O-dibutyryladenosine 3′:5′ cyclic monophosphate increases the activity of a Cl-dependent transporter

As observed previously, we found that treatment of cultured astrocytes with dbcAMP for 10 days resulted in a marked increase in the Na+-independent accumulation of l-[3H]glutamate (Fig. 1) (Schlag et al. 1998). To determine if this accumulation of glutamate might be mediated by a previously identified Cl-dependent activity, the Na+-independent accumulation of l-[3H]glutamate was characterized using a Na+-free buffer that either contained Cl or equimolar gluconate. In both untreated and dbcAMP-treated astrocytes, omission of Cl significantly reduced the levels of Na+-independent l-[3H]glutamate accumulation (Fig. 1). The difference in accumulation observed in the presence and absence of Cl was defined as Cl-dependent activity. The level of this activity was examined in astrocytes treated with dbcAMP for 1, 3 or 10 days (data not shown, n = 2). In these studies, no increase in activity was observed after 1 day of treatment, and 10 days of treatment caused the greatest effect resulting in an 8.2 ± 0.9-fold increase in activity (from Fig. 1, n = 6). Therefore, all further studies were performed using astrocytes that had been treated with dbcAMP for 10 days. The effects of the anion transport inhibitors, DIDS, DNDS and SITS, on this activity were examined in dbcAMP-treated cultures (Fig. 2). All three compounds inhibited the Cl-dependent accumulation of glutamate in a concentration-dependent manner. Both DIDS and DNDS reduced this activity to < 30% of control at 100 µm, whereas 1 mm SITS was required to achieve a similar level of inhibition. None of these compounds had any effect on the Cl-independent accumulation of l-[3H]glutamate (data not shown).

Figure 1.

 The effects of dbcAMP on Cl-dependent/Na+-independent accumulation of l-[3H]glutamate. Astrocytes were prepared and maintained for 14 days in vitro and then treated with dbcAMP (0.25 mm) for 10 days. Control cultures were maintained for 24 days in vitro. Transport assays were performed using a Na+-free buffer (solid bars) and a Na+- and Cl-free buffer (open bars) and at 0.5 µm glutamate. Data are normalized to the Na+-independent activity measured in untreated (control) astrocytes and are the mean ± SEM of six independent observations. Data were compared by anova with Bonferroni post-hoc analysis. **p < 0.01 compared with activity using Na+- and Cl-free buffer in control astrocytes. ***p < 0.001 compared with activity measured using Na+- and Cl-free buffer in dbcAMP-treated astrocytes. #p < 0.001 compared with activity measured using Na+-free buffer in control astrocytes.

Figure 2.

 The effects of anion transport inhibitors on Cl-dependent l-[3H]glutamate transport activity. The transport of l-[3H]glutamate was measured in the absence and presence of 1 µm (open bar), 10 µm (striped bars), 100 µm (dotted bar), 1 mm (solid bar) of SITS, DIDS and DNDS using primary astrocyte-enriched cultures treated with dbcAMP (0.25 mm) for 10 days. Data are expressed as a fraction of the transport activity observed in the absence of the inhibitor and are the mean ± SEM of three or four independent observations. Control uptake for these studies was 16 ± 2 pmol/mg protein/min (n = 5). Data were compared by anova with Bonferroni post-hoc analysis. ***p < 0.001 compared with vehicle control.

These primary cultures contain a small percentage of oligodendroglial precursor cells which are A2B5-positive (Grinspan et al. 1990; Zelenaia et al. 2000). To reduce the likelihood that this small population of cells expressed this activity, these cells were eliminated using an A2B5 antibody and complement-mediated cell lysis. In cultures that were free of these cells, dbcAMP treatment caused an 8.7 ± 0.6-fold increase in Cl-dependent transport activity. This strongly suggests that dbcAMP increases Cl-dependent transport activity in astrocytes.

N6,2′-O-dibutyryladenosine 3′:5′ cyclic monophosphate increases the Vmax for Cl-dependent l-[3H]glutamate transport

The concentration-dependence for this Cl-dependent l-[3H]-glutamate transport activity was examined in astrocytes treated with dbcAMP (0.25 mm) for 10 days. Treatment with dbcAMP increased the Vmax value from 69.0 ± 16 pmol/mg protein/min in untreated astrocytes to 608 ± 70 pmol/mg protein/min (p < 0.001, by Student's unpaired t-test, n = 4). N6,2′-O-dibutyryladenosine 3′:5′ cyclic monophosphate treatment did not significantly change the Km value: 21.7 ± 6.0 µm in untreated cultures and 17.9 ± 3.4 µm in treated cultures (Fig. 3).

