SEARCH

SEARCH BY CITATION

Keywords:

  • amygdala;
  • neuroactive steroids;
  • pregnancy;
  • transgenic mice;
  • Y1 receptor for neuropeptide Y

Abstract

  1. Top of page
  2. Abstract
  3. Experimental procedures
  4. Materials
  5. Animals
  6. Treatment protocol
  7. Steroid extraction and assay
  8. β-Galactosidase staining
  9. Quantitation of transgene expression
  10. In situ hybridization
  11. Quantitation of Y1 receptor mRNA expression
  12. Statistical analysis
  13. Results
  14. Effects of pregnancy on steroid concentrations in the cerebral cortex
  15. Effects of pregnancy on Y1R/LacZ transgene expression in the medial amygdala
  16. Effects of pregnancy on Y1 receptor mRNA expression in the medial amygdala
  17. Discussion
  18. Acknowledgements
  19. References

Long-term administration of progesterone or allopregnanolone was previously shown to increase Y1 receptor gene expression in the medial amygdala of Y1R/LacZ transgenic mice, which harbor a construct comprising the murine Y1 receptor gene promoter and a lacZ reporter. We have now investigated the effects of physiological fluctuations in the cerebrocortical concentrations of neuroactive steroids during pregnancy on Y1R/LacZ transgene expression by quantitative histochemical analysis of β-galactosidase activity. Cerebrocortical concentrations of progesterone and its metabolites allopregnanolone and allotetrahydrodeoxycorticosterone were increased on day 18 of pregnancy and had returned to control values 2 days after delivery. Transgene expression in the medial amygdala was also increased on day 18 of pregnancy and had returned to control values 2 days after delivery. Similar results were obtained after analysis of Y1R mRNA levels in the medial amygdala of pregnant mice by in situ hybridization. Administration of the 5α-reductase inhibitor finasteride to pregnant mice prevented both the increase in the cerebrocortical concentrations of neuroactive steroids as well as the increase in transgene expression. These data suggest that fluctuations in the brain concentrations of endogenous neuroactive steroids during pregnancy are associated with changes in Y1 receptor gene expression in the medial amygdala, further supporting a functional interaction between the GABAergic and NPY–Y1 receptor systems.

Abbreviations used
AOI

area of interest

AP

allopregnanolone

NPY

neuropeptide Y

PBS

phosphate-buffered saline

SSC

saline sodium citrate buffer

THDOC

allotetrahydrodeoxycorticosterone.

Neuropeptide Y (NPY) is one of the most abundant peptides in the CNS, with its concentration being especially high within limbic and cortical regions (Tatemoto et al. 1982). NPY plays an important role in the regulation of both emotional behavior and responsiveness to stressful stimuli, inducing behavioral responses similar to those observed with positive modulators of the GABAA receptor complex such as benzodiazepines and neuroactive steroids. Central administration of NPY thus produces an anxiolytic effect (Heilig et al. 1989; Wettstein et al. 1994; Bannon et al. 2000; Thorsell et al. 2000; Kask et al. 2001) and sedation at high doses (Fuxe et al. 1983; Yamada et al. 1996; Naveilhan et al. 2001a,b), and it reduces CNS excitability in a manner consistent with an anticonvulsant action (Erickson et al. 1996; Vezzani et al. 1999). Studies with agonists, antagonists and antisense oligonucleotides indicate that the anxiolytic and anti-stress actions of NPY are mediated through activation of Y1 receptors in the amygdala, a structure that is important for fear and anxiety in both experimental animals and humans (Davis et al. 1994; LeDoux 2000). Intracerebroventricular administration or direct injection into the amygdaloid complex of Y1 receptor agonists elicits an anxiolytic effect in several behavioral models, including the elevated plus maze (Broqua et al. 1995), the conflict test (Heilig et al. 1993; Britton et al. 1997, 2000), and the social interaction test (Sajdyk et al. 1999). In contrast, the central administration of Y1 receptor antagonists or antisense oligonucleotides complementary to Y1 receptor mRNA induce behavioral signs of anxiety (Wahlestedt et al. 1993; Heilig 1995; Kask et al. 1997).

Various lines of evidence suggest the existence of a functional interaction between GABAergic neurotransmission and that mediated by NPY and the Y1 receptor (NPY-Y1) in the amygdala. Neuroanatomical studies have demonstrated that GABA and NPY coexist in neurons of the amygdaloid complex and suggest that NPY may directly modulate the activity of GABAergic neurons by stimulating Y1 receptors (Gustafson et al. 1986; McDonald and Pearson 1989; Oberto et al. 2001). In addition, the anxiolytic benzodiazepine diazepam was shown to block the anxiogenic effect of Y1 receptor antagonists (Kask et al. 1996), suggesting that GABAergic and NPY-Y1 transmission may interact in the regulation of anxious behavior.

With the use of a transgenic mouse model, we recently obtained further support for a functional coupling between these two systems in the amygdala. With transgenic mice harboring a construct comprising the murine Y1 receptor gene promoter fused to a lacZ reporter gene (Y1R/LacZ mice) (Oberto et al. 1998), we thus showed that long-term treatment with positive (diazepam or abecarnil) or negative (FG7142) modulators of GABAA receptor function induced a marked increase or decrease, respectively, in Y1 receptor gene expression in the medial amygdala (Oberto et al. 2000). Furthermore, long-term treatment of these animals with progesterone or its 3α-reduced metabolite allopregnanolone (AP) increased Y1 receptor gene expression in the medial amygdala (Ferrara et al. 2001), an effect similar to that induced by diazepam or abecarnil. This latter observation thus suggested that a persistent increase in the brain concentration of neuroactive steroids might affect NPY-Y1 transmission through modulation of GABAA receptor function.

Progesterone and the deoxycorticosterone derivatives AP and allotetrahydrodeoxycorticosterone (THDOC) are endogenous neuroactive steroids that bind in a stereoselective manner and with high affinity to a steroid recognition site on the GABAA receptor complex. They thereby both potentiate the response of the associated Cl channel to GABA (Majewska et al. 1986; Puia et al. 1990; Paul and Purdy 1992; Lambert et al. 1995; Rupprecht and Holsboer 1999) and elicit anxiolytic, anticonvulsant, and hypnotic-anesthetic effects in vivo similar to those induced by other positive allosteric modulators of GABAA receptors (Belelli et al. 1989; Bitran et al. 1991; Wieland et al. 1991; Kokate et al. 1994; Frye 1995; Concas et al. 1996; Brot et al. 1997; Devaud et al. 1997). Moreover, the behavioral, neurochemical and functional GABAergic responses induced by fluctuations in the brain concentrations of neurosteroids during physiological (pregnancy and delivery) or pharmacological (long-term treatment with progesterone and progesterone withdrawal) conditions are associated with changes in GABAA receptor subunit gene expression (Concas et al.1998; Follesa et al. 1998, 2000, 2001; Smith et al. 1998a,b).

We have now investigated whether physiological fluctuations in the brain concentrations of endogenous neuroactive steroids also modulate Y1 receptor gene expression in the medial amygdala of Y1R/LacZ transgenic mice. Given that pregnancy and delivery are two physiological conditions associated with marked changes in the brain concentrations of progesterone, AP, and THDOC (Concas et al. 1998, 1999; Follesa et al. 1998, 2001), we used pregnant Y1R/LacZ transgenic mice as an experimental model to examine further the functional coupling between endogenous neuroactive steroids and Y1 receptors.

