SEARCH

SEARCH BY CITATION

Keywords:

  • chromosomes;
  • evolution;
  • expression;
  • MC-receptor;
  • melanocyte stimulating hormone (MSH);
  • pharmacology;
  • structure

Abstract

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References

We report the cloning, genome mapping, functional expression, pharmacology and anatomical distribution of three melanocortin (MC) receptors from zebrafish (z). Phylogenetic analysis showed with high bootstrap support that these genes represent one MC4 receptor and two MC5 receptors. Chromosomal mapping showed conserved synteny between regions containing zMC4 and human (h) MC4 receptors, whereas the two zMC5 receptor genes map on chromosome segments in which the zebrafish has several genes with two orthologues of a single mammalian gene. It is likely that the two copies of zMC5 receptors arose through a separate duplication in the teleost lineage. The zMC4, zMC5a, and zMC5b receptors share 70–71% overall amino acid identity with the respective human orthologues and over 90% in three TM regions believed to be most important for ligand binding. All three zebrafish receptors also show pharmacological properties remarkably similar to their human orthologues, with similar affinities and the same potency order, when expressed and characterized in radioligand binding assay for the natural melanocyte stimulating hormone (MSH) peptides α-, β-, and γ-MSH. Stimulation of transfected mammalian cells with α-MSH caused a dose-dependent increase in intracellular cAMP levels for all three zebrafish receptors. All three genes were expressed in the brain, eye, ovaries and gastrointestinal tract, whereas the zMC5b receptor was also found in the heart, as determined by RT-PCR. Our studies, which represent the first characterization of MC receptors in a nonamniote species, indicate that the MC receptor subtypes arose very early in vertebrate evolution. Important pharmacological and functional properties, as well as gene structure and syntenic relationships have been highly conserved over a period of more than 400 million years implying that these receptors participate in vital physiological functions.

Abbreviations used:
ACTH

adrenocorticotropic hormone; Agrp, agouti-related peptide

CMV

cytomegalovirus

DCC

developed degeneration complementation

DMEM

Dulbecco's modified Eagle's medium

GI

gastrointestinal

GPCR

G protein coupled receptors

h

human

IBMX

isobutylmethylxantine

MC

melanocortin

POMC

pro-opiomelanocortin

PTH

parathyroid hormone

SDS

sodium dodecyl sulfate

SSC

saline sodium citrate

z

zebrafish.

The teleost zebrafish (Danio rerio) is an important experimental animal in genomic and developmental research. It has a compact genome with a similar number of genes but is only one-third in size as compared with the human genome, sharing large blocks of conserved synteny (Postlethwait et al. 2000). While the complete sequencing of the zebrafish genome is in progress, currently less than 30% of the genes in the zebrafish genome have been cloned, and these include about 40 genes for G-protein coupled receptors (GPCR). The majority of these belong to the groups of olfactory, chemokine and opsin receptors. The other main families of GPCRs cloned in zebrafish include neuropeptide Y (NPY), opioid, melatonin, endothelin and parathyroid hormone (PTH) receptors. Only a few families of peptide-binding GPCRs from ‘lower’ vertebrates, including fishes, have been expressed and pharmacologically characterized. Although some of these receptors show a high level of similarity to their mammalian counterparts, which relate to sequence identity, ligand selectivity and affinity (Darlison et al. 1997; Palyha et al. 2000), other gene families seem to have undergone major transformation in the mammalian lineage (Rubin et al. 1997; Cerda-Reverter and Larhammar 2000). It is conceivable that the physiological systems that involve GPCRs may be largely conserved between vertebrate classes even though the molecular components may differ significantly.

Our understanding of the mechanisms for central regulation of food intake and metabolism in mammals is growing rapidly. Several neuropeptides are involved that bind to GPCRs in the hypothalamic regions (Kalra et al. 1999). Very little is known however, about the molecular mechanisms of central regulation of energy balance in non-mammalian species, despite the fact that the growth rate of several species, including fishes, has important global ecological and economical impact.

The family of melanocortin (MC) receptors consists of five subtypes cloned from human, rat and mouse and also one non-mammalian species, namely chicken (for review see Schiöth 2001). The primary structures of the MC receptors show no major similarity to other peptide-binding GPCRs and evidence indicates that the ligand-binding pocket of these receptor mainly involves transmembrane regions 2, 3 and 7 but not 4 and 5, like many other rhodopsin-like GPCRs (Yang et al. 2000; Schiöth et al. 1998c; Haskell-Luevano et al. 2001). The mammalian MC receptors have been extensively characterized and lately received great attention due to their important role in the regulation of the energy balance, involving the centrally expressed MC3 and MC4 receptors (Huszar et al. 1997; Chen et al. 2000). MC4 receptor antagonists are among the most effective agents available to induce both acute and long-term food intake in mammals (Kask et al. 1998a,b; Skuladottir et al. 1999). Agonists for the MC4 receptor are also highly effective in reducing feeding (Fan et al. 1997) and affecting metabolic rate (Jonsson et al. 2001). These findings have attracted great interest from researchers studying central regulation of body weight homeostasis, including the pharmaceutical industry. The MC5 receptor subtype is primarily expressed in a variety of peripheral tissues but it has also been detected in the brains of mammals (Barret et al. 1994; Griffon et al. 1994; Labbéet al. 1994; Chhajlani 1996; Mountjoy and Wong 1997). This receptor is believed to have a role in exocrine gland functions in mice (Chen et al. 1997). Both the MC4 and MC5 receptor genes have been linked with human obesity-related phenotypes (Chagnon et al. 1997; Hinney et al. 1999). The two other MC receptor subtypes are found in the periphery. The MC1 receptor has a role in pigmentation and it also mediates the broad anti-inflammatory actions of the melanocortins. The MC2 receptor is exclusively found in the adrenal gland where it mediates the effect of adrenocorticotropic hormone (ACTH) on steroid production (Schiöth 2001).

The MC receptor system is unique in that it has both natural agonists and antagonists. The agonists are the pro-opiomelanocortin (POMC) cleavage products α-melanocyte stimulating hormone (MSH), β-MSH, γ-MSH and ACTH, whereas separate precursors generate natural antagonists named agouti and agouti-related peptide (Agrp). POMC has been extensively used as a model for studies of the evolution of neuropeptides. There are several examples of two copies of the POMC gene in fishes (Dores et al. 1990). It seems to have arisen in early chordate evolution and has undergone a number of lineage-specific modifications but seems always to include both α- and β-MSH. The sequence of α-MSH has been cloned from at least seven species of fish, showing high evolutionary conservation of this 13 amino acid peptide (Danielson and Dores 1999). The principal source of the mammalian melanocortins is the pituitary, but the POMC gene is also expressed in a variety of other brain regions and also in a number of peripheral tissues, particularly in the skin. Besides the physiological functions mentioned above, the melanocortins have been implicated in a broad array of other processes, as they also effect sexual functions in both sexes, memory, pyretic control, pain perception, blood pressure, nerve growth and regeneration, and several events surrounding parturition (Eberle 1988; Schiöth 2001).

In this paper we report the cloning and characterization of the first MC receptors from a ‘lower’ (nonamniote) vertebrate. We describe three MC receptors in zebrafish with respect to structure, chromosomal localization, pharmacological profile and anatomical distribution and discuss their evolution through gene duplications.