Figure 3.

 The concentration dependence of Cl-dependent l-[3H]glutamate transport activity in astrocyte-enriched cultures. Confluent cultures of primary astrocytes were treated with vehicle or dbcAMP (0.25 mm) for 10 days. Chloride-dependent glutamate transport was measured in untreated (control, □) and dbcAMP-treated (●) astrocyte cultures. These data were fit by linear regression analysis of an Eadie-Hofstee transformation. For control astrocytes, the average Km value was 21.7 ± 6.0 µm and the average Vmax value was 69.0 ± 16 pmol/mg protein/min. For dbcAMP-treated astrocytes, the average Km value was 17.9 ± 3.4 µm and the average Vmax value was 608 ± 70 pmol/mg protein/min (p < 0.001 compared with control by Student's unpaired t-test). Data are the mean ± SEM of four independent observations.

Pharmacological properties of astrocytic Cl-dependent transport activity

The sensitivity of this Cl-dependent l-[3H]glutamate transport activity to inhibition by several excitatory amino acid analogs was examined in astrocyte-enriched cultures treated with dbcAMP for 10 days (Fig. 4 and Tables 1 and 2). These compounds included a number of glutamate receptor agonists and antagonists, as well as compounds that inhibit Na+-dependent glutamate transport activity. Compounds were initially tested at concentrations of 10, 100 and 1000 µm. In general, compounds that inhibited activity by < 75% at 1 mm were not tested any further and these results are summarized in Table 2. All other compounds were tested using concentrations that range from at least 10-fold below to 10-fold above the estimated IC50 values. The IC50 values and Hill slopes for these compounds were determined and are summarized in Table 1. None of the data for inhibition appeared consistent with multiple sites; all of the Hill coefficients were 0.81 or above. Although the ionotropic receptor specific agonists kainate and NMDA had essentially no effect on this activity, α-amino-3-hydroxy-5-methylisoxazole-4-propionate and quisqualate both inhibited this activity (Fig. 4 and Tables 1 and 2). Many compounds that have been identified previously as mGluR agonists/antagonists, including (S)-4-carboxyphenylglycine (4CPG), (S)-4-carboxy-3-hydroxyphenylglycine (4C3HPG) and (S)-3-carboxy-4-hydroxyphenylglycine, were potent inhibitors of this transport activity. Of the compounds known to inhibit Na+-dependent glutamate transport, only l-α-aminoadipate, l-serine-O-sulfate (2S,1′S,2′R)-2-(carboxycyclopropyl)glycine and l-cysteate were relatively potent inhibitors of Cl-dependent transport activity. ltrans-Pyrrolidine-2,4-dicarboxylate (ltrans-PDC), dlthreo-βhydroxyaspartate (2S,1′R,2′R)-2-(carboxycyclopropyl)glycine and d-aspartate had little effect on this activity.

Figure 4.

 Inhibition of chloride-dependent l-[3H]glutamate transport by cystine (a) and quisqualate (b). The transport of l-[3H]glutamate (0.5 µm) was measured in the absence and presence of increasing concentrations of inhibitor using primary astrocyte-enriched cultures treated with dbcAMP (0.25 mm) for 10 days. Data are expressed as a fraction of the transport activity observed in the absence of the inhibitor and are the mean ± SEM of four (a) or five (b) independent observations. Control uptake for these studies was 13 ± 1 pmol/mg protein/min (n = 8). Data were fit to a theoretical curve with a Hill coefficient of one.

To determine if 4CPG, 4C3HPG and cystine are competitive inhibitors, the concentration dependence of Cl-dependent l-[3H]glutamate uptake was examined in the absence and presence of inhibitor (Fig. 5). In these studies, two concentrations of inhibitor were used; one approximately equaled the IC50 value and the other equaled approximately three times the IC50 value. In these studies, the inhibitors increased the Km value and had no effect on the maximum velocity (see legend for Fig. 5) and are consistent with a competitive mechanism of inhibition.

Figure 5.