Animals

  1. Top of page
  2. Abstract
  3. Experimental procedures
  4. Materials
  5. Animals
  6. Treatment protocol
  7. Steroid extraction and assay
  8. β-Galactosidase staining
  9. Quantitation of transgene expression
  10. In situ hybridization
  11. Quantitation of Y1 receptor mRNA expression
  12. Statistical analysis
  13. Results
  14. Effects of pregnancy on steroid concentrations in the cerebral cortex
  15. Effects of pregnancy on Y1R/LacZ transgene expression in the medial amygdala
  16. Effects of pregnancy on Y1 receptor mRNA expression in the medial amygdala
  17. Discussion
  18. Acknowledgements
  19. References

Adult female Y1R/LacZ mice from transgenic line 62 (body mass, 25–30 g) obtained from our breeding colony were used for the experiments (Oberto et al. 1998). Y1R/LacZ transgenic mice were created and maintained on an FVB inbred background and were genetically identical. Mice were housed in cages (4–5 mice per cage) with free access to food and water, and were maintained on a 12-h light/dark cycle and at a constant temperature of 22 ± 2°C. Experiments were performed at the same time on each day to avoid any circadian effects. Animal care and handling throughout the experimental procedures were in accordance with the European Community Council Directive of 24 November 1986 (86/609/EEC), and the experimental protocol was approved by the Animal Investigation Committee of the Ministero dell'Università e della Ricerca Scientifica e Tecnologica.

Treatment protocol

  1. Top of page
  2. Abstract
  3. Experimental procedures
  4. Materials
  5. Animals
  6. Treatment protocol
  7. Steroid extraction and assay
  8. β-Galactosidase staining
  9. Quantitation of transgene expression
  10. In situ hybridization
  11. Quantitation of Y1 receptor mRNA expression
  12. Statistical analysis
  13. Results
  14. Effects of pregnancy on steroid concentrations in the cerebral cortex
  15. Effects of pregnancy on Y1R/LacZ transgene expression in the medial amygdala
  16. Effects of pregnancy on Y1 receptor mRNA expression in the medial amygdala
  17. Discussion
  18. Acknowledgements
  19. References

Stage of estrous cycle (diestrus, proestrus, or estrus) was determined from daily vaginal smears collected between 10:00 and 11:00 h for 2 weeks. For the induction of pregnancy, females were caged with fertile males on the evening of proestrus. Mating was verified by the detection of a vaginal plug on the morning of the next day, which was designated day 1 of pregnancy. Pregnant mice were housed in individual cages and killed by cervical dislocation on day 18 of pregnancy. Lactating mice were housed in individual cages with their litters and killed by cervical dislocation on day 2 or 7 after delivery. Other mice were treated in parallel with a subcutaneous injection of finasteride (25 mg/kg body mass) or vehicle once a day (at 12:00 h) from day 12 to day 17 of pregnancy. Estrus mice were also injected with finasteride or vehicle for 6 days. Finasteride was dissolved in a mixture of ethanol (20%, v/v) and corn oil (80%) and was injected in a volume of 3 mL/kg; control mice received the same amount of vehicle. The brain was rapidly removed from killed mice, and the two hemispheres were separated. One of the hemispheres was immediately frozen in 10% (v/v) embedding medium (Bio-optica, Milan, Italy) in phosphate-buffered saline (PBS) on dry ice for β-galactosidase staining and quantitation of transgene expression. The cerebral cortex of the second hemisphere was dissected and immediately frozen with dry ice for determination of steroid concentrations.

Steroid extraction and assay

  1. Top of page
  2. Abstract
  3. Experimental procedures
  4. Materials
  5. Animals
  6. Treatment protocol
  7. Steroid extraction and assay
  8. β-Galactosidase staining
  9. Quantitation of transgene expression
  10. In situ hybridization
  11. Quantitation of Y1 receptor mRNA expression
  12. Statistical analysis
  13. Results
  14. Effects of pregnancy on steroid concentrations in the cerebral cortex
  15. Effects of pregnancy on Y1R/LacZ transgene expression in the medial amygdala
  16. Effects of pregnancy on Y1 receptor mRNA expression in the medial amygdala
  17. Discussion
  18. Acknowledgements
  19. References

Steroids present in cerebral cortical homogenates were extracted three times with ethyl acetate, and the combined organic phases were dried under vacuum. The resulting residue was dissolved in 5 mL of n-hexane and applied to a SepPak silica cartridge (Waters, Milford, MA, USA), and components were eluted with n-hexane and 2-propanol (7 : 3, v/v). Steroids were separated and further purified by HPLC on a 5-µm Lichrosorb-diol column (250 by 4 mm; Phenomenex, Torrance, CA, USA) with a discontinuous gradient of 2-propanol (0–30%, v/v) in n-hexane. The recovery (70–80%) of steroids through the extraction and purification procedures was monitored by adding trace amounts of a mixture of [3H]progesterone, [3H]AP, and [3H]THDOC (6000–8000 cpm of each; 20–80 Ci/mmol) to the brain homogenate. Steroids were quantified by radioimmunoassay as previously described (Serra et al. 2000), with specific antibodies to progesterone, to AP, and to THDOC that were generated in rabbit and sheep, respectively, and characterized as described (Purdy et al. 1990). Protein concentration was measured by the method of Lowry et al. (1951) with bovine serum albumin as standard.

β-Galactosidase staining

  1. Top of page
  2. Abstract
  3. Experimental procedures
  4. Materials
  5. Animals
  6. Treatment protocol
  7. Steroid extraction and assay
  8. β-Galactosidase staining
  9. Quantitation of transgene expression
  10. In situ hybridization
  11. Quantitation of Y1 receptor mRNA expression
  12. Statistical analysis
  13. Results
  14. Effects of pregnancy on steroid concentrations in the cerebral cortex
  15. Effects of pregnancy on Y1R/LacZ transgene expression in the medial amygdala
  16. Effects of pregnancy on Y1 receptor mRNA expression in the medial amygdala
  17. Discussion
  18. Acknowledgements
  19. References

Expression of lacZ was analyzed by histochemical staining of coronal brain sections for β-galactosidase activity, as previously described (Oberto et al. 1998). Coronal sections of the brain (thickness, 25 µm) were cut with a cryostat at −20 to −25°C, beginning at the level corresponding to the end of the anterior commissure, and were collected on clean glass slides. Sections were dehydrated for 5 min on ice with acetone–chloroform (1 : 1, v/v), dried in air, fixed for 10 s with 2.5% (v/v) glutaraldehyde in PBS, and incubated for 48 h at 30°C in PBS containing X-gal (1 mg/mL), 5 mm potassium ferricyanide, 5 mm potassium ferrocyanide, 2 mm MgCl2, and 0.01% (v/v) Triton X-100. Slides were washed twice for 5 min with water, after which the sections were counterstained with nuclear fast red and covered with DPX mounting medium (Fluka, Buchs, Switzerland) and cover slips.

