SEARCH

SEARCH BY CITATION

Keywords:

  • apomorphine;
  • cDNA expression array;
  • in situ hybridization;
  • N-methyl-4-phenyl-1;
  • 2, 3, 6-tetrahydropyridine;
  • Parkinson's disease;
  • quantitative real-time RT-PCR

Abstract

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References

To establish the possible roles of oxidative stress, inflammatory processes and other unknown mechanisms in neurodegeneration, we investigated brain gene alterations in N-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP) mice model of Parkinson's disease using Atlas mouse cDNA expression array membrane. The expression of 51 different genes involved in oxidative stress, inflammation, glutamate and neurotrophic factors pathways as well as in still undefined processes, such as cell cycle regulators and signal transduction molecules, was differentially affected by the treatment. The present study indicates the involvement of an additional cascade of events that might act in parallel to oxidative stress and inflammation to converge eventually into a common pathway leading to neurodegeneration. The attenuation of these gene changes by R-apomorphine, an iron chelator-radical scavenger drug, supports our previous findings in vivo where R-apomorphine was neuroprotective.

Abbreviations used
A170

oxidative stress-induced protein mRNA

ACE

S-(2-aminoethyl)-l-cysteine

APO

apomorphine

DA

dopamine

DEPC

diethylpyrocarbonate

dNTP

Dig, dioxygenin

deoxy-NTP

 

EGF

epidermal growth factor

GDNF

glial derived neurotrophic factor

HAP1

huntingtin-associated protein 1

I-κB

inhibitory-κB

IL

interleukin

iNOS

inducible nitric oxide synthase

M-MLV

molney murine leukemia virus reverse transcriptase

MPTP

N-methyl-4-phenyl-1,2,3,6-tetrahydropyridine

NF-κB

nuclear factor-kappa B

NGF

nerve growth factor

6-OHDA

6-hydroxydopamine

OS

oxidative stress

PCR

polymerase chain reaction

PD

Parkinson's disease

ROS

reactive oxygen species

RT

reverse transcription

SSC

saline sodium citrate buffer

SN

substantia nigra

SNPC

substantia nigra pars compacta

TGF

transforming growth factor

TH

tyrosine hydroxylase

TNF

tumor necrosis factor.

Parkinson's disease (PD) is a progressive neurodegenerative disorder that results in degeneration of nigro-striatal dopamine neurons with the deficiency of dopamine in the striatum (Bernheimer et al. 1973). The causes and mechanism for the degeneration of dopaminergic neurons is still elusive. There have been numerous hypotheses concerning the etiology of PD, including genetic aberrations, involvement of endogenous and exogenous derived neurotoxins and initiation of oxidative stress (OS) as a consequence of accumulation of reactive oxygen species (ROS). However, in majority of idiopathic PD the role of OS has gained support mainly because the neurochemical changes that have been observed occur specifically in substantia nigra pars compacta (SNPC) and not in substantia nigra (SN) pars reticulata, where melanin containing dopamine (DA) neurons degenerate. The neurochemical lesions in SNPC are accompanied by a progressive accumulation of iron and ferritin within reactive microglia and melanin containing dopamine neurons (Jellinger et al. 1990). It is thought that the chelatable iron has a pivotal role in the process of neurodegeneration and participates in the Fenton reaction with hydrogen peroxide to generate the most reactive of all ROS, namely the hydroxyl radical (Youdim et al. 1999). Support for OS in dopaminergic neurodegeneration has come from animal studies with the use of neurotoxins 6-hydroxydopamine (6-OHDA) and N-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP) (Gerlach and Riederer 1996). Both neurotoxins are considered relevant models of the disease and are thought to induce neurodegeneration via OS, since iron chelators (e.g. desferrioxamine and apomorphine) and radical scavengers (vitamin E and α-lipoic acid) pretreatment induces neuroprotection against the two neurotoxins (Olanow 1996; Grünblatt et al. 1999). Post mortem human PD brain and animal studies revealed that dopaminergic neurodegeneration might constitute a cascade of events, including OS, leading to demise of the neurons.

The major problem concerning a better therapeutic approach to the treatment, neuroprotection and prevention of the disease, is the enigma of its underlying cause. Knowledge of highly selective gene expression, as well as sequence homology to a known gene family, can provide a convenient shortcut for implicating a target in a given pathway of disease. The advent of cDNA microarrays provided a potential tool for gene expression profiling analysis. The most attractive application of cDNAs microarrays is in the study of differential gene expression in disease and animal models (Debouck and Goodfellow 1999). Detailed profiling of gene expression in the MPTP Parkinson model may yield additional insight into cellular, animal and human physiology, which is critical to the discovery and validation of therapeutic targets. Since OS has been implicated in a number of neurodegenerative diseases (Alzheimer's disease, Huntington chorea, amyotrophic lateral sclerosis and PD), the knowledge of the specific cascades of events leading and causing the neurodegeneration will be the key factor in developing and using neuroprotective drugs.

In the present study, we applied a cDNA array including 1200 gene fragments for comparing gene expression in brains of control and MPTP treated mice. The results were then compared with those of quantitative reverse-transcription polymerase chain reaction (RT-PCR) and in situ hybridization, and the effects of R-apomorphine (R-APO), a neuroprotective drug, was explored. The data show that alterations of gene expression detected by means of cDNA array, display a relatively high reliability and that they all implicate to a highly structured cascade of events involving not only OS, inflammation and glutamate toxicity but also cell cycle and signal transduction pathways. Monitoring differential gene expression profile provides a better insight for understanding the molecular mechanism of neurodegeneration and protection by neuroprotective drugs, such as R-APO.

Materials and methods

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References

Materials

The R-APO, MPTP, DNase, monoclonal anti-tyrosine hydroxylase mouse ascite fluid antibody, horseradish peroxidase conjugated antibodies against mouse Fab, and Tri ReagentTM Isolation reagent were purchased from Sigma Chemical Co. (St Louis, MO, USA). S-APO was purchased from ICN Pharmaceuticals Inc. (Costa Mesa, CA, USA). The mRNA Isolation Kit and Dig-RNA labeling kit were purchased from Boehringer Mannheim GmbH, Mannheim, Germany. The AtlasTM Mouse cDNA Expression Array was purchased from Clontech, Palo Alto, CA, USA. RT reaction mix, random hexanucleotides, dNTP, RNasin inhibitor and M-MLV reverse transcriptase were purchased from Promega, Madison, WI, USA. The LightCycler, DNA Master SYBR Green I ready-to use PCR mix kit and FastStart (Hot Start) DNA Master SYBR Green I ready-to use PCR mix kit were purchased from Roche Diagnostics (Mannheim, Germany). The Histostain-SPTM kit for immunohistochemical staining was purchased from Zymed laboratories Inc. (San Francisco, CA, USA). Other chemicals and reagents were of the highest analytical grade and were purchased from local commercial sources.