 The concentration-dependence of Cl-dependent l-[3H]glutamate transport measured in the absence and presence of cystine (a), 4CPG (b) or 4C3HPG (c). Activity was measured in the absence of inhibitor (□), in the presence of the IC50 concentration of inhibitor (●) and in the presence of 3× the IC50 concentration of inhibitor (○). These data were fit by linear regression analysis of an Eadie-Hofstee transformation. The Km and Vmax values in the absence of cystine and 4CPG were 13.0 ± 1.8 µm and 768 ± 96 pmol/mg protein/min. In the presence of 10 or 30 µm cystine, the Km value increased to 23.7 ± 1.4 and 64 ± 11 µm, respectively. The Vmax values, in the presence of 10 or 30 µm cystine, were 741 ± 58 and 687 ± 37 pmol/mg protein/min, respectively. In the presence of 2 or 6 µm 4CPG, the Km increased to 29 ± 5 and 107 ± 25 µm, respectively. The Vmax values, in the presence of 2 or 6 µm 4CPG, were 749 ± 91 and 735 ± 80 pmol/mg protein/min, respectively. The Km and Vmax values in the absence of 4C3HPG were 12.2 ± 2.1 µm and 724 ± 81 pmol/mg protein/min. In the presence of 6 or 20 µm 4C3HPG, the Km value increased to 32 ± 6 and 74 ± 12 µm, respectively. The Vmax values, in the presence of 6 or 20 µm 4C3HPG, were 716 ± 106 and 752 ± 82 pmol/mg protein/min, respectively.

N6,2′-O-dibutyryladenosine 3′:5′ cyclic monophosphate increases xCT mRNA expression and CD98 immunoreactivity

Recent studies have suggested that co-expression of 4F2hc (also called CD98) and xCT are required for functional reconstitution of system xc (Sato et al. 1999). Therefore, our goal was to determine if dbcAMP treatment results in increased expression of one or both of these subunits. Because no anti-xCT antibodies are currently available, the levels of mRNA were examined. Northern blot analysis revealed a single band of ≈ 12 kb in both astrocytes and cortical mRNA (Fig. 6a). This is similar to that observed previously in whole brain mRNA (Sato et al. 1999). N6,2′-O-dibutyryladenosine 3′:5′ cyclic monophosphate treatment (0.25 mm for 10 days) resulted in a 2.3 ± 0.5-fold (p < 0.05, n = 4) increase in xCT mRNA expression without significantly changing the expression of cyclophilin (Fig. 6a). The effects of dbcAMP on the levels of 4F2hc/CD98 protein were examined by western blot. This commercially available antibody reacted with a single band in both cortical membrane homogenates and astrocytes with a molecular weight of 85 ± 4 kDa (Fig. 6b). Pre-incubation of the antibody with the peptide used as the antigen abolished this immunoreactive band, providing evidence for the specificity of this immunoreactivity. The level of 4F2hc/CD98 expression in untreated cultures ranged from undetectable to a faint band. On average, the level of expression was 16.5 ± 5.0% of that observed in dbcAMP-treated cultures. Therefore, dbcAMP treatment increased the expression of both xCT and 4F2hc/CD98.

Figure 6.

 dbcAMP increases mRNA expression of xCT (a and d) and protein expression of 4F2hc/CD98 (b, c and e). Confluent astrocyte cultures were treated with 0.25 mm dbcAMP for 10 days in parallel with control cultures. (a) A representative Northern blot using an oligonucleotide probe specific to xCT and a probe specific to cyclophilin. All lanes are derived from the same experiment. Twenty-five micrograms of total RNA was loaded in each lane. Data were normalized to cyclophilin RNA levels and expressed as a ratio of dbcAMP-treated. Representative western blots using an (b) anti-CD98 and an anti-actin antibody; (c) an anti-actin antibody and an anti-CD98 antibody neutralized with a blocking peptide. Fifty micrograms of protein was loaded in each well. Data were calculated as a ratio of protein expression in dbcAMP-treated astrocytes. (d) and (e) data are the mean ± SEM of four independent observations and were compared by anova with Bonferroni post-hoc analysis. *p < 0.05, **p < 0.01 compared with dbcAMP-treated.

System xc is thought to supply cystine for the production of glutathione. Therefore, the intracellular levels of GSH in astrocytes was examined after a 10-day treatment with dbcAMP. Treatment with dbcAMP reduced intracellular GSH content from 79 ± 10 nmol/mg protein in untreated astrocytes to 58 ± 6 nmol/mg protein. This represents a 25 ± 5% reduction (n = 7, p < 0.01).