Quantitation of transgene expression

  1. Top of page
  2. Abstract
  3. Experimental procedures
  4. Materials
  5. Animals
  6. Treatment protocol
  7. Steroid extraction and assay
  8. β-Galactosidase staining
  9. Quantitation of transgene expression
  10. In situ hybridization
  11. Quantitation of Y1 receptor mRNA expression
  12. Statistical analysis
  13. Results
  14. Effects of pregnancy on steroid concentrations in the cerebral cortex
  15. Effects of pregnancy on Y1R/LacZ transgene expression in the medial amygdala
  16. Effects of pregnancy on Y1 receptor mRNA expression in the medial amygdala
  17. Discussion
  18. Acknowledgements
  19. References

Quantitation of Y1R/LacZ transgene expression was performed by computer-assisted morphometric analysis of β-galactosidase histochemical staining as previously described (Oberto et al. 2000). Quantitative image analysis was performed by one observer on coded sections.

Three standardized sections of comparable levels of the medial amygdala (around bregma −1.70 mm) and four standardized sections of the medial habenula (around bregma −1.02 mm), defined by neuroanatomical criteria based on the mouse brain atlas of Franklin and Paxinos (1997), were examined for each animal. Selected sections were placed on a Zeiss Axioplan I microscope equipped with a 10 × objective, and the images were transferred via a black-and-white, charge-coupled device camera (PCO; VC44, Keilheim, Germany) to a digitizing board (LG-3; Scion, Frederick, MD) placed in a PowerPC 8200 Macintosh computer and were analyzed with NIH Image software (version 1.62; NIH, Bethesda, MD). Sections were observed and digitized first with the use of a built-in green filter in order to identify the extensions of the nuclei more readily. The area of interest (AOI) was defined by drawing a line along the boundary of the medial amygdaloid nucleus or of the medial habenula. The same sections were then digitized with a built-in red filter, resulting in a marked enhancement of the histochemical signal but a loss in definition of the nuclear boundaries. The AOI selected in the first image was finally superimposed on the second image to delimit the region in which dots should be counted. With the use of a manual threshold method, dots were selected, the corresponding image was converted to binary, and the number of dots and the extension of the AOI were automatically recorded. For each animal, the cumulative number of dots and the cumulative area of the analyzed sections were used to obtain the density of transgene expression (dots/µm2).

In situ hybridization

  1. Top of page
  2. Abstract
  3. Experimental procedures
  4. Materials
  5. Animals
  6. Treatment protocol
  7. Steroid extraction and assay
  8. β-Galactosidase staining
  9. Quantitation of transgene expression
  10. In situ hybridization
  11. Quantitation of Y1 receptor mRNA expression
  12. Statistical analysis
  13. Results
  14. Effects of pregnancy on steroid concentrations in the cerebral cortex
  15. Effects of pregnancy on Y1R/LacZ transgene expression in the medial amygdala
  16. Effects of pregnancy on Y1 receptor mRNA expression in the medial amygdala
  17. Discussion
  18. Acknowledgements
  19. References

Coronal brain sections (12-µm thick) were cut on a cryostat (Leitz 1720) at − 18°C and thaw-mounted onto glass slides (Bio-Optica). About 14 sections for each glass slide were mounted. An in situ hybridization protocol from Wisden and Morris (2002) was used. To strongly increase the signal four different 40-/45-mer oligonucleotide probes complementary to different regions of the murine Y1 receptor mRNA were used simultaneously (5′-to 3′ antisense sequences are: probe A, ATACTTGTCCTTGAACGCCGCAAGTGACACATTTTGGAAG; probe B, TCGCTTGGTCTCACTGGACCTGTACTTACTGTCCCGGATCTTGTC; probe C, GTCGGTCAGAATTTGATAGATCACAAAGGGCAGAGAAGAAGCCAC;probe D,AGAAACAGCAGATTGTGGTTGCAGGTGGCAATGATCTGGTGGTTC). In a pilot experiment, each of them gave, singularly, exactly the same pattern of labeling. The oligonucleotides were 3′ end labeled with [35S]dATP (Amersham Life Science, Milan, Italy) using terminal deoxynucleotide transferase (Life Technologies, Grand Island, NY, USA) to a specific activity of 200 000 dpm/µL and separated from unlabeled probe on a home-made Sephadex G25 column (for the resin Amersham Pharmacia Biotech, Piscataway, NJ, USA).

The hybridization solution contained 50% formamide, 4 × saline sodium citrate buffer (SSC), 10% dextran sulfate, 5 × Denhardt's solution, 200 µg/mL acid–alkali cleaved salmon sperm DNA, 100 µg/mL long chain polyadenylic acid, 25 mm sodium phosphate pH 7.0, 1 mm sodium pyrophosphate, 0.06 m dithiothreitol. Oligonucleotide probes (200 000 dpm/mL) were added to the hybridization solution and each slide was incubated in 150 µL overnight in a humidified chamber at 42°C. After hybridization, sections were washed shortly once in 1 × SSC at room temperature, and then for one hour in 1 × SSC at 55°C in a water bath with gentle shaking. Sections were then shortly rinsed in 0.1 × SSC, dehydrated in alcohol and air dried. Slides were exposed to X-ray film (Kodak BioMax MR-1 film, Rochester, NY, USA) at room temperature for 8–10 days.

Quantitation of Y1 receptor mRNA expression

  1. Top of page
  2. Abstract
  3. Experimental procedures
  4. Materials
  5. Animals
  6. Treatment protocol
  7. Steroid extraction and assay
  8. β-Galactosidase staining
  9. Quantitation of transgene expression
  10. In situ hybridization
  11. Quantitation of Y1 receptor mRNA expression
  12. Statistical analysis
  13. Results
  14. Effects of pregnancy on steroid concentrations in the cerebral cortex
  15. Effects of pregnancy on Y1R/LacZ transgene expression in the medial amygdala
  16. Effects of pregnancy on Y1 receptor mRNA expression in the medial amygdala
  17. Discussion
  18. Acknowledgements
  19. References

Sections from estrous mice and from mice on day 18 of pregnancy (P18) exposed simultaneously to the autoradiographic film were analyzed with a PowerMacintosh 7100 computer, acquiring images through a CCD camera (Ikegami, ICD 42-E) connected to a Nikon stereomicroscope (Stemi 2000-C). Images were digitized through a digitizing board (Pixelbuffer, Perceptics, Knoxville, TN, USA) and analyzed by means of NIH Image version 1.55 VDM (a public domain software written by W. Raysband, NIH, modified by Perceptics). Quantitative image analysis was performed by one observer on coded sections.

In order to avoid uneven light distribution, the image was corrected for the background (an area of developed film clear of sections) by using the appropriate software function. The background was measured for each developed film.

Calibration of the system was performed using a 12-point scale, obtained with co-exposed radioactive standards (Amersham Life Science) used to convert optical density to nCi of 14C-labeled polymer. The AOI for measurement was defined following the boundaries of the labeled region within the amygdala. Specific binding in the AOI was defined as the density of binding in the measured region minus non-specific binding in adjacent regions of the section.

Values from seven to eight adjacent sections were measured and averaged, yielding a mean value expressed in nCi per animal.