Materials and methods

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References

Cloning

Degenerate primers based on conserved parts of the human, rat, mouse and chicken MC receptors were used in different pair-wise combinations. One hundred nanograms of zebrafish genomic DNA was used as template in a low stringency PCR, using the AmpliTaq DNA polymerase Stoffel Fragment (Perkin Elmer) in a reaction volume of 20 µL, containing 4 mm dNTP, 1 × Stoffel buffer (Perkin Elmer), 60 mm MgCl2, 20 pmol each primer and 2 units DNA polymerase, Stoffel Fragment (Perkin Elmer). Touch-down PCR was used, starting with an initial 1 min denaturation, followed by 22 cycles of 45 s at 94°C, 45 s at 52°C to 42°C, 90 s at 72°C. This was followed by 25 cycles of 30 s at 94°C, 40 s at 50°C, 1 min at 72°C, with a final extension of 5 min at 72°C. The PCR gave products of the expected size, 600 bp. The 5′ primer's sequence was CAYTCNCCNATGTAYTTYTT and the 3′ primer ATNACIGARTTRCACATDAT. Y denotes C or T, R denotes A or G, D denotes A, G or T, I denotes inosine and N denotes any base. The PCR products were purified from a 1% agarose gel using Gel Extraction Kit (Qiagen, Valencia, CA, USA). Re-amplification was performed by denaturating for 1 min, followed by 45 s at 95°C, 45 s at 50°C, 1 min at 72°C and 40 cycles with a final extension of 72°C for 5 min. An aliquot of each of the re-amplified products was cloned into a Topo-vector and transformed into TOP10 cells (TOPO TA-cloning® Kit, Invitrogen, Carlsbad, CA, USA). PCRs were performed on a GeneAmp® PCR System 9700 (Perkin Elmer).

Sequencing

Sequence determinations were performed using ABI PRISM Dye Terminator cycle sequencing kits according to the manufacture's recommendations (Applied Biosystems, Stockholm, Sweden) and analysed on an ABI PRISM-310 Automated Sequencher (Applied Biosystems). Sequences were compiled and aligned in Sequencher (Gene Codes, Ann Arbor, MI, USA). Sequences were compared with National Center for Biotechnology Information (NCBI) database using BlastX.

Screening of a genomic library and isolation of full-length genes

Filters from a zebrafish cosmid library made in the vector EMBL3 contained approximately 700 000 clones (roughly four genome equivalents) were supplied by RessoursenZentrum/PrimärDatabank (RZ/PD) (Max Planck-Institut für Molekulare Genetik, Berlin-Charlottenburg, Germany). The MC receptor-like PCR products were labelled with 32P using Megaprime Labelling System (Amersham, Uppsala, Sweden) and used as probes. Hybridization was carried out at 65°C in 25% formamide (Merck Eurolab AB, Stockholm, Sweden), 6 × saline sodium citrate buffer (SSC) (Sambrook and Russells 2001), 10% dextran sulfate (Amersham Pharmacia Biotech AB), 5 × Denhardt's solution (Sambrook and Russells 2001), and 0.1% SDS (sodium dodecyl sulfate, Scientific Imaging Systems, Eastman Kodak Company) over night. The filters were washed five times in 0.2 × SSC + 0.1% SDS for 1 h at 65°C. After exposure to autoradiographic films, six individual cosmid clones were selected for further characterization. The cosmid cultures were grown in Luria–Bertani (LB) medium in presence of 20 µg/mL kanamycin. Three cosmids (ICRFc68B06142Q6 (zMC4), ICRFc70H1237Q5 (zMC5a) and ICRFc70E02127Q5 (zMC5b)) were confirmed to be true positives and were used as template for sequencing to obtain the full-length receptors.

Alignments and phylogenetic analysis

The zebrafish full-length amino acids sequences were aligned with other MC receptor sequences using ClustalW (1.7) software (Thompson et al. 1994) and edited manually after visual inspection. The sequences aligned with the zebrafish sequences (see Figs 1 and 2) were retrieved from GenBank and have accession codes: Homo sapiens MC1 (NM_002386), MC2 (NM_000529), MC3 (XM_009545), MC4 (NM_005912), MC5 (XM_008685), Mus musculus MC1 (NM_008559), MC2 (NM_008560), MC3 (NM_008561), MC4 (AF201662), MC5 (NM_013596), Gallus gallus MC1 (D78272), MC2 (AB009605), MC3 (AB017137), MC4 (AB012211), MC5 (AB012868). The zebrafish (Danio rerio) MC receptors have the following accession numbers: zMC4 receptor: AY078989, zMC5a receptor: AY078990, and zMC5b receptor: AY078991. Phylogenetic trees were built using maup 4.0 software (Smithsonian Institution) using maximum parsimony and distance neighbour joining methods. Human NPY-Y1 (accession code A26481) was used as an out-group. A bootstrap consensus tree assessing the robustness of the nodes was made with 100 replicates and 10 random addition heuristic searches for each node.

image

Figure 1. Amino acid sequence alignment made using ClustalW (1.7) software and edited by manual inspection. The zebrafish MC5a receptor serves as master with human MC1, MC2, MC3, MC4 and MC5, mouse MC4 and MC5, chicken MC4 and MC5, zebrafish MC4 and MC5b sequences. The lines mark putative transmembrane (TM) regions [according to (Prusis et al. 1997)]. Tripeptide sequences in extracellular parts that conform with the consensus sequence for N-linked glycosylation sites are highlighted with framed grey boxes. Extracellular and intracellular cysteines are shown in grey unframed boxes. The accession numbers are listed in ‘Material and methods’.

Download figure to PowerPoint

image

Figure 2. Phylogenetic analysis of the MC-receptor family using the full-length amino acid sequences. To the left is a tree generated by neighbour-joining analysis (maup 4.0) and to the right is the shortest tree obtained by maximum persimony analysis (maup 4.0). The human NPY-Y1 receptor sequence was used to root the trees. The numbers above the nodes indicate percentage of bootstrap replicates. The accession numbers are listed in ‘Material and methods’.

Download figure to PowerPoint

Molecular clock calculation

The same neighbour-joining tree (seen in Fig. 2) was used as an input tree into Protml from the Phylip 3.6a suit (Joseph Felsenstein, University of Washington) to improve topology calculations. The software settings were as follows; use user tree (U); gamma + invariant sites (R); otherwise the default settings were applied. For the gamma calculations the following parameters were used: coefficient of variation of substitution rate 1.12; 8 rate categories; fraction of invariant sites 0.05. These parameters were calculated for the same data set using TREE-PUZZLE 5.0 (Heiko A. Schmidt, Heidelberg).

Genetic mapping

Mapping was performed on the Heat Shock doubled haploid mapping panel (Postlethwait et al. 2000; Woods et al. 2000) http://zebrafish.stanford.edu/genome/Frontpage.html) and the LN54 radiation hybrid panel (Hukriede et al. 1999) using the following mapping primers: zMC4. + 645 TGGACCGCTACATCACAATCTTCTA, zMC4. − 918 CATATCGGGCCGTTTCCAGGTAA; zmc5a. + 4. GCTTCCTTCCTATTCAACTGCTTG, zMC5a. − 150 CTCGCATGCTTTCGGCTTGTTGTG; and zMC5b. + 12 TGCGCTAAAGCCCAAGTGAA, zMC5b.-345 ATGCTAGAGGCCGTGGATTTTA. The position of the MC4 receptor locus was intercalated on the HS mapping panel. For comparative mapping, putative orthologues were defined by a BLASTX search using the zebrafish nucleotide sequence to query the human NR database at GenBank (http://www.ncbi.nlm.nih.gov/BLAST/), followed by a reciprocal BLAST using the top human hit in a TBLASTN search querying the zebrafish Unigene set [either http://www.ncbi.nlm.nih.gov/UniGene/Dr.Home.html or our own unigene set at http://zfish3.uoregon.edu/ (Alan Day and JHP, unpublished)]. If the best human hit for a zebrafish sequence blasted back to the zebrafish Unigene that included the original zebrafish sequence, then the two mutually best sequences were considered as putative orthologues. The map locations of those sequences were obtained from LocusLink (http://www.ncbi.nlm.nih.gov/genome/guide/human/) or GeneMap99 (http://www.ncbi.nlm.nih.gov/genemap/). Maps were constructed using MapManager (Manly et al. 1993); http://mapmgr.roswellpark.org/mapmgr.html).

