SEARCH

SEARCH BY CITATION

Keywords:

  • deep-brain stimulation;
  • nomifensine;
  • pargyline;
  • Parkinson's disease;
  • reserpine;
  • tyrosine hydroxylase

Abstract

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Animals
  5. Drug treatment
  6. Surgery and microdialysis
  7. Tyrosine hydroxylase activity assay
  8. Semi quantitative measurement of tyrosine hydroxylase mRNA using RT-PCR
  9. Histological verification
  10. Data analysis
  11. Results
  12. High-frequency stimulation in non-drug-treated animals
  13. High-frequency stimulation after dopamine reuptake inhibition
  14. High-frequency stimulation after monoamine oxidase inhibition
  15. High-frequency stimulation after dopamine depletion
  16. Tyrosine hydroxylase activity and tyrosine hydroxylase mRNA expression
  17. Discussion
  18. Acknowledgements
  19. References

High-frequency stimulation of the subthalamic nucleus is believed to exert its main effects via the basal ganglia output structures. Previously, we have shown a concomitant increase in striatal dopamine (DA) metabolites in normal and 6-hydroxydopamine-lesioned rats. The present study was designed to determine whether this increase in striatal DA metabolites reflects enhanced intraneuronal DA turnover or, alternatively, is due to increased DA release with subsequent rapid and efficient reuptake and/or metabolism. Thus, high-frequency stimulation of the subthalamic nucleus was performed in normal rats after inhibition of DA reuptake, metabolism or DA depletion. Extracellular levels of striatal DA and its metabolites were assessed using microdialysis. Our data suggest that subthalamic high-frequency stimulation increases striatal DA release and activates independent striatal DA metabolism. Since such changes could be triggered by modification of either the activity or the gene expression of the rate-limiting enzyme tyrosine hydroxylase, an activity assay and RT-PCR of striatal and nigral samples were performed. Subthalamic stimulation increased striatal tyrosine hydroxylase activity without affecting gene expression. We, therefore, conclude that the application of subthalamic high-frequency stimulation could partially compensate for the DA deficit by inducing increased striatal DA release and metabolism.

Abbreviations used
DA

dopamine

DOPAC

3,4-dihydroxyphenylacetic acid

HFS

high-frequency stimulation

HPRT

hypoxanthine phosphoribosyltransferase

HVA

homovanillic acid

MAO

monoamine oxidase

6-OHDA

6-hydroxydopamine

PD

Parkinson's disease

6R-BH4

6-methyl-5,6,7,8-tetrahydropterin

SNc

substantia nigra pars compacta

STN

subthalamic nucleus

TH

tyrosine hydroxylase

Parkinson's disease (PD) is characterized by a striatal dopamine (DA) deficit due to a progressive loss of nigrostriatal DA neurones (Ehringer and Hornykiewicz 1960). The major symptoms of PD can be sufficiently controlled by DAergic medication (Yahr et al. 1969). In the later course of the disease, however, treatment is complicated by the occurrence of levodopa-induced dyskinesias and motor fluctuations (Marsden et al. 1982). High-frequency stimulation (HFS) of the subthalamic nucleus (STN) has emerged as a powerful therapeutic approach for the treatment of PD patients (Benabid et al. 1998; Krack et al. 1999) since it alleviates rigidity, bradykinesia (Limousin et al. 1998), tremor (Krack et al. 1997b) as well as levodopa-induced dyskinesia (Krack et al. 1997a).