Animals and treatment

All procedures were in accordance with the NIH Guide for the Care and Use of Laboratory Animals and were approved by the Technion Animal Ethics committee, Haifa, Israel. Male C57-BL mice (weighing 20–30 g; Harlan, Jerusalem, Israel) were housed 6–10 animals per cage in a colony room maintained at constant temperature and humidity with a 12-h light/dark cycle. Mice were handled daily and allowed at least 3 days to acclimate before any treatment. Mice were injected (subcutaneously) with saline, R-APO (10 mg/kg per day) or S-APO (1 mg/kg per day) before MPTP (24 mg/kg per day) injections, for 5 days. Control animals received saline, R-APO or S-APO. The animals were decapitated 3 days after the last injection. Brains were dissected on an ice-chilled glass plate and quickly frozen in liquid nitrogen. For immunohistochemistry and in situ hybridization, the whole brains were fixated in NBF (32 mmol/L NaH2PO4, 58 mmol/L Na2HPO4, 3.5 mL/L formaldehyde).

Total RNA extraction and mRNA isolation

Isolation of total RNA was performed using Tri ReagentTM Isolation reagent. Because of the inherent difficulties in dissecting out the substantia nigra (SN) of mice, freshly isolated brain tissues were dissected at the level of chiasma optic nerve (which removed most of the striatum and whole frontal cortex) and the level of cerebellum (with brain stem and cerebellum removed) leaving part of the striatum and the whole of the SN, with most of the hippocampus discarded, and were immediately frozen in liquid nitrogen. Using a pestle and mortar prechilled with liquid nitrogen, frozen tissues were ground into fine powder. Special care was taken not to allow the tissues to thaw. Ground tissues were then transferred into Tri ReagentTM (1 mL/50–100 mg tissue), and homogenized in glass-Teflon homogenizer. The samples were further processed as indicated in the manual. The RNA pellet was resuspended in 50–200 µL of diethylpyrocarbonate (DEPC)-treated RNase-free water, and incubated for 10–15 min at 55–60°C. Total RNA was stored at − 70°C until use.

For cDNA expression array hybridization, total RNA was treated with DNase before isolation of the mRNA (mRNA Isolation Kit).

AtlasTM mouse cDNA expression array

We used the Atlas mouse cDNA expression array with 1200 mouse cDNAs spotted on a nylon membrane. Four identical membranes were used in parallel, in order to receive the expression profiles of four mRNA populations (MPTP, R-APO and combination of MPTP and R-APO treated mice compared with control). The hybridization pattern was quantified by phosphor imaging followed by AtlasImageTM 1.0 program (Clontech) analysis. The relative expression level of a given cDNA was assessed by comparing the signal obtained in one membrane (after normalizing to the global value of all the genes provided on the membranes) relative to a second membrane.

Reverse transcription (RT)

In order to confirm the results obtained with the atlas cDNA expression array, 2 µg of total RNA were denatured and reverse transcribed using random hexanucleotides (0.5 µg/µL). Secondary structures of the template and primer (total volume of 16 µL) were opened by incubation for 5 min at 70°C and immediately cooled on ice. Nine microliters of mix reaction containing reaction buffer, dNTP (0.5 mm each), RNasin inhibitor (25 U) and M-MLV reverse transcriptase (200 U) was added and samples were incubated at 39°C for 1 h. For every RNA preparation a negative control was run in parallel consisting of a direct amplification of the RNA sample, omitting the RT step. The samples were transferred to 92°C for 10 min in order to deactivate the enzyme and then cooled to 4°C.

RT-PCR

cDNA (40–80 ng) was amplified in a 50-µL PCR reaction mixture with specific primers for interleukin-1 receptor (IL-1 R), nuclear factor-kappa B (NF-κB) P65, NF-κB P105, glial-derived neurotrophic factor (GDNF), epidermal growth factor (EGF), oxidative stress-induced protein mRNA (A170), tyrosine hydroxylase (TH), cyclophyline and for β-actin cDNAs (Table 1). The amplified products were visualized on an ethidium bromide strained agarose gel. The results were analyzed by the densitometry program Bio-Profil (Vilber Laurmat, France).

Table 1.   Primer sequences and PCR conditions for semiquantification
mRNA Oligonucleotide sequence (5′−3′)Denaturing temperature and time (°C, s)Annealing temperature and time (°C, s)Elongation temperature and time (°C, s)CyclesProduct size (bp)
  1. All templates were initially denatured for 3 min at 94°C and the amplicon was extended at a final extension temperature for 72° for 10 min.

IL-1 R type IIFTATCATCCTCACGGCTACAAT93 (30)60 (90)72 (90)30844
RTTCTCTTCCCAATCCAGCTCC     
NF-κB P65FATCAATGGCTACACAGGA93 (30)54 (90)72 (90)30503
RCCCGTGAAATACACCTCA     
NF-κB P105FCAGAGCCCTTGTAACTGGAGT93 (30)60 (90)72 (90)29429
RGTCCTGCTGTTACGGTGCATA     
GDNFFGATATTGCAGCGGTTCCT93 (30)54 (90)72 (90)32199
RCCACACCGTTTAGCGGAA     
EGFFAACACCCCTGGATCCTAT93 (30)54 (90)72 (90)31452
RTCCACAGGGTCATAATCC     
A170FGGTTGCCTTTTCCAGTGATGA93 (30)60 (90)72 (30)27459
RGCAGAAGCTGACTCAGCTGTA     
THFGCTTCAGAAGAGCCGTCTCAG93 (30)60 (90)72 (30)28608
RCTTGTATTGGAAGGCAATCTC     
CyclophilinFCCATCGTGTCATCAAGGACTTCAT93 (30)65 (90)72 (45)25216
RTTGCCATCCAGCCAGGAGGTCT     
β-actinFTGACGGGGTCACCCACACTGTGCCCATCTA93 (30)60 (45)72 (30)20660
RCTAGAAGCATTGCGGTGGACGATGGAGGG     

Quantitative real-time RT-PCR

Real-time quantitative PCR using LightCycler and DNA Master SYBR Green I or the FastStart (Hot Start) DNA Master SYBR Green I ready-to use PCR mix kits was performed according to the manufacturer's protocol. cDNA (40 ng) was amplified in 20 µL total volume. For standards curves purified amplicons were used. The sequences of the primers, the experimental conditions and the melting temperature of the products are given in Table 2. The results are analyzed in real-time on the provided program of the LightCycler.

Table 2.   Primer sequences and PCR conditions for quantitative real-time PCR
mRNA Oligonucleotide sequence (5′−3′)Denaturing temperature and time (°C, s)Annealing temperature and time (°C, s)Elongation temperature and time (°C, s)Acquisition temperature (°C)Product Tm (°C)
  1. All templates were initially denatured for 30 s at 95°C. *When using the FastStart DNA Master SYBR Green I denaturation was done for 3 min. Amplification was done for 55 cycles. In order to receive meting temperatures of the products, melting curve analysis was done by continuous acquisition from 65°C to 95°C with temperature transition rate of 0.1°C/sec.