Cloning into expression vector

The entire coding regions of the receptor sequences were amplified with Pfu Turbo DNA polymerase (Stratagene, La Jolla, CA, USA). Specific primers containing HindIII and XhoI sites were used under the following conditions: 60 s at 95°C for one cycle, then 30 s at 95°C, 30 s at 53°C and 70 s at 72°C for 35 cycles. The PCR fragments were purified by QIAquick PCR Purification Kit (Qiagen) and digested by HindIII and XhoI. The full-length receptor sequences were then purified again with QIAquick PCR purification kit (Qiagen) and ligated into a modified pCEP4 expression vector (Lundell et al. 2001). The new constructs were sequenced and found to be identical to the genomic clones. The human MC4 (Gantz et al. 1993) and MC5 receptor (Chhajlani et al. 1993) were inserted into the same vector and sequenced.

Transfection

HEK 293-EBNA cells were transiently transfected with the constructs using FuGENE™ Transfection Reagent (Boehringer Mannheim, Mannheim, Germany) diluted in OptiMEM medium (Gibco BRL) according to the manufacturer's recommendations. The cells were grown in Dulbecco's modified Eagle's medium (DMEM)/Nut Mix F-12 with 10% fetal calf serum (Gibco BRL/Lifetech) containing 0.2 mmaup-glutamine (Gibco BRL) and 250 µg/mL G-418 (Gibco, Rockville, MD, USA) and penicillin-streptomycin (100 U penicillin, 100 µg streptomycin/mL) (Gibco BRL).

Radioligand binding

Intact transfected cells were re-suspended in 25 mmaup HEPES-buffer (pH 7.4) containing 2.5 mmaup CaCl2, 1 mmaup MgCl2 and 2 g/L bacitracin. Saturation experiments were performed in a final volume of 100 µL for 3 h at 37°C and carried out with serial dilutions of [125I](Nle4,maup-Phe7)α-MSH (NDP-MSH). Non-specific binding was defined as the amount of radioactivity remaining bound to the intact cells after incubation in the presence of 2000 nmaup unlabelled NDP-MSH. Competition experiments were performed in a final volume of 100 µL. The cells were incubated in the well plates for 3 h at 37°C with 0.05 mL binding buffer in each well containing a constant concentration of [125I]NDP-MSH and appropriate concentrations of competing unlabelled ligands NDP-MSH, α-, β-, γ-MSH or HS014. The incubations were terminated by filtration through Glass Fibre Filters, Filtermat A (Wallac Oy, Turku, Finland), which had been presoaked in 0.3% polyethylenimine, using a TOMTEC Mach III cell harvester (Orange, CT, USA). The filters were washed with 5.0 mL/well of 50 mmaup Tris (pH 7.4) at 4°C and dried at 60°C. The dried filters were then treated with MeltiLex A (Perkin Elmer) melt-on scintillator sheets and counted with Wallac 1450 (Wizard automatic Microbeta counter). The results were analysed with a software package suitable for radioligand binding data analysis (Pmaup 3.0, Graphpad, San Diego, CA, USA). Data were analysed by fitting to formulas derived from the law of mass action by the method generally referred to as computer modelling (see also Cheng and Prusoff 1973). The binding assays were performed in duplicate wells and repeated three times. Non-transfected HEK293-EBNA cells did not show any specific binding for [125I]NDP-MSH. NDP-MSH was radio-iodinated by the chloramine T method and purified by HPLC (high performance liquid chromatography). NDP-MSH, α-, β-, γ-MSH or HS014 were purchased from Neosystem, France.

cAMP assay

Cyclic adenosine 3′:5′-cyclic monophosphate (cAMP) was assayed on transfected HEK293-EBNA cells treated for 20 min at 37°C with 0.5 mmaup isobutylmethylxantine (IBMX) (Sigma). Cells were incubated with various concentrations of α-MSH for 30 min, then lysed by treatment with 4.4 maup perchloric acid and neutralized with 5 maup KOH. 25 µL of the neutralized cAMP extract was added to a 96 well microtiter plate. The content of cAMP was then estimated essentially according to Nordstedt and Fredholm (1990); by adding to each well [3H]cAMP (0.14 pmol, approximately 11 000 cpm, specific activity 54 Ci/mmol, Amersham) and bovine adrenal binding protein and incubating at 4°C, over night. The incubates were thereafter harvested by filtration through Glass Fibre Filters, Filtermat A (Wallac Oy, Turku, Finland), which had been presoaked in 0.3% polyethylenimine, using a TOMTEC Mach III cell harvester (Orange, CT, USA). Each filter was rinsed with 3 mL 50 mmaup Tris/HCl pH 7.4 at 4°C and dried at 60°C. The dried filters were then treated with MeltiLex A (Perkin Elmer) melt-on scintillator sheets and counted with Wallac 1450 Microbeta counter. The cAMP assays were performed in duplicate wells and repeated three times. Untransfected HEK293-EBNA cells showed no response to cAMP (data not shown).

RT-PCR and Southern analysis

Fresh tissues (heart, muscle, brain, gastrointestinal-track, eye, ovary) from 10 adult zebrafish (equal number of males and females) were collected and pooled. The total RNA was isolated according to the RNeasy Mini Kit (Qiagen) protocol. The RNA preparations were then DNaseI treated for 20 min at room temperature using the RNase-Free DNase Set protocol (Qiagen). The quality of RNA was controlled on a 1% agarose gel. Messenger RNA was reverse transcribed using the 1st Strand cDNA Synthesis kit (Amersham Pharmacia Biotech). The produced cDNA was used as a template for PCR with the specific primers for the three receptor genes. The following primers were used: (zMC4): 5′-TGATGGCGCTCATCACGTGAG and 3′-GCGATCCGTTTCATGTGC(AGC) (zMC5a): 5′-TCATCTACCTGCTCACCAATC and 3′-GCAATGCGTTTGACGTGAGAA (zMC5b): 5′-TCATTCATCTGCTGGCAAACAGG and 3′-TGTAGAGTGACGCCATCATAAG, giving products of approximately 355 bp, 355 bp and 325 bp, respectively. The conditions for PCR were: 1 min denaturation, then 30 s at 95°C, 40 s at 53°C, 60 s at 72°C for 35 cycles and finished by 5 min at 72°C, using Taq polymerase (Gibco BRL). A PCR with total RNA serving as a template, from each organ, was run as a negative control (data not shown). No contamination was detected. The PCR products were analysed on a 1% agarose gel. The DNA products on the gels were transferred to nylon filters over night using 0.4 maup NaOH. The filters were hybridized with a random-primed 32P-labelled, species and receptor specific probe (Megaprime kit, Amersham Pharmacia Biotech) at 65°C in 25% formamide, 6 × SSC, 10% dextran sulfate, 5 × Denhardt's solution and 0.1% SDS over night. The filters were then washed five times in 0.25 SSC + 0.1% SDS for 1 h at 65°C and exposed to autoradiography film (Amersham Pharmacia Biotech). As positive controls in the Southern blots, the probes for the new receptors were used.