Although there is growing clinical experience, the exact mechanisms of action of STN-HFS remain unknown. At present, indirect techniques, such as microdialysis, that allow sampling during stimulation are more suitable for detecting HFS-related changes in neuronal activity than direct electrophysiological recordings, which are limited by the stimulation artefact. Previous microdialysis studies have suggested that striatal DAergic activity is affected by STN-HFS both in naive (Paul et al. 2000; Bruet et al. 2001) and in 6-hydroxydopamine (6-OHDA)-lesioned rats (Meissner et al. 2001; Bruet et al. 2001; Meissner et al. 2002). However, it is difficult to conclude whether the reported changes in DA metabolites (Paul et al. 2000; Meissner et al. 2001; Meissner et al. 2002) simply reflect increased intraneuronal DA turnover or, alternatively, are due to DA release with subsequent rapid and efficient reuptake and/or metabolism. Under physiological conditions DA is released by exocytosis from a reserpine-sensitive vesicular DA pool upon arrival of an action potential and taken up again by the DA transporter. The main enzymes responsible for DA metabolism are monoamine oxidase (MAO, EC1.4.3.4) and catechol-O-methyl-transferase (EC2.1.1.6). Monoamine oxidase, which is located in the outer mitochondrial membrane, catalyses the formation of 3,4-dihydroxyphenylacetic acid (DOPAC). This reaction occurs intra- and extraneuronally, i.e. in glia cells (Elsworth and Roth 1997). Previously, it has been suggested that a major portion of extracellular DOPAC is derived from metabolism of an intraneuronal, cytoplasmic newly synthesized and reserpine-insensitive DA pool rather than from exocytotic DA release with subsequent reuptake and metabolism (Zetterström et al. 1988; Arbuthnott et al. 1990a). Homovanillic acid (HVA) is formed from DOPAC outside DA neurones, given the extraneuronal location of catechol-O-methyl-transferase in glia cells and on the post-synaptic membrane of DA neurones (Elsworth and Roth 1997).

The present study was designed to characterize the impact of STN-HFS on the striatal DA system using microdialysis. For this purpose, both sham and STN-stimulated rats were treated either with the DA reuptake inhibitor nomifensine, the MAO inhibitor pargyline or the vesicular monoamine transporter inhibitor reserpine. Furthermore, two separate groups were included in the present study to determine the impact of STN-HFS on striatal and nigral tyrosine hydroxylase (TH, EC1.14.16.2) activity and mRNA expression.

Animals

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Animals
  5. Drug treatment
  6. Surgery and microdialysis
  7. Tyrosine hydroxylase activity assay
  8. Semi quantitative measurement of tyrosine hydroxylase mRNA using RT-PCR
  9. Histological verification
  10. Data analysis
  11. Results
  12. High-frequency stimulation in non-drug-treated animals
  13. High-frequency stimulation after dopamine reuptake inhibition
  14. High-frequency stimulation after monoamine oxidase inhibition
  15. High-frequency stimulation after dopamine depletion
  16. Tyrosine hydroxylase activity and tyrosine hydroxylase mRNA expression
  17. Discussion
  18. Acknowledgements
  19. References

After permission was obtained from local authorities, the study was carried out in accordance with the European Communities Council Directive of 24 November 1986 (86/609/EEC) for care of laboratory animals. Naive male Wistar rats (Harlan-Winkelmann, Borchen, Germany; n = 89, 280–420 g during the experiment) were housed in a temperature- and humidity-controlled vivarium with a 12-h light/dark cycle (6 am− 6 pm). All experiments were performed during the day time of the animals. Food and water were available ad libitum.

Drug treatment

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Animals
  5. Drug treatment
  6. Surgery and microdialysis
  7. Tyrosine hydroxylase activity assay
  8. Semi quantitative measurement of tyrosine hydroxylase mRNA using RT-PCR
  9. Histological verification
  10. Data analysis
  11. Results
  12. High-frequency stimulation in non-drug-treated animals
  13. High-frequency stimulation after dopamine reuptake inhibition
  14. High-frequency stimulation after monoamine oxidase inhibition
  15. High-frequency stimulation after dopamine depletion
  16. Tyrosine hydroxylase activity and tyrosine hydroxylase mRNA expression
  17. Discussion
  18. Acknowledgements
  19. References

Pargyline (n = 15, 75 mg/kg i.p.; Sigma, St Louis, MO, USA) was administered 1 h prior to surgery, whereas reserpine (n = 16, 5 mg/kg i.p.; Research Biochemicals Inc., Natick, MA, USA) was applied 18 h before the implantation of the electrode and the microdialysis probe (Callaway et al. 1989). The DA reuptake inhibitor nomifensine (n = 11, 1 mm; Research Biochemicals Inc.) was added to the artificial cerebrospinal fluid perfusing the microdialysis probe given the short half-life of this substance (Lindberg and Syvalahti 1986).