Effects of pregnancy on steroid concentrations in the cerebral cortex

  1. Top of page
  2. Abstract
  3. Experimental procedures
  4. Materials
  5. Animals
  6. Treatment protocol
  7. Steroid extraction and assay
  8. β-Galactosidase staining
  9. Quantitation of transgene expression
  10. In situ hybridization
  11. Quantitation of Y1 receptor mRNA expression
  12. Statistical analysis
  13. Results
  14. Effects of pregnancy on steroid concentrations in the cerebral cortex
  15. Effects of pregnancy on Y1R/LacZ transgene expression in the medial amygdala
  16. Effects of pregnancy on Y1 receptor mRNA expression in the medial amygdala
  17. Discussion
  18. Acknowledgements
  19. References

As expected (Concas et al. 1998, 1999), the cerebrocortical concentrations of progesterone, AP, and THDOC in Y1R/LacZ transgenic mice were markedly increased on day 18 of pregnancy, compared with those apparent on the day of estrus, and had returned to control values 2 days after delivery (Table 1). Finasteride administration from day 12 to day 17 of pregnancy did not significantly affect the increase in the cortical concentration of progesterone on day 18 of pregnancy (Table 2). In contrast, finasteride treatment resulted in marked inhibition of the increases in the concentrations of AP and THDOC in the cerebral cortex of pregnant Y1R/LacZ mice. The cortical concentrations of progesterone, AP, and THDOC in estrus mice treated with finasteride did not differ significantly from those of vehicle-treated estrus mice (Table 2).

Table 1.  Effects of pregnancy and delivery on cerebrocortical concentrations of progesterone, allopregnanolone and allotetrahydrodeoxycorticosterone
 Steroid (ng/g)
ProgesteroneAllopregnanoloneTHDOC
  1. THDOC, allotetrahydrodeoxycorticosterone. Data are means ± SEM of values from four to nine mice and are expressed as nanograms of steroid per gram of cortical tissue. One-way anova: progesterone, F1,3 = 22.56; AP, F1,3 = 13.08; THDOC, F1,3 = 13.26. *p < 0.01 versus estrus and days 2 and 7 after delivery (Newman–Keuls' test).

Estrus11.4 ± 1.211.6 ± 1.47 3.6 ± 0.6
Day 18 of pregnancy41.0 ± 4.8*20.9 ± 2.6*12.2 ± 1.3*
Day 2 after delivery16.4 ± 1.83 7.9 ± 1.6 3.5 ± 0.8
Day 7 after delivery18.4 ± 2.89 6.4 ± 1.1 5.8 ± 0.9
Table 2.  Effects of finasteride treatment on the concentrations of progesterone, allopregnanolone and allotetrahydrodeoxycorticosterone in the cerebral cortex of estrus and pregnant mice
 Steroid (ng/g)
ProgesteroneAllopregnanoloneTHDOC
  1. THDOC, allotetrahydrodeoxycorticosterone. Mice were treated with vehicle or finasteride (25 mg/kg, subcutaneous) from day 12 to day 17 of pregnancy and killed on day 18. Estrus mice were similarly treated with finasteride or vehicle for 6 days. Data are means ± SEM of values from four to 10 mice and are expressed as nanograms of steroid per gram of cortical tissue. One-way anova: progesterone, F1,3 = 19.14; AP, F1,3 = 11.48; THDOC, F1,3 = 11.49. *p < 0.01 versus estrus and estrus + finasteride; **p < 0.01 versus estrus, estrus + finasteride, and pregnant + finasteride (Newman–Keuls' test).

Estrus15.8 ± 1.711.6 ± 0.83.6 ± 0.5
Estrus + finasteride16.5 ± 3.0 9.4 ± 1.43.9 ± 0.1
Pregnant39.8 ± 2.8*24.2 ± 2.2**9.9 ± 1.3**
Pregnant + finasteride39.9 ± 3.9*15.8 ± 1.94.5 ± 0.4

Effects of pregnancy on Y1R/LacZ transgene expression in the medial amygdala

  1. Top of page
  2. Abstract
  3. Experimental procedures
  4. Materials
  5. Animals
  6. Treatment protocol
  7. Steroid extraction and assay
  8. β-Galactosidase staining
  9. Quantitation of transgene expression
  10. In situ hybridization
  11. Quantitation of Y1 receptor mRNA expression
  12. Statistical analysis
  13. Results
  14. Effects of pregnancy on steroid concentrations in the cerebral cortex
  15. Effects of pregnancy on Y1R/LacZ transgene expression in the medial amygdala
  16. Effects of pregnancy on Y1 receptor mRNA expression in the medial amygdala
  17. Discussion
  18. Acknowledgements
  19. References

Transgene expression was determined by histochemical staining for β-galactosidase activity with the chromogenic substrate X-gal in coronal sections of the medial amygdala and of the medial habenula (control region) from mice in estrus, during pregnancy (day 18), and after delivery (days 2 and 7). Images typical of those subjected to computer-assisted quantitation of β-galactosidase expression are shown in Fig. 1. Quantitative analysis of data demonstrated that β-galactosidase expression in the medial amygdala was significantly increased on day 18 of pregnancy and had returned to control values by day 2 after delivery, thereafter remaining unchanged for up to 7 days after delivery (Fig. 2).

image

Figure 1. Effects of pregnancy and delivery on Y1R/LacZ transgene expression in the medial amygdala. Coronal sections of the medial amygdala of mice in estrus (a), on day 18 of pregnancy in the absence (b) or presence (c) of finasteride treatment, or on day 2 after delivery (d) were subjected to histochemical staining for β-galactosidase activity. Scale bar = 100 µm.

Download figure to PowerPoint

image

Figure 2. Quantitation of Y1R/LacZ transgene expression in the medial amygdala and in the medial habenula of mice during pregnancy and after delivery. (a) Coronal sections of the medial amygdala (Me) or of the medial habenula (HAb) were subjected to quantitative analysis of β-galactosidase histochemical staining. Values are shown for mice in estrus (E), on day 18 of pregnancy (P18), and on days 2 (PD2) and 7 (PD7) after delivery. Data are expressed as the density of blue dots and are means ± SEM of values from five to nine mice. One-way anova: F1,3 = 9.22; *p < 0.01 versus E, PD2, and PD7 (Newman–Keuls' test). (b) Pregnant mice were injected daily with vehicle or finasteride (25 mg/kg, subcutaneous) from day 12 to day 17 and then killed on day 18 (P18 and P18 + F, respectively). Estrus mice were similarly treated with vehicle (VEH) or with finasteride (F) for 6 days. Coronal sections of the medial amygdala (Me) or of the medial habenula (HAb) were then analyzed for β-galactosidase activity as in (a). Data are means ± SEM of values from five to 10 mice. One-way anova: F1,3 = 20 591; *p < 0.01 versus VEH, F, and P18 + F (Newman–Keuls' test).

Download figure to PowerPoint

To clarify the roles of AP and THDOC in the changes in Y1 receptor gene expression during pregnancy, we treated mice daily with the selective 5α-reductase blocker finasteride (25 mg/kg) (Azzolina et al. 1997) from day 12 to day 17 of pregnancy and then killed the animals on day 18 (24 h after the last injection). Treatment with finasteride prevented the increase in β-galactosidase expression normally apparent in the medial amygdala of the transgenic mice on day 18 of pregnancy (Fig. 2). Similar finasteride treatment did not affect the extent of transgene expression in the medial amygdala of estrus mice as compared with that observed in vehicle-treated animals (Fig. 2). No significant changes in transgene expression were detected in the medial habenula either during pregnancy or after delivery. Treatment of pregnant or estrus mice with finasteride also had no effect on β-galactosidase activity in the medial habenula (Fig. 2).