G2/M-specific cyclin B2*FGGTCCAAGTCCATTCCAAGTT95(15)58(10)72(25)8488
RCGGTGTCATTGACTTTCACA     
A170FGGTTGCCTTTTCCAGTGATGA95(1)60(10)72(20)8791
RGCAGAAGCTGACTCAGCTGTA     
Plasma glutathione peroxidase precursor*FTGTGTCTGAACCACTGTGGAC95(15)58(65)72(25)8590.9
RAGATGGGGGTGTTGAGATACC     
Glutathione reductase*FGGAAAAAGTTTACCGCTCCAC95(15)58(10)72(30)8690
RTAAACGCCTTTGACGTTGGTA     
Glutathione-S-transferase A*FAAGCCCGTGCTTCACTACTT95(15)58(10)72(25)8486.9
RGCAGGCAAGTAACGGTTTTT     
NADPH-cytochrome P450 reductaseFCGACAACGCGCAGGACTTCTA95(1)60(10)72(20)8489.9
RAGGAATGGATTCTTGGCATCG     
INOS*FTCCCAAGTACGAGTGGTTCC95(15)58(10)72(25)8389.5
RGACCTTTCGCATTAGCATGG     
AMPA 1*FTATGAGGGCTACTGCGTGGAA95(15)60(10)72(20)8689
RTAAGGACTGAAACGGCTGACC     
NMDA2AFGAGCCCAGCTTCCACTTAGAT95(1)59(10)72(25)8287
RGAGAGGGCCTGCTAAGGTCTA     
IL-1β*FAAATGCCACCTTTTGACAGTG95(20)58(10)72(25)8487
RGCCGTCTTTCATTACACAGGA     
IL-10*FTGGAGCAGGTGAAGAGTGATT95(15)58(10)72(25)8486
RGAGCTCTGAACTCAGGGATGA     
Parkin*FCAAACAAGCAACCCTCACCT95(15)58(10)72(30)8589.7
RTTACAGTCCCGGCAGAAAAC     
β-actin*FTGACGGGGTCACCCACACTGTGCCCATCTA95(15)58(10)72(30)8689
RCTAGAAGCATTGCGGTGGACGATGGAGGG     

Immunohistochemistry for TH

In order to confine to the SN, paraffin sections were reacted for 2 h at room temperature with specific antibody against mouse TH (Mori et al. 1988). In addition, MPTP-treated mice brain sections were analyzed for TH immunoreactivity as an index of the extent of dopaminergic neurodegeneration. Detection was done by appropriate biotinylated second antibody with streptavidin–peroxidase conjugate and S-(2-aminoethyl)-l-cysteine (AEC) as substrate. Counterstaining was done using hematoxylin.

In situ hybridization

Paraffin sections (6 µm) were loaded on precleaned poly l-lysine coated slides, deparaffinized with xylene, hydrated with graduated ethanols, and treated with 3 mL/L hydrogen peroxide in methanol to neutralize endogenous peroxidase. Sections were then treated for 15 min with 12.5 µg/mL proteinase K, rinsed with 2 mg/mL glycine, and acetylated in 0.5 mL/L acetic anhydride (in 0.1 m Tris buffer, pH 8.0). Sections were post fixated in 4 mL/L paraformaldehyde (in PBS) and prehybridized for 10 min in 2 × saline sodium citrate buffer (SSC) followed by 1 h in hybridization buffer: 4 × SSC, 50 mL/L formamide, 1 × Denhardt's solution, 0.5 ng/mL Salmon Sperm DNA. Hybridization was carried out over night (18 h) at 42°C in maximal humidity with 5 ng/µL dioxygenin (Dig)-labeled anti-sense probe (see below). At the end of the incubation period, slides were rinsed with SSC at increasing stringency conditions and then with 0.1 m Tris-HCl, 0.15 m NaCl, pH 7.5. Hybrids were detected using anti(Dig) antibodies conjugated with peroxidase and AEC as a substrate and counterstained with hematoxylin. As negative controls we used sections from the highly expected positive tissue reacted with the same concentration of Dig-labeled sense probes.

Dig-labeled anti-sense RNA probes for in situ hybridization

We used probes for mouse hGDNF(tr) cloned in pBluescript II SK+, for mouse cyclin B2 cloned in pBluescript SK– (received from C. Akazawa and D. J. Wolgemuth, respectively), and for mouse tumor necrosis factor α (TNFα)-induced protein cloned in pT7T3D-Pac (ATCC 1827805). After linearization, anti-sense RNA was transcribed using Dig-RNA labeling kit, following the company's instructions.

Statistics

One-way analysis of variance (anova), followed by the Tukey test was performed using InStatTM (Version 2.04; GraphPadSoftware Inc., San Diego, CA, USA) in order to evaluate the effects of different drugs. p-values of less than 0.05 were considered significant.

GeneBank accession numbers

X03765 β-actin; M60456 cyclophylin.

Results

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References

Analysis of differential gene expression by cDNA array hybridization

A set of 1200 mouse cDNAs fragments of genes coding for proteins of different functional classes, arrayed on nylon membranes, was used for hybridization. Chronic 5-day treatment with MPTP (24 mg/kg), R-APO (10 mg/kg), or a combination of the two, differentially affected the expression of prominent genes. The data were analyzed and represented graphically (Fig. 1). The adjusted intensities from control or MPTP were plotted against the adjusted intensities of MPTP, R-APO or the combination of R-APO and MPTP treatment. The middle diagonal line serves as reference to compare the degree of induction or repression of gene expression. Genes, which displayed the greatest changes lay furthers from the two dashed lines. Fifty-one of 1200 genes whose expression was altered by the treatments, were divided into eight major functional groups as described in Table 3. The results are expressed as changes in gene expression. The alterations in mRNA expression for each gene were determined by two parameters, including the ratio of signal intensities of treatment vs. control and/or the difference between them. This provided a more accurate method for evaluating significant gene changes. This procedure also eliminates artifact problems when gene signal intensity is at background level and therefore the ratio cannot be determined. A substantial inhibition of the inhibitory-κB (I-κB) subunit mRNA, which holds a pivotal role in the activation of NF-κB, was observed after MPTP chronic treatment. MPTP also lowered the expression of cytochrome P450 1A1 (involved in detoxification), TH (the rate limiting enzyme for DA metabolism), Osp94 (a heat shock and osmotic stress protein) and cyclin B2 (a G2/M specific cell cycle regulator) mRNAs, while pretreatment with APO reversed these effects. In addition, MPTP treatment up-regulated the expression of several other genes, among them are NF-κB P105 (precursor of NF-κB p50 subunit), GDNF, IL-1β, an inflammatory protein and A170 of unknown function.

image

Figure 1.  Scatter plot representation of the gene expression in control vs. MPTP (a), control vs. APO (b), control vs. APO + MPTP (c) and MPTP vs. APO + MPTP (d). The values of the control, MPTP (24 mg/kg), R-APO (10 mg/kg) and the combination of R-APO and MPTP hybridization adjusted intensities (signal intensity minus background) were plotted directly onto the plot. The three lines in the scatter plot are guides for comparing the relative expression of the two data sets. The center line indicates equivalent expression. The upper and lower dashed lines mark a 1.4-fold increase or decrease, respectively. Genes which displayed the greatest changes lay further from the two dashed lines. The results are a representative experiment, each group consisting of 5–8 pooled brain total RNA that was repeated twice.