Results

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References

Degenerate primers corresponding to highly conserved regions in the cloned MC receptors were made and used for PCR on genomic zebrafish DNA. About 40 PCR products of expected size, approximately 400–600 bp, were cloned and sequenced. Three clones of 600 bp showed high sequence identity to the MC4 and MC5 receptors. These sequences were used as probes for high stringency screening of a gridded genomic zebrafish cosmid library. Three clones that hybridized strongly were identified and subsequently sequenced with specific primers. Each of the three clones had a unique MC receptor-like sequence. One of the sequences had highest identity to the mammalian MC4 receptors. This clone was designated as the zMC4 receptor. The other two clones had highest sequence identity to each other. Among the mammalian and chicken receptors they had highest identity to the MC5 receptors (70–77%). Hence, they were designated as the zMC5a and zMC5b receptors. Alignment of the protein sequences of the three zebrafish receptors with the previously cloned human MC1, MC2, MC3, MC4 and MC5 receptors and the chicken and mouse MC4 and MC5 receptors is shown in Fig. 1. The percentage identities of the complete sequences and the TM regions are shown in Table 1.

Table 1.  Sequence comparison of melanocortin receptor subtypes in different species
  1. The upper-right part shows the percentage identity of full-length amino acid sequences, whereas the lower-left part shows the percentage identity of the TM regions.

 zMC5azMC5bchMC5mMC5hMC5zMC4chMC4mMC4hMC4hMC3hMC2hMC1
zMC5a77.576.970.471.366.861.761.161.760.248.248.5
zMC5b85.972.070.869.667.160.761.962.560.845.446.6
chMC585.982.979.278.666.863.462.864.060.846.946.0
mMC580.080.688.880.763.460.160.460.158.745.144.8
hMC580.078.287.185.363.159.561.060.160.544.843.8
zMC478.277.177.675.973.570.469.869.860.545.748.5
chMC471.871.874.771.271.281.285.787.256.545.145.7
mMC470.072.472.970.671.280.692.993.555.344.246.3
hMC470.672.974.771.271.280.094.195.955.343.346.0
hMC371.871.871.867.169.472.965.965.965.943.645.7
hMC249.450.050.648.247.150.652.952.450.050.038.3
hMC153.555.352.450.650.057.655.956.555.354.740.0

Phylogenetic analyses of the full-length amino acid sequences of the three zebrafish receptors, together with the amniote (human, mouse and chicken) MC receptors, using maximum parsimony and neighbour joining methods are shown in Fig. 2. The topology of the trees were the same with or without an out group (data not shown). The parsimony tree (right) had length of 1421, consistency index 0.78, homoplasy index 0.22. The topologies of the trees are identical except for two minor differences. The neighbour joining tree places the MC2 receptors as the sister group of the MC3/4/5 and MC1 receptors as the earliest branch, whereas the parsimony tree shows both the MC1 and MC2 receptors at the base of the tree. Similarly, the neighbour joining tree has the MC3 receptors as the sister group of the MC4 and MC5 receptors, whereas the parsimony tree places the MC3, MC4, and MC5 receptor groups equidistantly from each other. For each of the five receptor subtypes, human and mouse are more closely related than either is to chicken, as expected. The zMC4 receptor is basal to the three amniote MC4 receptor sequences corresponding to the relationships of the species. The zMC5 receptor sequences are most similar to each other and branch off basal to the three amniote MC5 receptor sequences, suggesting that they arose by gene duplication after the divergence of amniote and teleost lineages. Neighbour joining and maximum parsimony analyses of only the TM regions give trees with the same topology as for the full-length receptors with respect to the positioning of the zebrafish receptors with one exception (data not shown), namely that the TM maximum parsimony tree interchanges the branches for the MC2 and the MC1 receptor groups. These phylogenetic trees can be obtained from the correspondence author upon request. Molecular clock calculations indicate that the duplication that generated the two zMC5 receptors took place in the teleost lineage later than the divergence of mammals and birds which is usually dated to 300 million years ago.

The zMC4, zMC5a, and MC5b receptor genes mapped to chromosomes [linkage group (LG)], LG2, LG19, LG16, respectively. Figure 3 shows a map of locations of the zMC4, zMC5a, zMC5b receptor genes, together with a map of HSA18 with the location of the hMC4, hMC5 and hMC2 receptor genes. The zMC4 receptor gene is found close to another locus, MYOM1 found on HSA18p11.32. A third HSA18 gene, NPC1, lies distantly on LG2. The zMC5a and zMC5b receptor genes show no known conserved synteny to HSA18. LG16 and LG19 have however, closely related genes that correspond to the same mammalian orthologue, suggesting that they are duplicated chromosome segments (Amores et al. 1998; Woods et al. 2000).

image

Figure 3. Map showing chromosomal positions of the MC receptors and conserved syntenies on zebrafish linkage groups LG2, LG16, LG19 and human chromosome HSA18. The abbreviations for the genes are listed below with the full names and the zebrafish and human NCBI accession numbers (or Locus ID): NPC (Niemann–Pick C1, Protein precursor), AI722583, O15118; MYOM1 (myomesin 1), AI658181, Q62234; atp1a3 (Na+/K+ ATPase alpha subunit isoform), AF308599, AY008374, AAA53499; rxrd (retinoid X receptor delta), U29941, NP_068811; hoxa11, Y14528, NP_005514; apoe (apolipoprotein E precursor protein), Y13652, AAB59397; gdf6 (growth and differentiation factor 6), AAB34226 and Locus ID 9571.

Download figure to PowerPoint

For functional expression, the coding regions of the three zebrafish receptors were transferred to an expression vector containing the cytomegalovirus (CMV) promotor. These clones were readily expressed in HEK-EBNA cells and the receptors were tested in radioligand binding assay to intact cells using methods similar to those employed earlier for the human MC receptor subtypes (Schiöth et al. 1995). The results of saturation analysis (Kd values) were obtained by incubating varying concentrations of the high-affinity ligand [125I]NDP-MSH in the absence or presence of 2 µmaup unlabelled NDP-MSH. We also performed competition binding analysis (Ki values) using a constant concentration of the labelled ligand and varying concentrations of NDP-MSH, α-MSH, β-MSH, γ-MSH and HS014. The results show that [125I]NDP-MSH bound to a single saturable site for the zebrafish receptors in a fashion similar to that of the human MC4 and MC5 receptors, which were used for comparison. Figure 4 shows saturation and competition curves for the zebrafish receptors. Table 2 shows the Kd and the Ki values obtained from saturation and competition analysis, respectively. The hMC4 and hMC5 receptor proteins showed binding values similar to those we reported earlier (Schiöth et al. 1995, 1996). The zMC4 receptor had binding values indistinguishable from the hMC4 receptor for the high potency synthetic ligand NDP-MSH and also for the endogeneous peptides α-, β-, and γ1-MSH. The potency order of the peptides was the same for the two MC4 receptors. The only compound that had a significantly different affinity for the zMC4 receptor as compared with the human receptor was the peptide HS014, which had 88-fold lower affinity for the zMC4 receptor. The pattern is the same for the MC5 receptors. Both the zebrafish receptors had similar affinity as the human receptor for all the peptides except for HS014. The characteristic potency order found for the human and mouse MC5 receptor (NDP-MSH > α-MSH > β-MSH > γ-MSH) was conserved for the zebrafish receptors (Schiöth et al. 1998a). HS014 had however, about 7–8-fold lower affinity for both the zMC5 receptors as compared with the human orthologue.

image

Figure 4. Saturation and competition curves for the zMC4, zMC5a and zMC5b receptors expressed in intact transfected cells. Saturation curves (left) were obtained with [125I](Nle4,maup-Phe7)α-MSH and the figure shows total binding (▮) and binding in the presence of 3 µmaup cold (Nle4,D-Phe7) α-MSH (▴) for each receptor. Lines represent the computer-modelled best fit of the data assuming that ligands were bound to one-site. Competition curves (right) for (Nle4,maup-Phe7)α-MSH (▴), α-MSH (▮), and β-MSH (□) were obtained by using a fixed concentration of 2 nmaup[125I](Nle4,maup-Phe7) α-MSH and varying concentrations of the non-labelled competing peptide.