Effects of pregnancy on Y1 receptor mRNA expression in the medial amygdala

  1. Top of page
  2. Abstract
  3. Experimental procedures
  4. Materials
  5. Animals
  6. Treatment protocol
  7. Steroid extraction and assay
  8. β-Galactosidase staining
  9. Quantitation of transgene expression
  10. In situ hybridization
  11. Quantitation of Y1 receptor mRNA expression
  12. Statistical analysis
  13. Results
  14. Effects of pregnancy on steroid concentrations in the cerebral cortex
  15. Effects of pregnancy on Y1R/LacZ transgene expression in the medial amygdala
  16. Effects of pregnancy on Y1 receptor mRNA expression in the medial amygdala
  17. Discussion
  18. Acknowledgements
  19. References

To provide evidence on the mechanisms by which pregnancy alters Y1 receptor gene expression, the levels of Y1 receptor mRNA were analyzed in the medial amygdala of pregnant Y1R/LacZ transgenic mice by in situ hybridization. Images representative of those subjected to computer-assisted quantitation of expression of Y1 receptor mRNA are shown in Fig. 3.

image

Figure 3. Effects of pregnancy on Y1 receptor mRNA expression in the medial amygdala. Low power magnification of an autoradiogram illustrating the neuroanatomical distribution of Y1 receptor mRNA visualized by in situ hybridization on a coronal brain section from an estrous female mice (a). Scale bar = 1 mm. High power magnification of autoradiograms showing the right medial amygdala of female mice in estrus (b) and on day 18 of pregnancy (c). Original sections were hybridized with four oligonucleotide probes and exposed to X-ray film for 8 days. The figure is representative of results obtained from four to six mice in each group. Scale bar = 0.5 mm.

Download figure to PowerPoint

Quantitative analysis of data demonstrated that Y1 receptor mRNA expression in the medial amygdala was significantly increased on day 18 of pregnancy as compared to estrous mice (nCi, mean ± SEM: estrous, 61 ± 7.2; P18, 87 ± 7.2, n = 4; p < 0.05 by Student's t-test).

Discussion

  1. Top of page
  2. Abstract
  3. Experimental procedures
  4. Materials
  5. Animals
  6. Treatment protocol
  7. Steroid extraction and assay
  8. β-Galactosidase staining
  9. Quantitation of transgene expression
  10. In situ hybridization
  11. Quantitation of Y1 receptor mRNA expression
  12. Statistical analysis
  13. Results
  14. Effects of pregnancy on steroid concentrations in the cerebral cortex
  15. Effects of pregnancy on Y1R/LacZ transgene expression in the medial amygdala
  16. Effects of pregnancy on Y1 receptor mRNA expression in the medial amygdala
  17. Discussion
  18. Acknowledgements
  19. References

Both GABA and NPY play important roles in the regulation of feeding, brain cell excitability, sedation, and anxiety (Griebel 1999; Kalra et al. 1999; Vezzani et al. 1999). Some of these actions of NPY involve interaction with GABAergic transmission (Kask et al. 1996; Pu et al. 1999; Naveilhan et al. 2001a,b; Ovesjöet al. 2001). Colocalization of GABA and NPY has been demonstrated in the arcuate nucleus of the hypothalamus, in the cerebral cortex, in the hippocampus, and in several limbic structures (Hendry 1993; Hendry et al. 1984; Aoki and Pickel 1990; Horvath et al. 1997; Pu et al. 1999). GABAergic and NPY-Y1 transmission are anatomically and functionally coupled in the amygdaloid complex, and they may act together in the regulation of emotional behavior (Gustafson et al. 1986; McDonald and Pearson 1989; Oberto et al. 2001). Consistent with this notion, wehave recently shown that long-term administration of positive or negative modulators of the GABAA receptor complex induces compensatory changes in Y1 receptor gene expression in the medial amygdala (Oberto et al. 2000). In addition, we demonstrated that a sustained increase in the brain concentrations of neuroactive steroids, induced by long-term treatment with progesterone or AP, resulted in an increase in Y1R/LacZ expression in the medial amygdala similar to that elicited by chronic administration of benzodiazepines (Ferrara et al. 2001).

We have now shown that physiological fluctuations in the brain concentrations of endogenous AP and THDOC during pregnancy are associated with an increase in Y1R/LacZ gene expression in the medial amygdala. In addition, we found that levels of Y1 receptor mRNA in the medial amygdala were also increased on day 18 of pregnancy, suggesting that changes in transgene expression reflect parallel changes in the endogenous Y1 receptor gene that are achieved, at least in part, via transcriptional mechanisms.

The administration of finasteride from day 12 to day 17 ofpregnancy prevented both the accumulation of AP andTHDOC in the cerebral cortex as well as the increase in Y1R/LacZ gene expression in the amygdala normally apparent on day 18 of pregnancy. These observations thus suggest that the increase in Y1 receptor gene expression in the medial amygdala during pregnancy is mediated by AP and THDOC and their selective action at the GABAA receptor, an effect similar to that elicited by benzodiazepines (Oberto et al. 2000). Since many receptors others than GABAA (i.e. nicotinic and serotoninergic receptors) have been identified as potential targets for a modulation by various neuroactive steroids (Rupprecht and Holsboer 1999), the possibility that these compounds modulate NPY-Y1 receptor expression by acting on these receptors can not be ruled out. Nevertheless, since the concentrations of neurosteroids required for modulations of the other receptors is in the micromolar range, the physiological relevance of such modulation is doubted. Moreover, it is also unlikely that the effect observed is mediated by the two neurosteroids metabolites, DHP and DHDOC, which can induce transcription via progesterone receptors (Rupprecht et al. 1993), or by dehydrotestosterone, that can induce transcription via androgen receptor, and which synthesis is inhibited by finasteride.

Both AP and THDOC potently enhance GABAA receptor responses in vitro (Majewska et al. 1986; Puia et al. 1990; Paul and Purdy 1992; Lambert et al. 1995), an effect that is associated with marked anticonvulsant, anxiolytic, and sedative activity when these compounds are administered in vivo (Belelli et al. 1989; Bitran et al. 1991; Wieland et al. 1991; Kokate et al. 1994; Frye 1995; Concas et al. 1996; Brot et al. 1997; Devaud et al. 1997). Fluctuations in the brain concentrations of neuroactive steroids, induced by pharmacological, physiological or pathological conditions, result in changes in neuronal excitability and, in turn, in alteration of emotional state, sleep pattern and seizure threshold (Majewska 1992; Engel and Grant 2001; Griffin et al. 2001; Wang et al. 2001). At the molecular level, such effects are associated with changes in the efficacy of GABA and of allosteric modulators (benzodiazepines and AP) at the GABAA receptor as well as with changes in the expression of GABAA receptor subunits (Concas et al. 1998, 1999; Follesa et al. 1998, 2000, 2001; Smith et al. 1998a,b). We now propose that the high concentrations achieved by neurosteroids in the cerebral cortex of mice during pregnancy might play a major role in modulation of both GABAA and Y1 receptor gene expression. Indeed, the reduction in the brain concentrations of these steroids elicited either by a physiological condition (delivery) or by pharmacological treatment (finasteride) reversed or prevented the pregnancy-associated changes in both systems.