Discussion

We and others have previously found that dbcAMP increases astrocytic expression of GLT-1 and GLAST (Eng et al. 1997; Swanson et al. 1997; Schlag et al. 1998). This increase in transporter expression is correlated with an increase in Na+-dependent l-[3H]-glutamate transport activity. We also noted an increase in the Na+-independent transport activity that represents < 5% of the Na+-dependent activity. In this study, the properties of this Na+-independent activity were examined. This activity was dependent on extracellular Cl and was inhibited by three different Cl transport blockers. In addition, the activity was inhibited by several compounds that inhibit system xc-mediated transport activity. The sensitivity of this activity to inhibition by several additional compounds was also examined. In these studies, we found that compounds previously identified as mGluR agonists/antagonists are potent inhibitors of this transport activity and that their kinetic properties are consistent with a competitive mechanism of action. The effects of dbcAMP on this activity were related to an increase in the Vmax for this Cl-dependent transport activity and were associated with increased expression of both proteins that have been identified as subunits mediating system xc.

Several different amino acid transport systems were originally differentiated based on their ion dependence and their amino acid selectivity (for review, see Christensen 1990; Verrey et al. 1999). Three high-affinity processes that transport glutamate and/or cystine have been identified; these transporters have been referred to as system b°,+, system XAG and system xc. Although system b°,+ is Na+ independent, it does not transport glutamate and therefore is not likely to represent the system characterized here (for review, see Verrey et al. 1999). System XAG, which represents Na+-dependent aspartate/glutamate transport activity, is inhibited by micromolar concentrations of several compounds that had essentially no effect on the activity characterized here, including d-aspartate, l-aspartate-β-hydroxamate, ltrans-PDC and dlthreo-β-hydroxyaspartate (for review, see Robinson and Dowd 1997). This system also appears to transport cystine (Bender et al. 2000). System xc was originally identified in peripheral tissue preparations and is Na+ independent and Cl dependent (Bannai and Kitamura 1980; Makowske and Christensen 1982; Takada and Bannai 1984; Miura et al. 1992). A process with similar properties has also been observed in C6 glioma (Waniewski and Martin 1983), neuronal cultures (Murphy et al. 1990) and astrocyte cultures (Cho and Bannai 1990; Tsai et al. 1996). Expression of both subunits of system xc in Xenopus oocytes results in an activity with the same properties. In this system, comparable uptake rates are observed for both glutamate and cystine, suggesting that both can be used as a substrate (Sato et al. 1999). As observed here, system xc recognizes both glutamate and cystine and a limited number of other structurally related compounds, including l-homocysteate, l-glutamate, quisqualate, β-N-oxalyl-l-α,β-diaminopropionate and l-α-aminoadipate. Unlike system XAG, this activity is insensitive to inhibition by d-aspartate. Together these studies suggest that dbcAMP increases expression of system xc in astrocytes.

In the 1980s, several groups studied Cl-dependent l-[3H]-glutamate ‘binding’ (for review see Foster and Fagg 1984). This ‘binding’ was frequently characterized with complete dose–response curves and was generally found to be sensitive to inhibition by compounds, including SITS, DITS, quisqualate, ibotenate and l-2-amino-4-phosphonobutyrate (l-AP4). In subsequent studies, several groups developed compelling evidence that this ‘binding’ may actually represent a transport process consistent with system xc (Recasens et al. 1987; Zaczek et al. 1987). Some studies suggest that this ‘binding’ activity may be heterogeneous. For example, an l-aspartate-sensitive and l-AP4-insensitive glutamate ‘binding’ site was identified in astrocytes not treated with dbcAMP (Bridges et al. 1987).

Physiologically, system xc is thought to mediate the stoichiometric exchange of intracellular glutamate for extracellular cystine which, after reduction to cysteine, is used for the synthesis of glutathione (Bannai and Ishii 1982; Christensen 1990). It is generally assumed that this transport process is critical for protection from oxidant insults, partly because the activity of this transporter is regulated bidirectionally by the level of oxidant stress. For example, chronic hypoxia (3% O2) decreases transport activity in fibroblasts and subsequent exposure to normal oxygen restores transporter activity (Bannai et al. 1989). Oxidant injury with either diethylmaleate, an electrophilic agent known to activate cellular antioxidant responses, or H2O2 increases transporter activity (Miura et al. 1992; Sato et al. 1998). In fact, in addition to the widely recognized excitotoxic effects of glutamate that are mediated through excessive activation of receptors, glutamate also causes neuronal cell death by inhibiting cystine uptake via system xcin vitro (Murphy et al. 1990). This toxicity is accompanied by a decrease in cellular glutathione and is blocked by antioxidants such as α-tocopherol. A similar effect of glutamate has been demonstrated in C6 glioma (Mawatari et al. 1996) and is thought to contribute to the l-α-aminoadipate-mediated glial toxicity observed in vivo (Kato et al. 1993). In addition to providing cystine for the synthesis of glutathione, there is some evidence that the operation of this transporter may significantly increase extracellular glutamate under physiologic and pathologic conditions. For example, in cerebellar slices, cystine causes Purkinje cell depolarization by increasing extracellular glutamate through an exchange process (Warr et al. 1999). In addition, a Cl-dependent process may contribute to the ischemia-induced increase in extracellular glutamate (Seki et al. 1999).