Download figure to PowerPoint

Table 2. Ki and Kd values (mean ± SEM) obtained from competition and saturation curves, respectively, for melanocortin peptides analogues on zMC4, hMC4, zMC5 and hMC5 receptor transfected EBNA cells
LigandzMC4 (nmol/L)hMC4 (nmol/L)zMC5a (nmol/L)zMC5b (nmol/L)hMC5 (nmol/L)
[125I]NDP-MSH (Kd)2.39 ± 0.962.35 ± 1.182.72 ± 0.822.49 ± 0.992.64 ± 1.05
NDP-MSH (Ki)3.35 ± 0.313.57 ± 0.3019.2 ± 1.55.56 ± 0.543.71 ± 0.72
α-MSH (Ki)243 ± 27289 ± 292580 ± 5702730 ± 2302950 ± 510
β-MSH (Ki)163 ± 14126 ± 153750 ± 4103280 ± 4807660 ± 640
γ1-MSH (Ki)2200 ± 5503690 ± 2604150 ± 3403750 ± 8305180 ± 830
HS014 (Ki)493 ± 405.60 ± 0.224220 ± 7605100 ± 410627 ± 570

We also tested zebrafish receptor transfected cells in a cAMP assay with the intent to investigate if the receptors were able to couple to G-proteins after α-MSH stimulation. We used the same vector and cells as for the binding experiments. The results are shown in Fig. 5. α-MSH induced a dose dependent accumulation of intracellular cAMP through all three receptors. The three receptors reached similar levels of maximum response, which is in line with what we have observed for the human MC4 and MC5 receptors in response to α-MSH (Schiöth et al. 1998b).

image

Figure 5. Generation of cAMP in response to α-MSH for zMC4 (○), zMC5a (▮) and zMC5b (▴) receptors in intact transfected cells. Each point represents the average ± SEM. Untransfected HEK293-EBNA cells showed no cAMP response to α-MSH.

Download figure to PowerPoint

Tissue distribution was determined by RT-PCR. We isolated total RNA from heart, muscle, eye, the gastrointestinal tract (GI), total brain and ovary. The length of a zebrafish is only about 3 cm, and the brain only weighs a few milligrams. The results of the RT-PCR for each of the receptor genes are shown in Fig. 6. Each probe bound specifically to the designated clone and there were no signs of cross hybridization under our experimental conditions (see Fig. 6d). The zMC4 receptor was expressed in four tissues. There were strong signals in the GI and the ovary whereas there were weaker signals in the brain and the eye. No signals were seen in the heart or the muscle. The zMC5a transcript was also found in the same four tissues with strongest signals in the ovary, brain and GI tract, whereas the signal for the eye was weaker. The zMC5b gene was expressed in five tissues. Strong signals were found in the ovary, GI tract, brain and the eye, whereas a weaker signal was found in the heart. However, it should be noted that the PCR assay was not designed for quantification. The experiment was performed three times and there were no qualitative differences between the runs. cDNA from muscle did not show any positive signal and we confirmed the integrity of this sample by performing RT-PCR with a zebrafish bradykinin receptor probe previously found to show positive signal in this tissue (data not shown, Dunér et al. personal communication).

image

Figure 6. Expression of zMC4 (a), zMC5a (b) and zMC5b (c) receptor mRNA as determined by RT-PCR on zebrafish tissues. The tissues and the controls are denoted at the top of each figure. The left part shows the agarose gel stained with ethidium bromide. The right part shows a 4-h exposure on an X-ray film after hybridization with the corresponding probe. The predicted lengths of the PCR products were 355 bp (zMC4), 355 bp (zMC5a) and 325 bp (zMC5a). The PCR reactions were performed three times with qualitatively the same result. Cross-hydrization experiment for each of the probes against positive control PCR products is shown in (d).

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References

The zMC4, zMC5a, and zMC5b receptors share 69.8%, 71.3% and 69.6% overall amino acid identity with the respective human orthologues (see Table 1). Prior to this study we only had MC receptors from amniote species whose ancestors diverged about 450 million years ago from the lineage leading to zebrafish. The ancient time of divergence makes the amino acid identity percentages alone not entirely conclusive in determining which of the mammalian subtype the new receptors might belong to. Moreover, the mammalian MC4 and MC5 receptors (and MC3 receptors) show high degree of amino acid identity to each other (55–65%) and so do the zebrafish receptors we cloned. The phylogenetic analysis however, indicates clearly that the new receptors are one orthologue of the MC4 and two of the MC5 receptor. Both the maximum parsimony and neighbour joining analyses of the full-length receptor proteins show the same topology with regard to the zebrafish receptors with very high bootstrap values (see Fig. 2). The chromosomal localization also shows that there is some conserved synteny between the zMC4 receptor gene and HSA18, containing the human MC4 receptor gene (see Fig. 3). Moreover, the two zMC5 receptor genes lie in linkage groups in vicinity of several genes where the zebrafish has duplicate or orthologues of several single-copy mammalian genes, suggesting that the entire chromosome was duplicated. The zebrafish, like most teleost fishes, probably underwent a linage specific genome duplication approximately 250 million years ago (Amores et al. 1998; Postlethwait et al. 1998; Meyer and Schartl 1999; Taylor et al. 2001) even though it also has been suggested that the teleost fishes underwent frequent independent duplications (Aparicio 2000; Robinson-Rechavi et al. 2001). It is likely that the two copies of the MC5 receptors that we have found, may have resulted from this tetraploidization. Comparison of the two zMC5 receptor sequences indicates that the duplication is not a very recent event as perhaps could be concluded on the basis of the similar pharmacology of the receptors. Our molecular clock calculations date it to the same time period as has been proposed for the teleost tetraploidization, providing further support for the hypotheses that the teleost linage indeed underwent a major or whole genome duplication at the proposed time interval.

The MC protein sequences reported here show a relatively high degree of conservation with mammals as compared with other GPCRs or membrane-bound proteins from zebrafish. The predicted receptors not only show high overall identity to their mammalian orthologues, they also display several of the structural characteristics typical for the mammalian MC receptors, for example, a conserved Cys in the first extra cellular loop (EL), lack of Pro in TM5 and short EL and intracellular loops (IL) (see Fig. 1). The high degree of identity is, however, unevenly distributed over the different regions of the receptors. There are two regions in the zebrafish receptors that show low or no sequence identity, namely the N-terminal and the C-terminal regions. This is in line with results that show that the N-termini is not involved in the binding of the four MSH binding MC receptors (Schiöth et al. 1997). Experiments involving chimeric proteins, cassette mutations, and molecular modelling have suggested which regions within the MC receptors make up the ligand pocket (Schiöth et al. 1998c; Yang et al. 2000; Oosterom et al. 2001). The zebrafish receptors show a particularly high degree of conservation in these regions. It is remarkable that there is only one amino acid difference in the entire TM7 (estimated to be 25 amino acids long) between the zMC5a and the hMC5 receptors. Moreover there is more that 90% overall amino acid identity between the zebrafish and the human MC5 receptors in TM2, TM3 and TM7 (see Fig. 1). It is a general conception that peptide ligands have a higher degree of conservation than the corresponding, but much larger receptors. It is interesting to note that fairly large regions believed to participate in the ligand binding unit of the MC receptors have the same degree of evolutionary conservation as found for α-MSH.