Both NPY and positive modulators of GABAA receptors (benzodiazepines, neurosteroids) induce similar and marked anxiolytic effects in a variety of behavioral tests of anxiety. Several lines of evidence thus indicate that NPY, like benzodiazepines, exerts direct actions in the CNS to reduce the behavioral, physiological and endocrine responses to stressful stimuli, and it has been suggested that endogenous NPY counteracts stress and anxiety (Heinrichs et al. 1993; Heilig et al. 1994; Gue et al. 1996; Yamada et al. 1996; Thorsell et al. 2000). Data presented in this study suggest that changes in Y1 receptor gene expression during pregnancy are region-specific. The amygdaloid complex has recently been implicated as a brain region that plays an important role in mediating the anxiolytic action of neuroactive steroids (Akwa et al. 1999). In addition, a growing body of evidence indicate an important functional interaction between these two neurochemical systems in this brain region (Gustafson et al. 1986; McDonald and Pearson 1989; Kask et al. 1996; Oberto et al. 2001) The large fluctuations in the brain concentrations of neuroactive steroids that occur during certain physiological conditions, such as pregnancy and menopause, as well as acute and chronic stress (Biggio and Purdy 2001), therefore might exert an important homeostatic action by modulating the plasticity of both GABAA receptor-mediated and NPY-Y1 neurotransmission in the amygdala in order to counteract the changes in neuronal excitability and the anxiety-like behavior also associated with such conditions.

In conclusion, we have shown that the physiological fluctuations in the brain concentrations of endogenous neuroactive steroids during pregnancy are associated with an increase of Y1 receptor gene transcription and expression, and that these changes are reversed by delivery or prevented by finasteride, both of which markedly reduce the brain levels of these hormones. Given that GABAA receptor gene expression is similarly modulated (Biggio et al. 2001), our data suggest that the secretion of neuroactive steroids is an important physiological determinant of GABAergic and NPY-Y1 transmission, both of which contribute to the modulation of emotional behavior.

Acknowledgements

  1. Top of page
  2. Abstract
  3. Experimental procedures
  4. Materials
  5. Animals
  6. Treatment protocol
  7. Steroid extraction and assay
  8. β-Galactosidase staining
  9. Quantitation of transgene expression
  10. In situ hybridization
  11. Quantitation of Y1 receptor mRNA expression
  12. Statistical analysis
  13. Results
  14. Effects of pregnancy on steroid concentrations in the cerebral cortex
  15. Effects of pregnancy on Y1R/LacZ transgene expression in the medial amygdala
  16. Effects of pregnancy on Y1 receptor mRNA expression in the medial amygdala
  17. Discussion
  18. Acknowledgements
  19. References

This work was supported by grant 9905045782 to CE from Ministero dell'Università e della Ricerca Scientifica e Tecnologica (Projects of National Relevance, Article 65DPR 382/80). We thank Professor GC Panzica, Sezione di Anatomia, Farmacologia e Medicina Legale, Università di Torino, for the helpful discussion during the preparation of the manuscript.