Download figure to PowerPoint

Table 3.   Differential gene expression analysis identified by the Atlas mouse cDNA arrays
GeneBank accession numberName of protein/geneMPTP versus control (change)R-APO versus control (change)R-APO + MPTP versus control (change)
  1. Differential gene expression caused by chronic treatment of MPTP, R-apomorphine or combination identified using the Atlas mouse cDNA expression array. The difference threshold was set as ± 1600, and ratio was set as 1.4 and 0.7. n/c, not changed; Up, up-regulated; Down, down-regulated. The results are representative of two separate experiments, each consisting of 5–8 pooled brain samples.

Cell cycle regulators    
X64713G2/mitotic-specific cyclin B1n/cDownn/c
X66032G2/M-specific cyclin B2Downn/cn/c
U62638Cyclin C (G1-specific)n/cDownDown
Z47766Cyclin F (S/G2/M-specific)n/cUpn/c
Z37110G2/M-specific cyclin G (CCNG)DownUpUp
U43918Proliferation-associated protein 1DownUpn/c
Stress response proteins    
D49482Osp94 osmotic stress proteinn/cUpn/c
U40930Oxidative stress-induced protein mRNA (A170)UpDownDown
M10021cytochrome P450 1A1DownUpn/c
D17571NADPH-cytochrome P450 reductasen/cn/cUp
U13705Plasma glutathione peroxidase precursorn/cDownDown
X76341Glutathione reductaseDownn/cDown
J03958Glutathione S-transferase ADownDownDown
J04696Glutathione S-transferase 5n/cn/cDown
Transcription factors    
U36277I-κB alpha subunitDownUpUp
M61909NF-κB transcription factor p65 subunit (NF-κB p65)DownDownDown
M57999NF-κB p105 subunit (NF-κB p105)UpDownDown
M21531Calbindin-28Kn/cUpn/c
M87039Inducible nitric oxide synthase (iNOS)Upn/cUp
Apoptosis proteins    
U59463Caspase-11n/cn/cUp
D28492Caspase-2n/cUpUp
U67321Caspase-7n/cUpn/c
L28095Interleukin-converting enzyme (ICE)n/cUpn/c
L22472BAX membrane isoform alphaUpUpUp
U43900STAM (signal transducing adaptor molecule)UpUpn/c
Receptors    
M74294Interleukin 1 (IL-1) receptor antagonistn/cUpUp
M20658Interleukin-1 receptorUpUpUp
X59769IL-1 receptor type IIUpn/cUp
L20048IL-2 receptor gammaUpn/cUp
M29855IL-3 receptorUpn/cn/c
M27959IL-4 receptor αUpn/cUp
L12120IL-10 receptorUpn/cn/c
X57349Transferrin receptor proteinn/cDownDown
U19880Dopamine receptor 4Upn/cUp
X57497Glutamate receptor; ionotropic AMPA 1n/cn/cUp
D10217Glutamate receptor; ionotropic NMDA2An/cDownDown
D10651Glutamate receptor; ionotropic NMDA2BUpDownDown
M14537Nicotinic acetylcholine receptorUpn/cDown
Growth factors, cytokines and chemokines    
J00380Epidermal growth factor (EGF)n/cUpUp
D49921Glial cell line-derived neurotrophic factor (GDNF)UpUpn/c
M114347S nerve growth factor α subunit (α-NGF)Upn/cn/c
M16819Tumor necrosis factor β (TNFβ)Upn/cUp
U19463TNFα-induced proteinn/cUpUp
Interleukins    
M15131IL-1βUpn/cUp
X06203IL-6Upn/cn/c
X07962IL-7UpDownDown
M37897IL-10Upn/cUp
Others    
L04662Sodium- and chloride-dependent GABA transporter 3Upn/cDown
M69200Tyrosine 3-hydroxylase (TH)DownDownDown
AJ000262Huntingtin-associated protein 1n/cDownDown
AF007560Presenilin-1Downn/cDown

Gene-specific RT-PCR analysis

The initial gene expression changes obtained from cDNA hybridization studies were further verified by semiquantitative RT-PCR, quantitative real-time RT-PCR and in situ hybridization techniques. The RT-PCR consisted of RNA samples isolated from chronic five days MPTP or R-APO treated mice brains and or from the combination of the two. Each gene was normalized towards its actin content. The lightcycler PCR for actin shows a single product indicating that no false amplification occurred (Fig. 2). Even if a minimal change in a single base pair had occurred, we would have expected additional peaks. In addition, there was no interference between the peak of the primer dimmers and that of actin since the reading acquisition was performed at a temperature between the melting point of the primer dimmers (84.5°C) and that of the product (89.5°C). The expressions of 18 genes were analyzed for their respective abundance. As shown in Table 4, the MPTP-induced expression profile of IL-1 R type II, IL-10, IL-1β, NF-κB P65, NF-κB p105, TH, GDNF, NMDA2A and glutathione-S-transferase A mRNAs was similar to that obtained after cDNA microarrays hybridization. The combined treatment of R-APO and MPTP reversed the effect of MPTP alone on the expression of most genes analyzed, confirming the results obtained from the microarray.

image

Figure 2.  Melting curve of actin-specific LightCycler-based PCR. The negative derivative of the SYBR green fluorescence with respect to temperature (– dF/dT) was plotted against temperature. Analysis conditions are as described in Table 2. Reading acquisition of actin-specific PCR product was performed at 86°C and the reading measurements at a melting temperature (Tm) of 89°C, as monitored by SYBR green dissociation. At this temperature the primer dimmers are already melted (Tm 84.5).

Download figure to PowerPoint

Table 4.   Differential gene expression in five days MPTP treated mice as measured by quantitative real-time RT-PCR
Name of protein/geneControlMPTPR-APOR-APO + MPTP
  1. The amount of each mRNA was obtained by quantitative real-time RT-PCR. The amount of each product was normalized to the housekeeping gene, β-actin. Control was set arbitrary as one. *Amplified products were visualized on ethidium bromide stained agarose gel and semiquantified by densitometry. The results are representative of two separate experiments, each consisting of 5–8 pooled brain samples in triplicates. anova: ap < 0.05, bp < 0.01, cp < 0.001 vs. control; dp < 0.05, ep < 0.001 vs. MPTP (n = 3–9).