The MSH peptides bind to the mammalian MC receptor subtypes without any major discrimination except that the MC2 receptor only binds ACTH. It is still possible to discriminate between the four other subtypes by careful radioligand binding analysis. It is interesting that the zMC4 receptor shows both of the unique characteristics of the human MC4 receptor. These are the relatively low affinity for γ-MSH and a slightly higher or similar affinity for β-MSH as compared with α-MSH. The physiological roles of γ- and β-MSH still remain obscure despite their high degree of evolutionary conservation. It is intriguing that β-MSH also has a higher affinity to the zMC4 receptor, in line with our previous results for the human receptor (Schiöth et al. 1996), now confirmed by another group (Harrold et al. 2001). Our new results support that β-MSH may have a specific and also an evolutionary conserved role for this receptor subtype. The two new zMC5 receptors had indistinguishable binding properties between them selves and to the hMC5 receptor, providing further support for the conclusion that these are indeed two copies of an ancestral MC5 receptor gene. The mouse MC5 receptor has been reported to have higher affinity for MSH peptides as compared with the hMC5 receptor. It has been speculated that this could be due to the lack of Cys in EL3 of the hMC5 receptor that is conserved in all the other MC receptors (Frändberg et al. 1997; Schiöth et al. 1998a). It is worth mentioning that the zMC5 receptor has this Cys in EL3 but still shares the human MC5 receptor pharmacology. HS014 is a synthetic cyclic MC4 receptor selective peptide. This substance has been widely used in physiological studies. It is interesting that this substance is the only one that has lower affinity for all three new zebrafish receptors as compared with the human ones. HS014 was developed by selection of ligands for the human MC receptor subtypes. It seems thus that even though the ability of the receptors to bind the natural peptides is highly conserved, the 3D binding cavity may not be as well conserved to fit this synthetic ligand. The data show that this peptide may not be as suitable for physiological studies in zebrafish as it has been in studies in rodents. We have also shown that the three fish MC receptors can functionally couple to the Gs linked signalling pathway in response to α-MSH. This is in line with all previous results found for expression of the mammalian MC receptors. Expression of the chicken MC receptors has not yet been reported, but our unpublished preliminary findings indicate that they couple in a similar manner.

Expression of mammalian MC4 receptors has only been found in brain tissue. The zMC4 receptor was also found in the brain but rather surprisingly also in the eye, GI tract and ovaries. Melanocytes from human choroid and iris respond to MSH (Smith-Thomas et al. 2001) through what is believed to be the MC1 receptor, but a search for other MC receptor subtypes in the different cell types in eyes that respond to MSH has, to the best of our knowledge, not yet been done. The GI tract has not got much attention within the MSH or MC receptor research community, despite the fact that the MC3 receptor subtype has been found in the GI tract of humans but not in other species like rat or mouse. It is believed that MSH peptides have several effects on the central regulation of reproductive processes, at least partially involving the MC4 receptor (Schiöth and Watanobe 2002). α-MSH was found to induce steroidogenesis of ovaries in rats (Durando and Celis 1998). POMC is also found to be expressed in the ovary of an African lungfish (Masini et al. 1997) and MSH peptides have been found in the ovaries of two teleost species, the sea bream and sea bass (Mosconi et al. 1994). The MC4 receptor is expressed in a wide variety of peripheral tissues in the chicken, including heart, adrenals, ovaries, testes, spleen and adipose tissues, and eye as well as brain (Takeuchi and Takahashi 1998; Teshigawara et al. 2001). Taken together, it seems that the expression pattern of the MC4 receptor in mammals is much more confined to central regions, as compared with zebrafish and chicken. This may indicate that this receptor has become more specific, and conceivably more important for central functions during mammalian evolution.

The MC5 receptor is expressed in a much wider range in mammalian tissues than any other MC receptor but no physiological function of this receptor is known beyond its role in secretion from exocrine glands (Chen et al. 1997). This receptor has been found in the adrenal gland, stomach, lung, spleen, skeletal muscle, skin, thymus, bone marrow, testis, leukocytes, lymph node, mammary gland, ovary, uterus, pineal gland, liver, fat cells and also in some cases in the brain including the pituitary (Barret 1994; Griffon et al. 1994; Labbéet al. 1994; Chhajlani 1996, see also review Schiöth 2001). The chicken expresses the MC5 receptor in the brain, kidney, liver, adrenals, ovary, testis and adipose tissue but was not found in the heart, spleen and skeletal muscle (Takeuchi and Takahashi 1998). The tissue expression of the two zMC5 receptors does comply with that for the ‘higher’ vertebrates with one exception, as we found expression of the zMC5b receptor in the heart. The only mammalian MC receptor found in the heart is the MC3 receptor but the role is unknown (Chhajlani 1996). These data could prompt the speculation that the zMC5b receptor may either be an ancient MC3 receptor or it may share some of its physiological functions. The phylogenetic, structural, genetic mapping and pharmacology analysis strongly suggests that the MC5b is indeed a duplicate copy of an ancient MC5 receptor gene, rendering the latter suggestion as more likely.

Classical models for evolution of duplicate genes predict that both genes survive only on rare occasions when one duplicate may acquire a new adaptive function and the other retains the old function, resulting in the preservation of both members of the pair (Ohno 1970). The recently developed degeneration complementation (DDC) model predicts however, that the usual mechanism of duplicate gene preservation is the partitioning of ancestral functions rather than the evolution of new functions (Force et al. 1999). The fact that the two copies of zebrafish MC5 receptors show similar pharmacology and are found in multiple tissues with somewhat different distribution pattern may indicate joint preservation of the functions of the parent gene, providing further support for the DDC hypothesis. It has recently been suggested that genes with broad tissue distribution may have a high degree of sequence conservation (Duret and Mouchiroud 2000). The widespread tissue distribution patterns for the MC5 receptors follows this pattern. Because the MC4 receptor is equally well conserved, it would appear likely that its widespread expression in zebrafish and chicken are representative for its role during vertebrate evolution whereas the narrow neuronal expression in mammals may be of more recent origin.

In conclusion, our data show that the MC4 and MC5 receptor subtypes were already present before the divergence of ray-finned fishes and tetrapods, early in vertebrate evolution. Thus, important structural and functional properties of the MC4 and MC5 receptors have been remarkably conserved over a period of at least 400 million years. The receptor clones will facilitate functional characterization of the MC receptors in zebrafish as well as further cloning in other nonamniote species and thereby allow further elucidation of the evolutionary origin and function of the complex MC receptor system. It is conceivable that the MC receptors arose even before the appearance of vertebrates, implying that these receptors participated in an important physiological role that might have to do with regulation of the energy homeostasis.

Acknowledgements

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References

The studies were supported by the Swedish Medical Research council (MRC), the Swedish Society for Medical Research (SSMF), Åke Wibergs Stiftelse and Melacure Therapeutics AB, Uppsala, Sweden to HBS, and NIH grant R01RR10715 to JHP.