Surgery and microdialysis

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Animals
  5. Drug treatment
  6. Surgery and microdialysis
  7. Tyrosine hydroxylase activity assay
  8. Semi quantitative measurement of tyrosine hydroxylase mRNA using RT-PCR
  9. Histological verification
  10. Data analysis
  11. Results
  12. High-frequency stimulation in non-drug-treated animals
  13. High-frequency stimulation after dopamine reuptake inhibition
  14. High-frequency stimulation after monoamine oxidase inhibition
  15. High-frequency stimulation after dopamine depletion
  16. Tyrosine hydroxylase activity and tyrosine hydroxylase mRNA expression
  17. Discussion
  18. Acknowledgements
  19. References

All procedures except for the TH activity assay and RT-PCR have previously been described in detail (Paul et al. 2000; Meissner et al. 2001). Briefly, under general anaesthesia (chloral hydrate, 400 mg/kg i.p.) a microdialysis probe (CMA 12; CMA, Solna, Sweden) and a concentric bipolar stimulation electrode (SNEX 100; Rhode Medical Instruments, Woodland Hills, CA, USA) were inserted into the left striatum (A, 1.0 mm; L, 3.0 mm and V, − 6.0 mm; Paxinos and Watson 1997) and the left STN (A, − 3.8 mm; L, 2.5 mm and V, − 7.6 mm; Paxinos and Watson 1997), respectively.

The striatal microdialysis probe was perfused with artificial cerebrospinal fluid. Samples were collected every 20 min for immediate analysis of extracellular concentrations of DA and its metabolites DOPAC and HVA by HPLC with electrochemical detection. For STN-HFS the following stimulation parameters were applied: alternating pulses (frequency 130 Hz, pulse width 60 µs) with an amplitude of 300 µA in a constant current mode for 20 min using an isolated stimulator (Coulbourn Instruments, Allentown, PA, USA). For rats used for the TH activity assay and RT-PCR, a concentric bipolar stimulation electrode (SNEX 100; Rhode Medical Instruments) was inserted in the left STN and animals were stimulated for 2 h. Control animals received no stimulation while the stimulating electrode was placed in the STN.

Tyrosine hydroxylase activity assay

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Animals
  5. Drug treatment
  6. Surgery and microdialysis
  7. Tyrosine hydroxylase activity assay
  8. Semi quantitative measurement of tyrosine hydroxylase mRNA using RT-PCR
  9. Histological verification
  10. Data analysis
  11. Results
  12. High-frequency stimulation in non-drug-treated animals
  13. High-frequency stimulation after dopamine reuptake inhibition
  14. High-frequency stimulation after monoamine oxidase inhibition
  15. High-frequency stimulation after dopamine depletion
  16. Tyrosine hydroxylase activity and tyrosine hydroxylase mRNA expression
  17. Discussion
  18. Acknowledgements
  19. References

The TH activity (n = 17) was determined using HPLC with electrochemical detection (Nagatsu et al. 1979; Naoi et al. 1988). Briefly, both dorsal striata and substantia nigra pars compacta (SNc) were dissected according to the method of Segal and Kuczenski (1974), homogenized in 0.25 m sucrose and incubated. The incubation mixture consisted of the following components in a total volume of 120 µL: 50 µL homogenate in 0.25 m sucrose, 10 µL of 1 m sodium acetate-acetic buffer (pH 6.0), 20 µL of 1.5 mm l-tyrosine (Sigma), 10 µL of 10 mm 6-methyl-5,6,7,8-tetrahydropterin (6R-BH4; Sigma) in 1 m 2-mercaptoethanol, 10 µL containing 12 µg catalase (Sigma), 10 µL of 10 mm ferrous ammonium sulphate (Sigma) and 10 µL of 1 mm NSD 1015 (Sigma), an inhibitor of aromatic l-amino acid decarboxylase (EC4.1.1.28). The incubation mixture, except for tyrosine and 6R-BH4, was pre-incubated at 37°C for 5 min and gassed with oxygen. Thereafter, the reaction was initiated by adding tyrosine and 6R-BH4. After incubation at 37°C for 10 min, the reaction was terminated by adding 600 µL of 0.5 m perchloric acid containing 300 pmol l-alpha methyldopa as an internal standard. Consequently, 20 µL of the eluate were injected in the HPLC and the amount of l-DOPA was measured using the same technique as described for microdialysis (Paul et al. 2000; Meissner et al. 2001). For quantification of non-enzymatical TH synthesis, d-tyrosine was added as substrate instead of l-tyrosine. Protein concentrations were measured according to Lowry et al. (1951) with human serum albumin as standard.