G2/M-specific cyclin B21.00 ± 0.0381.47 ± 0.137a1.24 ± 0.0821.97 ± 0.108c
A1701.00 ± 0.2690.90 ± 0.1980.62 ± 0.1790.74 ± 0.225
Plasma glutathione peroxidase precursor1.00 ± 0.0440.61 ± 0.108a0.69 ± 0.2980.60 ± 0.119a
Glutathione reductase1.00 ± 0.1670.97 ± 0.1520.95 ± 0.1410.72 ± 0.119
Glutathione S-transferase A1.00 ± 0.0100.74 ± 0.083a0.63 ± 0.2660.75 ± 0.044a
NADPH-cytochrome P450 reductase1.00 ± 0.0520.61 ± 0.026b0.78 ± 0.067a0.78 ± 0.340
NF-κB P65*1.00 ± 0.070.75 ± 0.06a0.73 ± 0.07a0.85 ± 0.08
NF-κB P105*1.00 ± 0.121.23 ± 0.121.05 ± 0.121.06 ± 0.12
iNOS1.00 ± 0.1820.78 ± 0.1040.90 ± 0.0810.76 ± 0.203
AMPA 11.00 ± 0.1100.96 ± 0.1200.78 ± 0.1180.86 ± 0.265
NMDA2A1.00 ± 0.1730.97 ± 0.1300.85 ± 0.2060.44 ± 0.123a
GDNF*1.00 ± 0.091.59 ± 0.14b0.70 ± 0.08e1.23 ± 0.14
EGF*1.00 ± 0.211.47 ± 0.230.90 ± 0.160.94 ± 0.17
IL-1 R type II*1.00 ± 0.081.43 ± 0.11a0.66 ± 0.06e1.27 ± 0.11
IL-1β1.00 ± 0.1671.45 ± 0.3580.57 ± 0.1310.59 ± 0.207
IL-101.00 ± 0.1516.81 ± 2.039b1.83 ± 0.804d2.49 ± 0.622
TH*1.00 ± 0.080.49 ± 0.05c0.53 ± 0.06c0.64 ± 0.06b
Parkin1.00 ± 0.0530.95 ± 0.0610.94 ± 0.0751.01 ± 0.045

In situ hybridization analysis

We further analyzed the expression of three different mRNAs, GDNF, cyclin B2 and TNFα-induced protein, in response to the different treatments by in situ hybridization to brain sections using gene specific anti-sense probes. Sense probes were synthesized and served as negative controls. Only cDNA fragments whose respective RNA sense probes did not show any signal after hybridization in parallel brain sections, were used. In parallel, adjacent sections were examined for reduction in striatal TH-positive immunostaining, as markers for degeneration of dopaminergic neurons, in the SN (data not shown). GDNF expression was intensely elevated in the chronic 5-day MPTP treatment (Fig. 3). Both enantiomers of APO (R and S, 10 and 1 mg/kg, respectively) reversed this effect. The expression of cyclin B2 seems to decrease in hippocampus as a result of MPTP treatment, whereas an increased expression was found in SN. Pre-treatment with R- and S-APO returned mRNAs expression to control levels (Fig. 3). TNFα-induced protein mRNA expression had also shown elevation as a result of MPTP treatment, while S-APO returned its expression to control levels (Fig. 3). Surprisingly, R-APO not only reversed the effect of MPTP treatment but also decreased TNFα-induced protein mRNA to levels below control.

image

Figure 3. In situ hybridization analysis in SN and hippocampus with probes for GDNF, cyclin B2 and TNFα-induced protein. In situ hybridization was preformed in paraffin-embedded brain tissue as described in methods. Brain slices from control (a, e, m and i), chronic five days MPTP (24 mg/kg; b, f and j), combination of R-APO (10 mg/kg) with MPTP (e, g and k) and combination of S-APO (1 mg/kg) with MPTP treated mice (d, h and l) were hybridized with RNA probes for GDNF (a–d), cyclin B2 (e–h) and TNFα-induced protein (i–l). As negative control RNA sense probe (m) was used. Hippocampal (upper left of each picture) and SN neurons were visualized and documented. Scale bar 525 µm (hippocampus), 15 µm (SN) and 35 µm (m).

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References

The technique of cDNA expression array is being extensively used to study global changes in gene expression in disease, model systems and in response to drug treatment (DeRisi et al. 1996; Heller et al. 1997; Gray et al. 1998; Marton et al. 1998; Backert et al. 1999; Lee et al. 1999). This may lead to a better understanding of disease pathology and development of more specific and effective drugs. In the present work, we have used this technique for the first time to examine differential gene expression in a model of PD using the Parkinson-inducing neurotoxin, MPTP and neuroprotective drugs, R- and S-APO. Our objective was to gain an insight to the processes involved in dopaminergic neurodegeneration, which is not fully established by biochemical means and to determine gene expression in response to dopaminergic neuroprotective drugs (e.g. R-APO, Gassen et al. 1996; Grünblatt et al. 1999). In addition to understanding the pathways causing cell death it may help to develop other neuroprotective drugs and strategies.

There have been a number of reports indicating that in idiopathic PD, as well as in 6-OHDA and MPTP models, OS may have a role in the mechanism of DA neuron degeneration. Although increased inflammatory and glutaminergic excitotoxicity have also been implicated, by no means they have been established in vivo. We have identified 51 major gene changes in the brains of MPTP-mice model of PD. In addition pretreatment with R-APO reversed most of the alterations. The present gene expression analysis has clearly indicated that the process of dopaminergic neurodegeneration is a complex cascade of events that simple OS cannot explain. In addition to OS, glutaminergic-excitatory, nitric oxide mediated and inflammatory processes reported to be involved in the process of neurodegeneration, we also identified other novel genes as growth factors, cell cycle regulators as cyclin B2 and cytochrome P450 who may also be involved in the process of neuronal cell death (Fig. 4).

image

Figure 4.  Current hypothesis for neurodegeneration cascade of events in the MPTP model of PD. The dashed lines represent potential targets for neuroprotection.