References

  1. Top of page
  2. Abstract
  3. Experimental procedures
  4. Materials
  5. Animals
  6. Treatment protocol
  7. Steroid extraction and assay
  8. β-Galactosidase staining
  9. Quantitation of transgene expression
  10. In situ hybridization
  11. Quantitation of Y1 receptor mRNA expression
  12. Statistical analysis
  13. Results
  14. Effects of pregnancy on steroid concentrations in the cerebral cortex
  15. Effects of pregnancy on Y1R/LacZ transgene expression in the medial amygdala
  16. Effects of pregnancy on Y1 receptor mRNA expression in the medial amygdala
  17. Discussion
  18. Acknowledgements
  19. References
  • Akwa Y., Purdy R. H., Koob G. F. and Britton K. T. (1999) The amigdala mediates the anxiolitic-like effect of neurosteroid allopregnanolone in rat. Behav. Brain Res. 106, 119125.
  • Aoki C. and Pickel V. M. (1990) Neuropeptide Y in cortex and striatum. Ultrastructural distribution and coexistence with classical neurotransmitters and neuropeptides. Ann. NY Acad. Sci. 611, 186205.
  • Azzolina B., Ellsworth K., Andersson S., Geissler W., Bull. H. G. and Harris G. S. (1997) Inhibition of rat α-reductases by finasteride: evidence for isozyme differences in the mechanism of inhibition. J.Steroid Biochem. Mol. Biol. 61, 5564.
  • Bannon A. W., Seda J., Carmouche M., Francis J. M., Norman M. H., Karbon B. and McCaleb M. L. (2000) Behavioral characterization of neuropeptide Y knockout mice. Brain Res. 868, 7987.
  • Belelli D., Bolger M. B. and Gee K. W. (1989) Anticonvulsant profile of the progesterone metabolite 5α-pregnan-3α-ol-20-one. Eur. J.Pharmacol. 166, 325329.
  • Biggio G. and Purdy R. H., eds. (2001) International Review of Neurobiology, Vol. 46: Neurosteroids and Brain Function. Academic Press, San Diego.
  • Biggio G., Follesa P., Sanna E., Purdy R. H. and Concas A. (2001) GABAA-receptor plasticity during long-term exposure to and withdrawal from progesterone. Int. Rev. Neurobiol. 46, 207241.
  • Bitran D., Hilvers R. J. and Kellogg C. K. (1991) Anxiolytic effects of 3α-hydroxy-5α[β]-pregnan-20-one: endogenous metabolites of progesterone that are active at the GABAA receptor. Brain Res. 561, 157161.
  • Britton K. T., Southerland S., Van Uden E., Kirby D., Rivier J. and Koob G. (1997) Anxiolytic activity of NPY receptor agonists in the conflict test. Psychopharmacology 132, 613.DOI: 10.1007/s002130050313
  • Britton K. T., Akwa Y., Spina M. G. and Koob G. F. (2000) Neuropeptide Y blocks anxiogenic-like behavioral action of corticotropin-releasing factor in an operant conflict test and elevated plus maze. Peptides 21, 3744.
  • Broqua P., Wettstein J. G., Rocher M. N., Gauthier-Martin B. and Junien J. L. (1995) Behavioral effects of neuropeptide Y receptor agonists in the elevated plus-maze and fear-potentiated startle procedures. Behav. Pharmacol. 6, 215222.
  • Brot M. D., Akwa Y., Purdy R. H., Koob G. F. and Britton K. T. (1997)The anxiolytic-like effects of the neurosteroid allopregnanolone: interactions with GABAA receptors. Eur. J. Pharmacol. 325, 17.
  • Concas A., Mostallino M. C., Perra C., Lener R., Roscetti G., Barbaccia M. L., Purdy R. H. and Biggio G. (1996) Functional correlation between allopregnanolone and [35S]-TBPS binding in the brainofrats exposed to isoniazid, pentylenetetrazol or stress. Br.J.Pharmacol. 118, 839846.
  • Concas A., Mostallino M. C., Porcu P., Follesa P., Barbaccia M. L., Trabucchi M., Purdy R. H., Grisenti P. and Biggio G. (1998) Role of brain allopregnanolone in the plasticity of gamma-aminobutyric acid type A receptor in rat brain during pregnancy and after delivery. Proc. Natl Acad. Sci. USA 95, 1328413289.
  • Concas A., Follesa P., Barbaccia M. L., Purdy R. H. and Biggio G. (1999) Physiological modulation of GABAA receptor plasticity by progesterone metabolites. Eur. J. Pharmacol. 375, 225235.
  • Davis M., Rainnie D. and Cassell M. (1994) Neurotransmission in the rat amygdala related to fear and anxiety. Trends Neurosci. 17, 208214.
  • Devaud L. L., Fritschy J. M., Sieghart W. and Morrow A. L. (1997) Bidirectional alterations of GABAA receptor subunit peptide levels in rat cortex during chronic ethanol consumption and withdrawal. J. Neurochem. 69, 126130.
  • Engel S. R. and Grant K. A. (2001) Neurosteroids and behavior. Int. Rev. Neurobiol. 46, 321348.
  • Erickson J., Clegg K. and Palmiter R. (1996) Sensitivity to leptin and susceptibility to seizures of mice lacking neuropeptide Y. Nature 381, 415418.
  • Ferrara G., Serra M., Zammaretti F., Pisu M. G., Panzica G. C., Biggio G. and Eva C. (2001) Chronic treatment with progesterone and with allopregnanolone increases NPY-Y1 receptor gene expression in the medial amygdaloid nucleus of transgenic mice. J. Neurochem. 79, 417425.
  • Follesa P., Floris S., Tuligi G., Mostallino M. C., Concas A. and Biggio G. (1998) Molecular and functional adaptation of the GABAA receptor complex during pregnancy and after delivery in the rat brain. Eur. J. Neurosci. 10, 29052912.
  • Follesa P., Serra M., Cagetti E., Pisu M. G., Porta S., Floris S., Massa F., Sanna E. and Biggio G. (2000) Allopregnanolone synthesis in cerebellar granule cells: roles in regulation of GABAA receptor expression and function during progesterone treatment and withdrawal. Mol. Pharmacol. 57, 12621270.
  • Follesa P., Concas A., Porcu P., Sanna E., Serra M., Mostallino M. C., Purdy R. H. and Biggio G. (2001) Role of allopregnanolone inregulation of GABAA receptor plasticity during long-term exposure and withdrawal from progesterone. Brain Res. Rev. 37, 8190.
  • Franklin K. B. J. and Paxinos G. (1997) The Mouse Brain in Stereotaxic Coordinates. Academic Press, San Diego and New York.
  • Frye C. A. (1995) The neurosteroid 3α,5α-THP has antiseizure and possible neuroprotective effects in an animal model of epilepsy. Brain Res. 696, 113120.
  • Fuxe K., Agnati L., Harfstrand A., Zini I., Tatemoto K., Pich E., Hokfelt V., Mutt V. and Terenius L. (1983) Central administrationof neuropeptide Y induces hypotension bradypnea and EEGsynchronization in the rat. Acta Physiol. Scand. 118, 189192.
  • Griebel G. (1999) Is there a future for neuropeptide receptor ligands inthe treatment of anxiety disorders? Pharmacol. Ther. 82, 161.
  • Griffin L. D., Conrad S. C. and Mellon S. H. (2001) Current perspectives on the role of neurosteroids in PMS and depression. Int. Rev. Neurobiol. 46, 479492.
  • Gue M., Junien J. L., Reeve J. R. Jr, Rivier J., Grandt D. and Tache Y. (1996) Reversal by NPY, PYY and 3–36 molecular forms of NPY and PYY of intracisternal CRF-induced inhibition of gastric acid secretion in rats. Br. J. Pharmacol. 118, 237242.
  • Gustafson E. L., Card J. P. and Moore R. Y. (1986) Neuropeptide Y localization in the rat amygdaloid complex. J. Comp. Neurol. 251, 349362.
  • Heilig M. (1995) Antisense inhibition of neuropeptide Y (NPY)-Y1 receptor expression blocks the anxiolytic-like action of NPY in amygdala and paradoxically increases feeding. Reg. Peptides 41, 6169.
  • Heilig M., Soderpalm B., Engel J. and Widerlov E. (1989) Centrally administered neuropeptide Y (NPY) produces anxiolytic-like effects in animal anxiety models. Psychopharmacology 94, 524529.
  • Heilig M., McLeod S., Brot M., Heinrichs S. C., Menzaghi F., Koob G.F. and Britton K. T. (1993) Anxiolytic-like action of neuropeptide Y: mediation by Y1 receptors in amygdala, and dissociation from foodintake effects. Neuropsychopharmacology 8, 357363.
  • Heilig M., Koob G. F., Elkman R. and Britton K. T. (1994) Corticotropin-releasing factor and neuropeptide Y: role in emotional integration. Trends Neurosci. 17, 8085.
  • Heinrichs S. C., Menzaghi F., Pich E. M., Hauger R. L. and Koob G. F. (1993) Corticotropin-releasing factor in the paraventricular nucleus modulates feeding induced by neuropeptide Y. Brain Res. 611, 1824.