Enzymatic TH activity was calculated using the following equation

  • image

Semi quantitative measurement of tyrosine hydroxylase mRNA using RT-PCR

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Animals
  5. Drug treatment
  6. Surgery and microdialysis
  7. Tyrosine hydroxylase activity assay
  8. Semi quantitative measurement of tyrosine hydroxylase mRNA using RT-PCR
  9. Histological verification
  10. Data analysis
  11. Results
  12. High-frequency stimulation in non-drug-treated animals
  13. High-frequency stimulation after dopamine reuptake inhibition
  14. High-frequency stimulation after monoamine oxidase inhibition
  15. High-frequency stimulation after dopamine depletion
  16. Tyrosine hydroxylase activity and tyrosine hydroxylase mRNA expression
  17. Discussion
  18. Acknowledgements
  19. References

For TH activity measurements, both dorsal striata and SNc (n = 19) were quickly removed and stored at − 80°C. RT-PCR was performed according to the method of Bowyer et al. (1998) and Tokuyama et al. (1999) with slight modifications. Briefly, after homogenization of nigral and striatum samples, total cellular RNA was isolated using the Absolutely RNA™ RT-PCR Miniprep Kit (Stratagene, La Jolla, CA, USA). Total RNA (1 µg) of either striatum or SNc was dissolved in 25 µL diethylpyrocarbonate (DEPC)-treated water and transcribed into cDNA (SuperScript™ II RNase H-Reverse Transcriptase; Invitrogen™ Life Technologies, Carlsbad, CA, USA). By PCR, TH and hypoxanthine phosphoribosyltransferase (HPRT, E.C. 2.4.2.8) transcripts (as internal standard) were amplified (primer 5′-390 TH, CCCCACCTGGAGTATTTTGTG; primer 3′-927 TH, GGTGCATTGAAACACGCGGAA; primer HPRT-forward, CTTGACTATAATGAGCACTTCAG and primer HPRT-reverse GGCTGCCTACAGGCTCATAGTGC). The PCR was performed with Taq DNA Polymerase (Eppendorff, Hamburg, Germany) in a total volume of 50 µL and stopped after 20, 23 and 25 cycles, respectively. A volume (5 µL) of each sample was subjected to agarose gel electrophoresis, blotted onto a membrane,and hybridized against radioactively labelled PCR products, which were amplified from cDNAs applying the above-mentioned primers.

In order to standardize the hybridization procedure, TH and HPRT cDNAs with known concentrations (25, 50 and 75 pg) were spotted onto a membrane. The membranes were scanned with the PhosphorImager™ (Molecular Dynamics, Sunnyvale, CA, USA) and quantification of the signals was performed using the ImageQuant™ software (Molecular Dynamics). Values were calculated as the ratio between the TH and the associated HPRT spot. Linearity of the PCR reaction was checked by using a linear regression comparing TH and HPRT values after 20, 23 and 25 cycles. The 75-pg spot was used to standardize the signals.

Data analysis

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Animals
  5. Drug treatment
  6. Surgery and microdialysis
  7. Tyrosine hydroxylase activity assay
  8. Semi quantitative measurement of tyrosine hydroxylase mRNA using RT-PCR
  9. Histological verification
  10. Data analysis
  11. Results
  12. High-frequency stimulation in non-drug-treated animals
  13. High-frequency stimulation after dopamine reuptake inhibition
  14. High-frequency stimulation after monoamine oxidase inhibition
  15. High-frequency stimulation after dopamine depletion
  16. Tyrosine hydroxylase activity and tyrosine hydroxylase mRNA expression
  17. Discussion
  18. Acknowledgements
  19. References

Baseline was defined as the mean of the last four dialysate samples collected before HFS. Statistical analysis of extracellular striatal concentrations of DA and its metabolites was performed using a one-way anova for repeated measures followed by post-hoc t-tests corrected for multiple comparisons by the method of Student–Newman–Keuls. Furthermore, HFS was compared with non-stimulated controls using an unpaired one way anova followed by post-hoc t-tests corrected for multiple comparisons by the method of Student–Newman–Keuls. In agreement with the analysis of the microdialysis data, left striatum and SNc of stimulated animals were compared (i) versus the contralateral striatum/SNc of stimulated animals and (ii) versus the ipsilateral striatum/SNc of non-stimulated controls using an unpaired one way anova. A probability level of 5% (p < 0.05) was considered significant. Data are shown as mean ± SEM. Baseline values are given as pmol/20 µL dialysate.