Download figure to PowerPoint

The general increase in interleukin (IL)-1β, IL-6, and IL-7, as well as in IL-1R, IL-2R, IL-3R and IL-4R induced by MPTP, confirms the concept of inflammation in neurodegeneration (Mogi et al. 1996, 1998; Bessler et al. 1999). Indeed, in PD and MPTP models there is a proliferation of reactive microglia around and on top of dying dopamine neurons (Jellinger et al. 1990), suggesting an on-going microglia-induced inflammatory process. In line with these findings, pretreatment with R-APO attenuated the elevation in most of those genes in the mouse model. The increase of the anti-inflammatory cytokine, IL-10 mRNA by MPTP might reflect an attempt to protect the neurons from degeneration. The evidence for OS includes the noted increase in chelatable-iron levels in microglia and nigrostriatal DA neurons (Jellinger et al. 1990) that may lead to activation of the redox and iron-sensitive NF-κB (Schreck et al. 1991; Youdim et al. 1999). Increased iron in macrophages and microglia, as seen in PD (Jellinger et al. 1990), may lead to iron dependent activation of NF-κB and gene regulation of IL-1β, IL-6 and TNFα (Lin et al. 1997; Bowie and O'Neill 2000). Indeed, a 70-fold increase in immunoreactive NF-κB in the nucleus of melanized dopaminergic neurons of PD patients was recently reported (Hunot et al. 1997). In the present study, the precursor of the NF-κB p50 subunit, NF-κB p105, mRNA expression was increased as a consequence of chronic MPTP treatment, whereas pretreatment of animals with R-APO prevented this effect. Inversely, inhibitor-κB (I-κB) was decreased by MPTP and increased upon pretreatment with R-APO, indicating a tight regulation of both proteins in neurodegeneration. Antioxidant and specifically iron chelators were found to be potent inactivators of NF-κB (Schreck et al. 1991; Lin et al. 1997; Youdim et al. 1999), suggesting a pivotal role for iron in NF-κB activation. Thus, the reversal in MPTP-induced NF-κB and I-κB mRNA expression pattern by R-APO could be assigned to its antioxidant and iron chelating properties (Gassen et al. 1996).

Stimulation of NMDA receptor results in calcium influx into the neuron, resulting in activation of NOS to form NO, which is released in bursts (Garthwaite et al. 1989). It has been established that MPP+ releases glutamate (Carboni et al. 1990) and that this may be associated with nigral cell death. In the present work we have shown for the first time decreased gene expression of NMDA2B receptors by R-APO pretreatment, while no changes occurred in the expression of AMPA-1 receptor and iNOS mRNA by MPTP or R-APO treatments. The fact that R-APO pretreatment decreased only NMDA receptor mRNA expression, without affecting expression of the AMPA1 receptor, suggests a mechanism of action through NMDA, and of no intervention by an AMPA receptor.

The increased expression of neurotrophic factors may reflect a compensatory mechanism by stimulating the sprouting of the surviving neurons. GDNF and EGF have been shown to exert growth-promoting and survival effects on dopaminergic neurons (Hadjiconstantinou et al. 1991; Lin et al. 1993). In the present study, an extensive increase of GDNF mRNA was observed in SN and the hippocampus in response to acute and chronic MPTP administration. Nonetheless, in post mortem analysis of PD patients, GDNF mRNA expression was undetectable (Hunot et al. 1996). This result may be explained by the regenerative properties of nigro-striatal dopamine system in rodents and non-human primates models of PD (Gash et al. 1998). Both enantiomers of APO prevented the increase of GDNF. TNFα-induced protein, a novel gene recently found to be expressed in human endothelial cells in response to the inflammatory cytotoxic cytokine TNFα (Liberatore et al. 1999), was detected in SN, hippocampal and cortical neurons as a result of MPTP treatment. However, R- and S-APO pretreatment completely abolished its expression, further supporting the notion for the involvement of inflammatory process and OS in neurodegeneration. It is possible that the increased expression of TNFα-induced protein activates NF-κB, which in turn induces iNOS and cytotoxic cytokines gene expression leading to neurodegeneration (Swift et al. 1998). R-APO may act as a chain breaker by chelating the iron and scavenging ROS, thus preventing NF-κB activation.

A decrease in several mRNAs coding for different cyclins (Table 3) was also observed as a consequence of MPTP treatment. At present we cannot draw any conclusions regarding the role the group of cyclins have in neurodegeneration, since their expressions have not been examined in idiopathic PD. Nevertheless, cell cycle arrest may be related to the inflammatory processes occurring in PD and in MPTP model of PD, which results in increased neurotrophic factors (Mogi et al. 1996, 1998; Bessler et al. 1999), as also observed in our work. Exposure of human monocytes to transforming growth factor-β (TGF-β) causes cell cycle arrest in G1/S phase and inactivation of cyclin B2 (Liu et al. 1999). On the other hand, in our studies the expression of cyclin B2 was up-regulated by MPTP in the SN, as observed by in situ hybridization. In addition, PC12 cell culture treatment with nerve growth factor (NGF) induces a decrease in the expression of cyclin F (Movsesyan et al. 1996). Iron, which is known to initiate OS and inflammation via liberation of the hydroxyl radical and membrane lipid peroxidation, has been shown (Philpott et al. 1998) to result in cell cycle arrest and decrease in the expression of G1 cyclins Cln1 and Cln2. In PD as well as in the MPTP-model of PD, iron is selectively increased in the SNPC (Jellinger et al. 1990). It is more than possible that the alterations in some of the expression of cyclins may be related to iron accumulation. The reversal of these gene expression by exposure to R-APO, an iron chelator and radical scavenger, further support this notion.

Three novel genes corresponding to a stress-response protein functional group were also found to be affected by MPTP and to be reversed by treatment with R-APO. Osp94 is a member of a recently described HSP110/SSE subfamily of heat shock and osmotic stress proteins which was shown to be down-regulated in response to hydrogen peroxide (Santos et al. 1998). MPTP decreased the expression of this gene supporting the role of hydrogen peroxide-induced OS in mechanism of MPTP neurotoxicity. Up-regulation of this gene by R-APO in control and MPTP-treated mice, confirms the protection provided by this drug against hydrogen peroxide and 6-OHDA-induced OS in pheochromocytoma cells (Gassen et al. 1998). Furthermore, our results point to possible gene targets for R-APO action, since R-APO itself alters the expression of many genes (Table 3). Cytochrome P450 1A1 is one of dozens of individual members of the cytochrome gene superfamily, which forms a major part of the body's defense against toxin exposure. Three P450 families (CYP1, CYP2 and CYP3) appear to be responsible for most drug metabolism (Wrighton and Stevens 1992), but they may also be involved in endogenous signals, which have not been identified (Dey et al. 1999). In several families with PD, genetic polymorphisms of P450 were reported (Takakubo et al. 1996; Riedl et al. 1998). In our opinion, this gene was down-regulated by MPTP treatment while R-APO prevented the effect. These findings point to the similarity of MPTP model to PD etiology, since the expression of this gene may also be crucial to the process of neurodegeneration by drug metabolizing mechanisms. The third novel gene, whose expression was unaltered by MPTP treatment but was down-regulated by R-APO treatment, is A170. This protein is not an antioxidant, but was found to be induced by exposure of cells to OS (Ishii et al. 1997). Its close structural similarity to a signal transduction protein, 60–62 kDa human lymphocyte protein, suggests that the A170 protein could play a role in signal transduction to induce cellular responses under OS which occurs with MPTP.