References

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References
  • Amores A. A., Force Y.-L., Yan L., Joly C., Amemiya A., Fritz R. K., Ho J., Langeland V., Prince Y.-L., Wang M., Westerfield M., Ekker and , J. H. (1998) Postlethwait Zebrafish hox clusters and vertebrate genome evolution. Science 282, 17111714.DOI: 10.1126/science.282.5394.1711
  • Aparicio S. (2000) Vertebrate evolution: recent perspectives from fish. Trends Genet. 16, 5456.
  • Barrett P., MacDonald A., Helliwell R., Davidson G. and Morgan P. (1994) Cloning and expression of a new member of the melanocyte-stimulating hormone receptor family. J. Mol. Endocrinol. 12, 203213.
  • Cerda-Reverter J. M. and Larhammar D. (2000) Neuropeptide Y family of peptides: structure, anatomical expression, function, and molecular evolution. Biochem. Cell Biol. 78, 371392.
  • Chagnon Y. C., Chen W. J., Perusse L., Chagnon M., Nadeau A., Wilkison W. O. and Bouchard C. (1997) Linkage and association studies between the melanocortin receptors 4 and 5 genes and obesity-related phenotypes in the Quebec Family Study. Mol. Med. 3, 663667.
  • Chen W., Kelly M. A., Opitz-Araya X., Thomas R. E., Low M. J. and Cone R. D. (1997) Exocrine gland dysfunction in MC5-R.-deficient mice: evidence for coordinated regulation of exocrine gland function by melanocortin peptides. Cell 91, 789798.
  • Chen A. S., Marsh D. J., Trumbauer M. E., Frazier E. G. and Guan X. M., Yu H., Rosenblum C. I., Vongs A., Feng Y., Cao L., Metzger J. M., Strack A. M., Camacho R. E., Mellin T. N., Nunes C. N., Min W., Fisher J., Gopal-Truter S., MacIntyre D. E., Chen H. Y. and Van der Ploeg L. H. (2000) Inactivation of the mouse melanocortin-3 receptor results in increased fat mass and reduced lean body mass. Nat. Genet. 26, 97102.
  • Cheng Y. and Prusoff W. H. (1973) Relationship between the inhibition constant (Kt) and the concentration of inhibitor which causes 50 per cent inhibition (I50) of an enzymatic reaction. Biochem. Pharmacol. 22, 3108.
  • Chhajlani V. (1996) Distribution of cDNA for melanocortin receptor subtypes in human tissues. Biochem. Mol. Biol. Int. 38, 7380.
  • Chhajlani V., Muceniece R. and Wikberg J. E. (1993) Molecular cloning of a novel human melanocortin receptor. Biochem. Biophys. Res. Commun. 218, 638.
  • Danielson P. B. and Dores R. M. (1999) Molecular evolution of the opioid/orphanin gene family. Gen. Comp. Endocrinol. 113, 169186.DOI: 10.1006/gcen.1998.7206
  • Darlison M. G., Greten F. R., Harvey R. J., Kreienkamp H. J., Stuhmer T., Zwiers H., Lederis K. and Richter D. (1997) Opioid receptors from a lower vertebrate (Catostomus commersoni): sequence, pharmacology, coupling to G-protein-gated inward-rectifying potassium channel (GIRK1), and evolution. Proc. Natl Acad. Sci. USA 94, 82148219.
  • Dores R. M., McDonald L. K., Steveson T. C. and Sei C. A. (1990) The molecular evolution of neuropeptides: prospects for the ’90s. Brain Behav. Evol. 36, 8099.
  • Durando P. E. and Celis M. E. (1998) In vitro effect of alpha-MSH administration on steroidogenesis of prepubertal ovaries. Peptides 19, 667675.DOI: 10.1016/S0196-9781(97)00458-0
  • Duret L. and Mouchiroud D. (2000) Determinants of substitution rates in mammalian genes: expression pattern affects selection intensity but not mutation rate. Mol. Biol. Evol. 17, 6874.
  • Eberle A. N. (1988) The Melanotropins. Chemistry, Physiology and Mechanisms of Action (EberleA. N., eds), Karger, Basel.
  • Fan W., Boston B. A., Kesterson R. A., Hruby V. J. and Cone R. D. (1997) Role of melanocortinergic neurons in feeding and the agouti obesity syndrome. Nature 385, 165168.
  • Force A., Lynch M., Pickett F. B., Amores A., Yan Y. L. and Postlethwait J. (1999) Preservation of duplicate genes by complementary, degenerative mutations. Genetics 151, 15311545.
  • Frändberg P. A., Xu X. and Chhajlani V. (1997) Glutamine235 and arginine272 in human melanocortin 5 receptor determines its low affinity to MSH. Biochem. Biophys. Res. Commun. 236, 489492.
  • Gantz I., Miwa H., Konda Y., Shimoto Y., Tashiro T., De Watson S. J. I., Valle J. and Yamada T. (1993) Molecular cloning, expression, and gene localization of a fourth melanocortin receptor. J. Biol. Chem. 268, 1517415179.
  • Griffon N., Mignon V., Facchinetti P., Diaz J., Schwartz J. C. and Sokoloff P. (1994) Molecular cloning and characterization of the rat fifth melanocortin receptor. Biochem. Biophys. Res. Commun. 200, 10071014.DOI: 10.1006/bbrc.1994.1550
  • Harrold J. A., Widdowson P. and Williams G. (2001) Evidence that β-MSH is the endogenous anti-obesity ligand acting at hypothalamic melanocortin-4 receptors (Flier J. and Kahn B., eds), pp. 444, abstract 500. Keystone Symposia, Colorado.
  • Haskell-Luevano C., Cone R. D., Monck E. K. and Wan Y. P. (2001) Structure activity studies of the melanocortin-4 receptor by in vitro mutagenesis: identification of agouti-related protein (AGRP), melanocortin agonist and synthetic peptide antagonist interaction determinants. Biochemistry 40, 164179.
  • Hinney A., Schmidt A., Nottebom K., Heibult O., Becker I., Ziegler A., Gerber G., Sina M., Gorg T., Mayer H., Siegfried W., Fichter M., Remschmidt H. and Hebebrand J. (1999) Systematic mutation screening of the pro-opiomelanocortin gene: identification of several genetic variants including three different insertions, one nonsense and two missense point mutations in probands of different weight extremes. J. Clin. Endocrinol. Metab. 84, 14831486.
  • Hukriede N. A., Joly L., Tsang M., Miles J., Tellis P., Epstein J. A., Barbazuk W. B., Li F. N., Paw B., Postlethwait J. H., Hudson T. J., Zon L. I., McPherson J. D., Chevrette M., Dawid I. B., Johnson S. L. and Ekker M. (1999) Radiation hybrid mapping of the zebrafish genome. Proc. Natl Acad. Sci. USA 96, 97459750.
  • Huszar D., Lynch C. A., Fairchild-Huntress V., Dunmore J. H., Fang Q., Berkemeier L. R., Gu W., Kesterson R. A., Boston B. A., Cone R. D., Smith F. J., Campfield L. A., Burn P. and Lee F. (1997) Targeted disruption of the melanocortin-4 receptor results in obesity in mice. Cell 88, 131141.
  • Jonsson L., Skarphedinsson J. O., Skuladottir G. V., Atlason P. T., Eiriksdottir V. H., Franzson L. and Schioth H. B. (2001) Melanocortin receptor agonist transiently increases oxygen consumption in rats. Neuroreport 12, 37033708.
  • Kalra S. P., Dube M. G., Pu S., Xu B., Horvath T. L. and Kalra P. S. (1999) Interacting appetite-regulating pathways in the hypothalamic regulation of body weight. Endocr. Rev. 20, 68100.
  • Kask A., Rago L., Mutulis F., Pahkla R., Wikberg J. E. and Schioth H. B. (1998a) Selective antagonist for the melanocortin 4 receptor (HS014) increases food intake in free-feeding. Biochem. Biophys. Res. Commun. 245, 9093.DOI: 10.1006/bbrc.1998.8389
  • Kask A., Mutulis F., Muceniece R., Pahkla R., Mutule I., Wikberg J. E., Rago L. and Schioth H. B. (1998b) Discovery of a novel superpotent and selective melanocortin-4 receptor antagonist (HS024): evaluation in vitro and in vivo. Endocrinology 139, 50065014.