  • Hendry S. H. (1993) Organization of NPY neurons in the mammalian central nervous system, in The Biology of Neuropeptide Y and Related Peptides (ColmersW. F. and WahlestedtC., eds), pp. 65156, Humana, Totowa, NJ.
  • Hendry S. H., Jones E. G., DeFelipe J., Schmechel D., Brandon C. and Emson P. C. (1984) Neuropeptide-containing neurons of the cerebral cortex are also GABAergic. Proc. Natl Acad. Sci. USA 81, 65266530.
  • Horvath T. L., Bechmann I., Naftolin F., Kalra S. P. and Leranth C. (1997) Heterogeneity in the neuropeptide Y-containing neurons of the rat arcuate nucleus: GABAergic and non-GABAergic subpopulations. Brain Res. 756, 283286.
  • Kalra S. P., Dube M. G., Pu S., Xu B., Horvath T. L. and Kalra P. S. (1999) Interacting appetite-regulating pathways in the hypothalamic regulation of body weight. Endocrine Rev. 20, 68100.
  • Kask A., Rago L. and Harro J. (1996) Anxiogenic-like effect of the neuropeptide Y Y1 receptor antagonist BIBP3226: antagonism with diazepam. Eur. J. Pharmacol. 317, R3R4.
  • Kask A., Rago L. and Harro J. (1997) α-Helical CRF9-41 prevents anxiogenic-like effect of NPY Y1 receptor antagonist BIBP3226 in rats. Neuroreport 8, 36453647.
  • Kask A., Nguyen H. P., Pabst R. and Von Hörsten S. (2001) Neuropeptide Y Y1 receptor-mediated anxiolysis in the dorsocaudal lateral septum: functional antagonism of corticotropin-releasing hormone-induced anxiety. Neuroscience 104, 799806.DOI: 10.1016/S0306-4522(01)00116-6
  • Kokate T. G., Svensson B. E. and Rogawski M. A. (1994) Anticonvulsant activity of neurosteroids: correlation with γ-aminobutyric acid-evoked chloride current potentiation. J. Pharmacol. Exp. Ther. 270, 12231229.
  • Lambert J. J., Belelli D., Hill-Venning C. and Peters A. P. (1995) Neurosteroids and GABAA receptor function. Trends Pharmcol. Sci. 16, 295303.
  • LeDoux J. E. (2000) Emotion: circuits in the brain. Annu. Rev. Neurosci. 23, 155184.
  • Lowry O. H., Rosebrough N. J., Farr A. L. and Randall L. J. (1951) Protein measurement with the folin phenol reagent. J. Biol. Chem. 193, 265276.
  • Majewska M. D. (1992) Neurosteroids: endogenous bimodal modulators of the GABAA receptor. Mechanism of action and physiological significance. Prog. Neurobiol. 38, 379395.
  • Majewska M. D., Harrison N. L., Schwartz R. D., Barker J. L. and Paul S. M. (1986) Steroid hormone metabolites are barbiturate-like modulators of the GABA receptor. Science 232, 10041007.
  • McDonald A. J. and Pearson J. C. (1989) Coexistence of GABA and peptide immunoreactivity in non-pyramidal neurons of the basolateral amygdala. Neurosci. Lett. 100, 5358.
  • Naveilhan P., Canals J. M., Arenas E. and Ernfors P. (2001a) Distinct roles of the Y1 and Y2 receptors on neuropeptide Y-induced sensitization to sedation. J. Neurochem. 78, 12011207.DOI: 10.1046/j.1471-4159.2001.00534.x
  • Naveilhan P., Canals J. M., Valjakka A., Vartiainen J., Arenas E. and Ernfors P. (2001b) Neuropeptide Y alters sedation through a hypothalamic Y1-mediated mechanism. Eur. J. Neurosci. 13, 22412246.
  • Oberto A., Tolosano E., Brusa R., Altruda F., Panzica G. and Eva C. (1998) The murine Y1 receptor 5′ upstream sequence directs cell-specific and developmentally regulated LacZ expression in transgenic mice CNS. Eur. J. Neurosci. 10, 32573268.
  • Oberto A., Panzica G., Altruda F. and Eva C. (2000) Chronic modulation of GABAA receptor complex regulates Y1 receptor gene expression in the medial amygdala of transgenic mice. Neuropharmacology 39, 227234.DOI: 10.1016/S0028-3908(99)00129-X
  • Oberto A., Panzica G. C., Altruda F. and Eva C. (2001) GABAergic and NPY-Y1 network in the medial amygdala: a neuroanatomical basis for their functional interaction. Neuropharmacology 41, 639642.DOI: 10.1016/S0028-3908(01)00109-5
  • Ovesjö M. L., Gamstedt M., Collin M. and Meister B. (2001) GABAergic nature of hypothalamic leptin target neurones in the ventromedial arcuate nucleus. J. Neuroendocrinol. 13, 505516.
  • Paul S. M. and Purdy R. H. (1992) Neuroactive steroids. FASEB J. 6, 23112322.
  • Pu S., Jain M. R., Horvath T. L., Diano S., Kalra P. S. and Kalra S. P. (1999) Interactions between neuropeptide Y and γ-aminobutyric acid in stimulation of feeding: a morphological and pharmacological analysis. Endocrinology 140, 933940.
  • Puia G., Santi M. R., Vicini S., Pritchett D. B., Purdy R. H., Paul S. M., Seeburg P. H. and Costa E. (1990) Neurosteroids act on recombinant human GABAA receptors. Neuron 4, 759765.
  • Purdy R. H., Morrow A. L., Blinn J. R. and Paul S. M. (1990) Synthesis, metabolism and pharmacological activity of 3α-hydroxy-steroids which potentiate GABA-receptor-mediated chloride ion uptake in rat cerebral cortical synaptoneurosomes. J. Med. Chem. 33, 15721581.
  • Rupprecht R. and Holsboer F. (1999) Neuroactive steroids: mechanisms of action and neuropsychopharmacological perspectives. Trends Neurosci. 22, 410416.
  • Rupprecht E., Reul J. M. H. M., Trapp T., Van Steensel B., Wetzel C., Damm K., Zieglgänsberger W. and Holsboer F. (1993) progesterone receptor-mediated neuroactive steroids. Neuron 11, 523530.
  • Sajdyk T. J., Vandergriff M. G. and Gehlert D. R. (1999) Amygdalar neuropeptide Y Y1 receptors mediate the anxiolytic-like actions of neuropeptide Y in the social interaction test. Eur. J. Pharmacol. 368, 143147.
  • Serra M., Pisu M. G., Littera M., Papi G., Sanna E., Tuveri F., Usala L., Purdy R. H. and Biggio G. (2000) Social isolation-induced decreases in both the abundance of neuroactive steroids and GABAA receptor function in rat brain. J. Neurochem. 75, 732740.
  • Smith S. S., Gong Q. H., Hsu F. C., Markowitz R. S., Ffrench-Mullen J.M. and Li X. (1998a) GABAA receptor α4 subunit suppression prevents withdrawal properties of an endogenous steroid. Nature 392, 926930.
  • Smith S. S., Gong Q. H., Li X., Moran M. H., Bitran D., Frye C. A. and Hsu F. C. (1998b) Withdrawal from 3α-OH-5α-pregnan-20-one using a pseudopregnancy model alters the kinetics of hippocampal GABAA-gated current and increases the GABAA receptor α4 subunit in association with increased anxiety. J. Neurosci. 18, 52755284.
  • Tatemoto K., Carlquist M. and Mutt V. (1982) Neuropeptide Y − a novel brain peptide with structural similarities to peptide YY and pancreatic polypeptide. Nature 296, 659660.
  • Thorsell A., Michalkiewicz M., Dumont Y., Quirion R., Caberlotto L., Rimondini R., Mathe A. A. and Heilig M. (2000) Behavioral insensitivity to restraint stress, absent fear suppression of behavior and impaired spatial learning in transgenic rats with hippocampal neuropeptide Y overexpression. Proc. Natl Acad. Sci. USA 97, 1285212857.
  • Vezzani A., Sperk G. and Colmer W. F. (1999) Neuropeptide Y: emerging evidence for a functional role in seizure modulation. Trends Neurosci. 22, 2530.
  • Wahlestedt C., Pich E. M., Koob G. F., Yee F. and Heilig M. (1993) Modulation of anxiety and neuropeptide Y-Y1 receptors by antisense oligodeoxynucleotides. Science 259, 528531.
  • Wang M., Bäckström T., Sundström I., Wahlström G., Olsson T., Zhu D., Johansson I.-M., Björn I. and Bixio M. (2001) Neuroactive steroids and central nervous system disorders. Int. Rev. Neurobiol. 46, 421459.
  • Wettstein J. G., Broqua P., Rocher M. N. and Junien J. L. (1994) Attenuation of fear-potentiated startle by neuropeptide Y1 receptor agonists. Neuropeptides 26, 116117.
  • Wieland S., Lan N. C., Mirasedeghi S. and Gee K. W. (1991) Anxiolytic activity of the progesterone metabolite 5α-pregnan-3α-ol-20-one. Brain Res. 565, 263268.
  • Wisden W. and Morris B. J. (2002) In situ hybridization with oligonucleotide probes, in In situ Hybridization Protocols for the Brain (W.Wisden and MorrisB. J., eds), pp. 934. Academic Press, London.
  • Yamada K., Shibasaki T., Ysumori C., Imaki T., Hotta M., Wakabayashi I. and Demura H. (1996) Neuropeptide Y reverses corticotropin-releasing hormone- and psychological stress-caused shortening ofsodium pentobarbital-induced sleep in rats. Brain Res. 725, 272275.