Most interesting is the effect of R-APO on Huntingtin-associated protein 1 (HAP1), as a suppressor. HAP1 is specifically expressed in neurons, and is associated with Huntington Chorea (Li et al. 1998). One of the possible functions of HAP1 is to activate the mutated huntingtin protein, and therefore causing the disease. The fact that R-APO inhibits the expression of HAP1 gene suggest that iron chelator and/or radical scavengers may be beneficial in treatment of Huntington Chorea neurodegenerative disease, where OS has been implicated (Polidori et al. 1999) and should be further investigated.

Although the 1200 genes analyzed in this study represent only about 1–2 % of the mouse genome, this method has given us a more complex and wider view of molecular events in dopaminergic neurodegeneration previously not known. Although we did not isolate SN specifically, the gene analysis of the dissected brain shows significant and specific gene expression related to the mechanism of MPTP-induced neurodegeneration. This is further supported by the prevention of these gene changes by R-APO pretreatment, which also results in neuroprotection. The gene expression array data presented here provide the first global assessment of the processes involved in neurodegeneration of dopamine neurons and the neuroprotection afforded by drug treatment at molecular levels. We are now examining gene expression in 6-OHDA model and in SNPC from idiopathic PD to evaluate the homology between animal models and clinical manifestation of the disease. We are confident that these findings could lead to development of novel and effective neuroprotective drugs.

Acknowledgements

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References

We thank Chihiro Akazawa (Department of Neuromuscular Research, National Institute of neuroscience, NCNP, Kadaira, Tokyo 187–8502, Japan) for the generous gift of the hGDNF(tr) in pBluescript II SK + plasmid and Debora J. Wolgemuth (Department of Genetics and Development, Columbia University College of Physicians and Surgeons, 630 west 168th St., NY 10032, USA) for the generous gift of the cyclin B2 in pBluescript SK-plasmid.