  • Labbé O., Desarnaud F., Eggerickx D., Vassart G. and Parmentier M. (1994) Molecular cloning of a mouse melanocortin 5 receptor gene widely expressed in peripheral tissues. Biochemistry 33, 45434549.
  • Lundell I., Eriksson H., Marklund U. and Larhammar D. (2001) Cloning and characterization of the guinea pig neuropeptide Y receptor Y5. Peptides 22, 357363.DOI: 10.1016/S0196-9781(01)00338-2
  • Manly K. F. (1993) A Macintosh program for storage and analysis of experimental genetic mapping data. Mamm. Genome 4, 303313.
  • Masini M. A., Sturla M., Pestarino M., Gallinelli A., Facchinetti F. and Uva B. M. (1997) Pro-opiomelanocortin (POMC) expression and immunolocalization of POMC-related peptides in the ovary of Protopterus annectens, an African lungfish. Peptides 18, 14111414.
  • Meyer A. and Schartl M. (1999) Gene and genome duplications in vertebrates. the one-to-four (-to-eight in fish) rule and the evolution of novel gene functions. Curr. Opin. Cell Biol. 11, 699704.
  • Mosconi G., Carnevali O., Facchinetti F., Radi D., Pestarino M., Vallarino M. and Polzonetti-Magni A. M. (1994) Ovarian melanotropic peptides and adaptation in two teleostean species: Sparus aurata L. and Dicentrarchus labrax L. Peptides 15, 927931.
  • Mountjoy K. G. and Wong J. (1997) Obesity, diabetes and functions for proopiomelanocortin-derived peptides. Mol. Cell Endocrinol. 128, 171177.
  • Nordstedt C. and Fredholm B. B. (1990) A modification of a protein-binding method for rapid quantification of cAMP in cell-culture supernatants and body fluid. Anal. Chem. 189, 231234.
  • Ohno S. (1970) Evolution by Gene Duplication. Springer-Verlag, Berlin.
  • Oosterom J., Garner K. M., Den Dekker W. K., Nijenhuis W. A., Gispen W. H., Burbach J. P., Barsh G. S. and Adan R. A. (2001) Common requirements for melanocortin-4 receptor selectivity of structurally unrelated melanocortin agonist and endogenous antagonist. J. Biol. Chem. 276, 931936.
  • Palyha O. C., Feighner S. D., Tan C. P., McKee K. K., Hreniuk D. L., Gao Y. D., Schleim K. D., Yang L., Morriello G. J., Nargund R., Patchett A. A., Howard A. D. and Smith R. G. (2000) Ligand activation domain of human orphan growth hormone (GH) secretagogue receptor (GHS-R.) conserved from pufferfish to humans. Mol. Endocrinol. 14, 160169.
  • Postlethwait J. H., Yan Y. L., Gates M. A., Horne S., Amores A., Brownlie A., Donovan A., Egan E. S., Force A., Gong Z., Goutel C., Fritz A., Kelsh R., Knapik E., Liao E., Paw B., Ransom D., Singer A., Thomson M., Abduljabbar T. S., Yelick P., Beier D., Joly J. S., Larhammar D., Rosa F., Westerfield M., Zon L. I., Johnson S. L. and Talbot W. S. (1998) Vertebrate genome evolution and the zebrafish gene map. Nat. Genet. 18, 345349.
  • Postlethwait J. H., Woods I. G., Ngo-Hazelett P., Yan Y. L., Kelly P. D., Chu F., Huang H., Hill-Force A. and Talbot W. S. (2000) Zebrafish comparative genomics and the origins of vertebrate chromosomes. Genome Res. 10, 18901902.
  • Prusis P., Schioth H. B., Muceniece R., Herzyk P., Afshar M., Hubbard R. E. and Wikberg J. E. S. (1997) Modeling of the three-dimensional structure of the human melanocortin 1 receptor, using an automated method and docking of a rigid cyclic melanocyte-stimulating hormone core peptide. J. Mol. Graph. Model. 15, 307317.
  • Robinson-Rechavi M., Marchand O., Escriva H., Bardet P. L., Zelus D., Hughes S. and Laudet V. (2001) Euteleost fish genomes are characterized by expansion of gene families. Genome Res. 11, 781788.
  • Rubin D. A., Hellman P. , Zon L. I, Lobb C. J., Bergwitz C. and Juppner H. (1997)A G protein-coupled receptor from zebrafish is activated by human parathyroid hormone and not by human or teleost parathyroid hormone-related peptide. Implications for the evolutionary conservation of calcium-regulating peptide hormones. J. Biol. Chem. 274, 2818528190.
  • Sambrook J. and Russells D. W. (2001) Molecular Cloning, A Laboratory Manual, 3rd edn, Cold Spring Habor Laboratory Press, Cold Spring Harbor.
  • Schiöth H. B. (2001) The physiological role of melanocortin receptors. Vitamins Hormones 63, 195232.
  • Schiöth H. B. and Watanobe H. (2002) Melanocortins and reproductions. Brain Res. Rev. 38, 340–350 .
  • Schiöth H. B., Muceniece R., Wikberg J. E. S. and Chhajlani V. (1995) Characterisation of melanocortin receptor subtypes by radioligand binding analysis. Eur. J. Pharmacol. 288, 311317.
  • Schiöth H. B., Muceniece R. and Wikberg J. E. S. (1996) Characterisation of melanocortin 4 receptor by radioligand binding analysis. Pharmacol. Toxicol. 79, 161165.
  • Schiöth H. B., Petersson S., Muceniece R., Szardenings M. and Wikberg J. E. (1997) Deletions of the N-terminal regions of the human melanocortin receptors. FEBS Lett. 410, 223228.
  • Schiöth H. B., Fredriksson A., Carlsson C., Yook P., Muceniece R. and Wikberg J. E. (1998a) Evidence indicating that the extracellular loops of the mouse MC5 receptor do not participate in ligand binding. Mol. Cell. Endocrinol. 139, 109115.
  • Schiöth H. B., Mutulis F., Muceniece R., Prusis P. and Wikberg J. E. S. (1998b) Discovery of novel melanocortin 4 receptor selective MSH analogues. Br. J. Pharmacol. 124, 7582.
  • Schiöth H. B., Yook P., Muceniece R., Prusis P., Wikberg J. E. S. and Szardenings M. (1998c) Chimeric melanocortin MC1 and MC3 receptors: identification of domains participating in binding of melanocyte-stimulating hormone peptides. Mol. Pharmacol. 54, 154161.
  • Skuladottir G. V., Jonsson L., Skarphedinsson J. O., Mutulis F., Muceniece R., Raine A., Mutule I., Helgason J., Prusis P., Wikberg J. E. and Schioth H. B. (1999) Long term orexigenic effect of a novel melanocortin 4 receptor selective antagonist. Br. J. Pharmacol. 126, 2734.
  • Smith-Thomas L. C., Moustafa M., Dawson R. A., Wagner M., Balafa C., Haycock J. W., Krauss A. H., Woodward D. F. and MacNeil S. (2001) Cellular and hormonal regulation of pigmentation in human ocular melanocytes. Pigment Cell Res. 14, 298309.DOI: 10.1034/j.1600-0749.2001.140411.x
  • Takeuchi S. and Takahashi S. (1998) Melanocortin receptor genes in the chicken – tissue distributions. Gen. Comp. Endocrinol. 112, 220231.
  • Taylor J. S., Van De Peer Y., Braasch I. and Meyer A. (2001) Comparative genomics provides evidence for an ancient genome duplication event in fish. Philos. Trans. R. Soc. Lond. B Biol. Sci. 356, 16611679.
  • Teshigawara K., Takahashi S., Boswell T., Li Q., Tanaka S. and Takeuchi S. J. (2001) Identification of avian alpha-melanocyte-stimulating hormone in the eye: temporal and spatial regulation of expression in the developing chicken. J. Endocrinol. 168, 527537.
  • Thompson J. D., Higgins D. G. and Gibson T. J. (1994) CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22, 46734680.
  • Woods I. G., Kelly P. D., Chu F., Ngo-Hazelett P., Yan Y. L., Huang H., Postlethwait J. H. and Talbot W. S. (2000) A comparative map of the zebrafish genome. Genome Res. 10, 19031914.
  • Yang Y. K., Fong T. M., Dickinson C. J., Mao C., Li J. Y., Tota M. R., Mosley R., Van Der Ploeg L. H. and Gantz I. (2000) Molecular determinants of ligand binding to the human melanocortin-4 receptor. Biochemistry 39, 1490014911.