System xc also displays many of the characteristics that are observed for a phenomenon that has been termed the ‘quisqualate effect’ or ‘quisqualate priming effect’ (Robinson et al. 1986; Harris et al. 1987). In brain slice preparations, application of quisqualate for a few minutes causes a long-lasting and dramatic increase in the depolarization induced by compounds such as l-AP4. It has been suggested that l-AP4 indirectly depolarizes cells by increasing the release of accumulated quisqualate (Harris et al. 1987). Compounds such as SITS, DIDS, l-α-aminoadipate, l-2-amino-6-phosphonohexanoate, homocysteate and cystine have all been shown to interact with this process (Harris et al. 1987; Whittemore and Koerner 1989; Turner 1993; Ishida and Shinozaki 1999; Chase et al. 2001). To date, the physiological relevance of this effect has not been established, but it is consistent with the notion that this transporter is localized to release glutamate which can activate receptors.

Our characterization of this process revealed that compounds originally identified as agonists/antagonists of mGluRs inhibited this transport process with micromolar affinity, including (1S,3R)-1-aminocyclopenate-1,3-dicarboxylate, 4CPG and 4C3HPG. Examination of the concentration-dependence of Cl-dependent l-[3H]-glutamate uptake in the absence and presence of 4CPG and 4C3HPG indicated that these compounds block uptake through a competitive mechanism of action. While these studies were ongoing, Ye and colleagues reported that these compounds block cystine-induced glutamate release from glioma cell lines, suggesting that these compounds may interact with this transport process (Ye et al. 1999). Together these studies would suggest that these phenylglycine derivatives are competitive non-substrate inhibitors of this transporter. Furthermore, these studies suggest that some of the previously documented neuroprotective effects of these compounds may not be due to interaction with mGluRs but may instead be related to interaction with system xc (for recent review, see Cartmell and Schoepp 2000).

In this study, we also found that the dbcAMP increases the expression of both subunits of system xc (Sato et al. 1999). Although the increase in expression of 4F2hc/CD98 protein was roughly equivalent to the increase in transport activity, the increase in xCT mRNA was only twofold. There are several possible explanations for this difference. First, dbcAMP may increase protein more than mRNA, but this cannot be addressed without an xCT antibody and none are currently available. It is possible that expression of 4F2hc/CD98 protein is limiting relative to xCT in untreated astrocytes. Finally, the increase in activity may be related to both increased expression and alterations in intracellular anion concentrations that could stimulate accumulation of l-[3H]-glutamate by a mechanism that is independent of expression.

The transcription of many genes is regulated through cAMP response elements, but generally this increased expression occurs within hours (for review see Montminy 1997). Therefore, it seems unlikely that the increased expression is a direct effect of transcription. There are two possible indirect mechanisms for upregulation of system xc. First, treatment of astrocytes with dbcAMP causes a morphological change similar to that observed with differentiation and increases expression of several proteins that are observed in mature astrocytes (Pollenz and McCarthy 1986). Therefore, increased expression of system xc may be part of a developmental program that occurs during differentiation. Oxidant injury, such as H2O2 exposure, causes an increase in system xc activity and decreases GSH levels (Bannai 1984; Miura et al. 1992). Although we acknowledge that dbcAMP-treatment may change the ratio of protein to intracellular volume, the levels of GSH were significantly lower in dbcAMP-treated astrocytes than in untreated astrocytes. Therefore, it is possible that dbcAMP accelerates metabolism in the astrocytes and increases the demand for glutathione. Currently, it is not possible to differentiate these possible mechanisms.

In summary, we report that dbcAMP treatment dramatically increases the expression of a Cl-dependent transport process in astrocytes which is consistent with system xc. This increase in activity is associated with increased expression of both subunits required for this transport process. Understanding the mechanisms that regulate this process may provide valuable approaches for limiting brain injury by limiting both the extracellular accumulation of glutamate and oxidant injury.

Acknowledgements

The authors would like to acknowledge the technical assistance of Dana Correale, Brian Schlag and Kurt Angle. In addition, the authors would like to thank Dr Olga Zelenaia for help with the northern analysis. This work was supported by NIH grants NS36465 and NS29868.

Ancillary