References

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References
  • Backert S., Gelos M., Kobalz U., Hanski M. L., Bohm C., Mann B., Lovin N., Gratchev A., Mansmann U., Moyer M. P., Riecken E. O., Hanski C. (1999) Differential gene expression in colon carcinoma cells and tissues detected with a cDNA array. Int. J. Cancer 82, 868874.DOI: 10.1002/(sici)1097-0215(19990909)82:6<868::aid-ijc16>3.3.co;2-n
  • Bernheimer H., Birkmayer W., Hornykiewicz O., Jellinger K., Seitelberger F. (1973) Brain dopamine and the syndrome of Parkinson and Huntington. Clinical, morphological and neurochemical correlations. J. Neurol. Sci. 20, 415455.
  • Bessler H., Djaldetti R., Salman H., Bergman M., Djaldetti M. (1999) IL-1β, IL-2, IL-6 and TNF-α production by peripheral blood mononuclear cells from patients with Parkinson's disease. Biomed. Pharmacother. 53, 141145.DOI: 10.1016/s0753-3322(99)80079-1
  • Bowie A. & O'Neill L. A. (2000) Oxidative stress and nuclear factor-kappaB activation: a reassessment of the evidence in the light of recent discoveries. Biochem. Pharmacol. 59, 1323.DOI: 10.1016/s0006-2952(99)00296-8
  • Carboni S., Melis F., Pani L., Hadjiconstantinou M., Rossetti Z. L. (1990) The noncompetitive NMDA-receptor antagonist MK-801 prevents the massive release of glutamate and aspartate from rat striatum induced by 1-methyl-4-phenypyridinium (MPP+). Neurosci. Lett. 117, 129133.
  • Debouck C. & Goodfellow P. N. (1999) DNA microarrays in drug discovery and development. Nat. Genet. Suppl. 21, 4850.
  • DeRisi J., Penland L., Brown P. O., Bittner M. L., Meltzer P. S., Ray M., Chen Y., Su Y. A., Trent J. M. (1996) Use of a cDNA microarray to analyze gene expression patterns in human cancer. Nat. Genet. 14, 457460.
  • Dey A., Jones J. E., Nebert D. W. (1999) Tissue- and cell type-specific expression of cytochrome P450 1A1 and cytochrome P450 1A2 mRNA in the mouse localized in situ hybridization. Biochem. Pharmacol. 58, 525537.DOI: 10.1016/s0006-2952(99)00110-0
  • Garthwaite J., Garthwaite G., Palmer R. M., Moncada S. (1989) NMDA receptor activation induces nitric-oxide synthesis from arginine in rat-brain slices. Eur. J. Pharmacol. 172, 413416.
  • Gash D. M., Zhang Z., Gerhardt G. (1998) Neuroprotective and neurorestorative properties of GDNF. Ann. Neurol. Suppl. 44, 121125.
  • Gassen M., Glinka Y., Pinchasi B., Youdim M. B. H. (1996) Apomorphine is highly potent free radical scavenger in rat mitochondrial fraction. Eur. J. Pharmacol. 308, 219225.DOI: 10.1016/0014-2999(96)00291-9
  • Gassen M., Gross A., Youdim M. B. H. (1998) Apomorphine enantiomers protect cultured pheochromocytoma (PC12) cells from oxidative stress induced by H2O2 and 6-hydroxydopamine. Mov. Disord. 13, 242248.
  • Gerlach M. & Riederer P. (1996) Animal models of Parkinson's disease: an empirical comparison with the phenomenology of the disease in man. J. Neural. Transm. 103, 9871041.
  • Gray N. S., Wodicka L., Thunnissen A. M., Norman T. C., Kwon S., Espinoza F. H., Morgan D. O., Barnes G., LeClerc S., Meijer L., Kim S. H., Lockhart D. J., Schultz P. G. (1998) Exploiting chemical libraries, structure, and genomics in the search for kinase inhibitors. Science 281, 533538.
  • Grünblatt E., Mandel S., Berkuzki T., Youdim M. B. H. (1999) Apomorphine protects against MPTP-induced neurotoxicity in mice. Mov. Disord. 14, 612618.
  • Hadjiconstantinou M., Fitkin J. G., Dalia A., Neff N. H. (1991) Epidermal growth factor enhances striatal dopaminergic parameters in the 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine-treated mouse. J. Neurochem. 57, 479482.
  • Heller R. A., Schena M., Chai A., Shalon D., Bedilion T., Gilmore J., Woolley D. E., Davis R. W. (1997) Discovery and analysis of inflammatory disease-related genes using cDNA microarrays. Proc. Natl Acad. Sci. USA 94, 21502155.DOI: 10.1073/pnas.94.6.2150
  • Hunot S., Bernard V., Faucheux B., Boissiere F., Leguern E., Brana C., Gautris P. P., Guerin J., Bloch B., Agid Y., Hirsch E. C. (1996) Glial cell line-derived neurotrophic factor (GDNF) gene expression in the human brain: a post mortem in situ hybridization study with special reference to Parkinson's disease. J. Neural. Transm. 103, 10431052.
  • Hunot S., Brugg B., Ricard D., Michel P. P., Muriel M. P., Ruberg M., Faucheux B. A., Agid Y., Hirsch E. C. (1997) Nuclear translocation of NF-κB is increased in dopaminergic neurons of patients with Parkinson's disease. Proc. Natl Acad. Sci. USA 94, 75317536.DOI: 10.1073/pnas.94.14.7531
  • Ishii T., Yanagawa T., Yuki K., Kawane T., Yoshida H., Bannai S. (1997) Low molecular levels of hydrogen peroxide and proteasome inhibitors induce the 60-kDa A170 stress protein in murine peritoneal macrophages. Biochem. Biophys. Res. Commun. 232, 3337.DOI: 10.1006/bbrc.1997.6221
  • Jellinger K., Paulus W., Grundke-Iqbal I., Riederer P., Youdim M. B. H. (1990) Brain Iron and ferritin in Parkinson's and Alzheimer's disease. J. Neural. Transm. 2, 327340.
  • Lee C. K., Klopp R. G., Weindruch R., Prolla T. A. (1999) Gene expression profile of aging and its retardation by caloric restriction. Science 285, 13901393.DOI: 10.1126/science.285.5432.1390
  • Li S. H., Hosseini S. H., Gutekunst C. A., Hersch S. M., Ferrante R. J., Li X. J. (1998) A human HAP1 homologue. Cloning, expression, and interaction with huntingtin. J. Biol. Chem. 273, 1922019227 .DOI: 10.1074/jbc.273.30.19220
  • Liberatore G. T., Jackson-Lewis V., Vukosavic S., Mandir A. S., Vila M., McAuliffe W. G., Dawson V. L., Dawson T. M., Przedborski S. (1999) Inducible nitric oxide synthase stimulates dopaminergic neurodegeneration in the MPTP model of Parkinson's disease. Nat. Med. 5, 14031409.DOI: 10.1038/70978
  • Lin L. F., Doherty D. H., Lile J. D., Bektesh S., Collins F. (1993) GDND: a glial cell line-derived neurotrophic factor for midbrain dopaminergic neurons. Science 260, 11301132.
  • Lin M., Rippe R. A., Niemela O., Brittenham G., Tsukamoto H. (1997) Role of iron in NFkB activation and cytokines gene expression by rat hepatic macrophages. Am. J. Physiol. 272, G1355G1364.
  • Liu J. H., Wei S., Burnette P. K., Gamero A. M., Hutton M., Djeu J. Y. (1999) Functional association of TGF-β receptor II with cyclin B. Oncogene 18, 269275.
  • Marton M. J., DeRisi J. L., Bennett H. A., Iyer V. R., Meyer M. R., Roberts C. J., Stoughton R., Burchard J., Slade D., Dai H., Bassett D. E. Jr, Hartwell L. H., Brown P. O., Friend S. H. (1998) Drug target validation and identification of secondary drug target effects using DNA microarrays. Nat. Med. 4, 12931301.DOI: 10.1038/3282
  • Mogi M., Harada M., Narabayashi H., Inagaki H., Minami M., Nagatsu T. (1996) Interleukin (IL)-1β, IL-2, IL-4, IL-6 and transforming growth factor-α levels are elevated in ventricular cerebrospinal fluid in juvenile parkinsonian and Parkinson's disease. Neurosci. Lett. 211, 1316.DOI: 10.1016/0304-3940(96)12706-3
  • Mogi M., Togari A., Ogawa M., Ikeguchi K., Shizuma N., Fan D., Nakano I., Nagatsu T. (1998) Effects of repeated systemic administration of 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP) to mice on interleukin-1β and nerve growth factor in the striatum. Neurosci. Lett. 250, 2528.DOI: 10.1016/s0304-3940(98)00427-3
  • Mori S., Fujitake J., Kuno S., Sano Y. (1988) Immunohistochemical evaluation of the neurotoxic effects of 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP) on dopaminergic nigrostriatal neurons of young adult mice using dopamine and tyrosine hydroxylase antibodies. Neurosci. Lett. 90, 5762.
  • Movsesyan V., Whalin M., Shibutani M., Katagiri Y., Broude E., Guroff G. (1996) Down-regulation of cyclin F levels during nerve growth factor-induced differentiation of PC12 cells. Exp. Cell Res. 227, 203207.DOI: 10.1006/excr.1996.0268
  • Olanow C. W. (1996) Neurodegeneration and Neuroprotection in Parkinson's Disease. N.Y. Acad. Press, New York.
  • Philpott C. C., Rashford J., Yamaguchi-Iwai Y., Rouault T. A., Dancis A., Klausner R. D. (1998) Cell-cycle arrest and inhibition of G1 cyclin translation by iron in AFT1–1up yeast. EMBO J. 17, 50265036.DOI: 10.1093/emboj/17.17.5026
  • Polidori M. C., Mecocci P., Browne S. E., Senin U., Beal M. F. (1999) Oxidative damage to mitochondrial DNA in Huntington's disease parietal cortex. Neurosci. Lett. 272, 5356.DOI: 10.1016/s0304-3940(99)00455-3
  • Riedl A. G., Watts P. M., Jenner P., Marsden C. D. (1998) P450 enzymes and Parkinson's disease: the story so far. Mov. Disord. 13, 212220.
  • Santos B. C., Chevaile A., Kojima R., Gullans S. R. (1998) Characterization of the Hsp110/SSE gene family response to hyperosmolarity and other stresses. Am. J. Physiol. 274, F1054F1061.
  • Schreck R., Rieber P., Baeuerle P. A. (1991) Reactive oxygen intermediates as apparently widely used messengers in the reactivation of the NF-kappa B transcription factor and HIV-1. EMBO J. 10, 22472258.
  • Swift S., Blackburn C., Morahan G., Ashworth A. (1998) Structure and chromosomal mapping of the TNF-α inducible endothelial protein 1 (Edp1) gene in the mouse. Biochem. Biophys. Acta 1442, 394398.
  • Takakubo F., Yamamoto M., Ogawa N., Yamashita Y., Mizuno Y., Kondo I. (1996) Genetic association between cytochrome P450Ia1 gene and susceptibility to Parkinson's disease. J. Neural. Transm. 103, 843849.
  • Wrighton S. A. & Stevens J. C. (1992) The human cytochromes P450 involved in drug metabolism. Crit. Rev. Toxicol. 22, 121.
  • Youdim M. B., Grunblatt E., Mandel S. (1999) The pivotal role of iron in NF-kappa B activation and nigrostriatal dopaminergic neurodegeneration. Prospects for neuroprotection in Parkinson’s disease with iron chelaters. Ann. NY Acad. Sci. 890, 725.