High-frequency stimulation in non-drug-treated animals

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Animals
  5. Drug treatment
  6. Surgery and microdialysis
  7. Tyrosine hydroxylase activity assay
  8. Semi quantitative measurement of tyrosine hydroxylase mRNA using RT-PCR
  9. Histological verification
  10. Data analysis
  11. Results
  12. High-frequency stimulation in non-drug-treated animals
  13. High-frequency stimulation after dopamine reuptake inhibition
  14. High-frequency stimulation after monoamine oxidase inhibition
  15. High-frequency stimulation after dopamine depletion
  16. Tyrosine hydroxylase activity and tyrosine hydroxylase mRNA expression
  17. Discussion
  18. Acknowledgements
  19. References

Baseline concentrations were 78.70 ± 12.24 fmol DA/20 µL, 32.11 ± 3.40 pmol DOPAC/20 µL and 20.56 ± 3.45 pmol HVA/20 µL in non-drug-treated animals. In non-stimulated controls all assessed parameters remained stable throughout the observation period. The STN-HFS did not affect striatal DA levels in comparison to baseline and non-stimulated controls. In contrast, STN-HFS significantly increased striatal extracellular DOPAC (max. 130.6 ± 6.0%) and HVA levels (max. 127.7 ± 6.0%) in comparison to baseline (DOPAC, t = 40–180 min and HVA, t = 120–180 min) and non-stimulated controls (DOPAC, t = 20–180 min and HVA, t = 20–180 min).

High-frequency stimulation after dopamine reuptake inhibition

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Animals
  5. Drug treatment
  6. Surgery and microdialysis
  7. Tyrosine hydroxylase activity assay
  8. Semi quantitative measurement of tyrosine hydroxylase mRNA using RT-PCR
  9. Histological verification
  10. Data analysis
  11. Results
  12. High-frequency stimulation in non-drug-treated animals
  13. High-frequency stimulation after dopamine reuptake inhibition
  14. High-frequency stimulation after monoamine oxidase inhibition
  15. High-frequency stimulation after dopamine depletion
  16. Tyrosine hydroxylase activity and tyrosine hydroxylase mRNA expression
  17. Discussion
  18. Acknowledgements
  19. References

In animals receiving 1 mm nomifensine, absolute concentrations of 4.11 ± 0.42 pmol DA/20 µL, 28.26 ± 2.26 pmol DOPAC/20 µL and 7.03 ± 0.72 pmol HVA/20 µL were detected in baseline dialysates. Thus, inhibition of DA reuptake greatly increased absolute baseline values of DA in comparison to non-drug-treated animals. Subsequently, concentrations of DA (min. 65.7 ± 3.4%, Fig. 1a), DOPAC (min. 77.6 ± 3.6%, Fig. 1b) and HVA (min. 73.8 ± 4.3%, Fig. 1c) declined in non-stimulated controls in comparison to baseline. The STN-HFS enhanced striatal DA levels in comparison to non-stimulated controls (Fig. 1a). The DA levels increased only transiently for 60 min in comparison to non-stimulated controls and decreased thereafter to 72.8 ± 4.0% of baseline values. The STN-HFS also increased the concentration of striatal DA metabolites (DOPAC, max. 132.0 ± 7.2%, Fig. 1b and HVA, max. 115.5 ± 6.4, Fig. 1c) in comparison to baseline and non-stimulated controls.

image

Figure 1. Striatal extracellular (a) dopamine (DA), (b) 3,4-dihydroxyphenylacetic acid (DOPAC) and (c) homovanillic acid (HVA) in the nomifensine group (1 mm) before, during and after subthalamic nucleus–high-frequency stimulation (STN-HFS) (▪ represents duration of HFS). Note that the dead volume in the microdialysis tubing is responsible for a lag time of 10 min. Thus, STN-HFS was performed for 10 min during the first and second sampling period after baseline. Data are presented as mean + SEM. *Significant differences in comparison to baseline (p < 0.05, post-hoc Student–Newman–Keuls test); §significant difference between HFS and non-stimulated controls (p < 0.05, unpaired one way anova). (a) DA: ●, HFS (n = 5); ○, non-stimulated controls (n = 6). (b) DOPAC: ●, HFS (n = 5); ○, non-stimulated controls (n = 6). (c) HVA: ●, HFS (n = 5); ○, non-stimulated controls (n = 6).

Download figure to PowerPoint

High-frequency stimulation after monoamine oxidase inhibition

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Animals
  5. Drug treatment
  6. Surgery and microdialysis
  7. Tyrosine hydroxylase activity assay
  8. Semi quantitative measurement of tyrosine hydroxylase mRNA using RT-PCR
  9. Histological verification
  10. Data analysis
  11. Results
  12. High-frequency stimulation in non-drug-treated animals
  13. High-frequency stimulation after dopamine reuptake inhibition
  14. High-frequency stimulation after monoamine oxidase inhibition
  15. High-frequency stimulation after dopamine depletion
  16. Tyrosine hydroxylase activity and tyrosine hydroxylase mRNA expression
  17. Discussion
  18. Acknowledgements
  19. References

Baseline dialysates contained 0.25 ± 0.03 pmol DA/20 µL, 0.67 ± 0.10 pmol DOPAC/20 µL and 0.68 ± 0.14 pmol HVA/20 µL. Thus, MAO inhibition dramatically decreased DA metabolites in comparison to non-drug-treated animals. In non-stimulated controls DA values remained stable (Fig. 2a), whereas striatal levels of DOPAC (max. 150.0 ± 8.9%, Fig. 2b) and HVA (max. 138.3 ± 12.7%, Fig. 2c) increased continuously. The STN-HFS resulted in an immediate and reversible increase in striatal extracellular DA (max. 131.9 ± 9.6%) in comparison to baseline and non-stimulated controls (Fig. 2a). Furthermore, STN-HFS enhanced extracellular DOPAC (max. 172.9 ± 15.6%, Fig. 2b) and HVA levels (max. 154.1 ± 23.0%, Fig. 2c) in comparison to baseline, but not when compared with non-stimulated controls.

image

Figure 2. Striatal extracellular (a) dopamine (DA), (b) 3,4-dihydroxyphenylacetic acid (DOPAC) and (c) homovanillic acid (HVA) in pargyline-treated rats before, during and after subthalamic nucleus–high-frequency stimulation (STN-HFS) (▪ represents duration of HFS). Note that the dead volume in the microdialysis tubing is responsible for a lag time of 10 min. Thus, STN-HFS was performed for 10 min during the first and second sampling period after baseline. Data are presented as mean + SEM. *Significant differences in comparison to baseline (p < 0.05, post-hoc Student–Newman–Keuls test); §significant difference between HFS and non-stimulated controls (p < 0.05, unpaired one way anova). (a) DA: ●, HFS (n = 7); ○, non-stimulated controls (n = 8). (b) DOPAC: ●, HFS (n = 7); ○, non-stimulated controls (n = 8). (c) HVA: ●, HFS (n = 7); ○, non-stimulated controls (n = 8).

Download figure to PowerPoint

image

Figure 3. Striatal extracellular (a) 3,4-dihydroxyphenylacetic acid (DOPAC) and (b) homovanillic acid (HVA) in reserpine-treated rats before, during and after subthalamic nucleus–high-frequency stimulation (STN-HFS) (▪ represents duration of HFS). Note that the dead volume in the microdialysis tubing is responsible for a lag time of 10 min. Thus, STN-HFS was performed for 10 min during the first and second sampling period after baseline. Data are presented as mean + SEM. *Significant differences in respect to baseline (p < 0.05, post-hoc Student–Newman–Keuls test); §significant difference between HFS and non-stimulated controls (p < 0.05, unpaired one way anova). (a) DOPAC: ●, HFS (n = 10); ○, non-stimulated controls (n = 6). (b) HVA: ●, HFS (n = 10); ○, non-stimulated controls (n = 6).

Download figure to PowerPoint

High-frequency stimulation after dopamine depletion

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Animals
  5. Drug treatment
  6. Surgery and microdialysis
  7. Tyrosine hydroxylase activity assay
  8. Semi quantitative measurement of tyrosine hydroxylase mRNA using RT-PCR
  9. Histological verification
  10. Data analysis
  11. Results
  12. High-frequency stimulation in non-drug-treated animals
  13. High-frequency stimulation after dopamine reuptake inhibition
  14. High-frequency stimulation after monoamine oxidase inhibition
  15. High-frequency stimulation after dopamine depletion
  16. Tyrosine hydroxylase activity and tyrosine hydroxylase mRNA expression
  17. Discussion
  18. Acknowledgements
  19. References

In reserpine pre-treated rats, extracellular levels of DA remained below the detection limit of 10 fmol/20 µL dialysate during the observation period. An amount of 19.47 ± 2.38 pmol DOPAC/20 µL and 7.08 ± 1.97 pmol HVA/20 µL was measured in baseline dialysates. These values remained stable in non-stimulated control animals (Fig. 3a and b). In contrast, STN-HFS increased extracellular DOPAC (max. 117.3 ± 4.5%, Fig. 3a) and HVA (max. 117.6 ± 6.5%, Fig. 3b). This STN-HFS-induced increase in DOPAC was also significant in comparison to non-stimulated controls.

Tyrosine hydroxylase activity and tyrosine hydroxylase mRNA expression

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Animals
  5. Drug treatment
  6. Surgery and microdialysis
  7. Tyrosine hydroxylase activity assay
  8. Semi quantitative measurement of tyrosine hydroxylase mRNA using RT-PCR
  9. Histological verification
  10. Data analysis
  11. Results
  12. High-frequency stimulation in non-drug-treated animals
  13. High-frequency stimulation after dopamine reuptake inhibition
  14. High-frequency stimulation after monoamine oxidase inhibition
  15. High-frequency stimulation after dopamine depletion
  16. Tyrosine hydroxylase activity and tyrosine hydroxylase mRNA expression
  17. Discussion
  18. Acknowledgements
  19. References

The STN-HFS increased striatal TH activity (1.42 ± 0.11 pmol/min/mg protein) when compared with the contralateral non-stimulated striatum of the same animal (1.10 ± 0.11 pmol/min/mg protein, Fig. 4a) and the ipsilateral striatum of non-stimulated controls (1.02 ± 0.16 pmol/min/mg protein, Fig. 4a). In contrast, STN-HFS did not affect nigral TH activity when compared with the contralateral non-stimulated SNc of the same animal (Fig. 4a) and the ipsilateral SNc of non-stimulated controls (Fig. 4a).

image

Figure 4. Striatal and nigral tyrosine hydroxylase (TH) activity and mRNA expression after subthalamic nucleus–high-frequency stimulation (STN-HFS). Data are presented as mean + SEM. (a) TH activity; ▪, HFS (n = 10); □, non-stimulated controls (n = 7). *Significant differences in comparison to the contralateral striatum of stimulated animals and the ipsilateral striatum of non-stimulated controls (p < 0.05, unpaired one way anova). (b) Representative figure of hybridized striatal and nigral TH and hypoxanthine phosphoribosyltransferase (HPRT) cDNA after 20, 23 and 25 cycles. Values were calculated as the ratio between the TH and the associated HPRT spot. (c) TH-mRNA expression; ▪, HFS (n = 10); □, non-stimulated controls (n = 9). SNc, substantia nigra pars compacta.

Download figure to PowerPoint

Whereas striatal TH activity was increased by STN-HFS, TH-mRNA expression of both the striatum (vs. contralateral striatum as well as the ipsilateral striatum of non-stimulated controls, Fig. 4b) and the SNc (vs. contralateral SNc as well as the ipsilateral SNc of non-stimulated controls, Fig. 4b) remained unaffected.

Discussion

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Animals
  5. Drug treatment
  6. Surgery and microdialysis
  7. Tyrosine hydroxylase activity assay
  8. Semi quantitative measurement of tyrosine hydroxylase mRNA using RT-PCR
  9. Histological verification
  10. Data analysis
  11. Results
  12. High-frequency stimulation in non-drug-treated animals
  13. High-frequency stimulation after dopamine reuptake inhibition
  14. High-frequency stimulation after monoamine oxidase inhibition
  15. High-frequency stimulation after dopamine depletion
  16. Tyrosine hydroxylase activity and tyrosine hydroxylase mRNA expression
  17. Discussion
  18. Acknowledgements
  19. References

The present study shows that STN-HFS induces (i) an increase in striatal exocytotic DA release; (ii) an independent activation of striatal DA metabolism and (iii) an activation of striatal TH activity without changes in TH gene expression.

In agreement with our previous studies in normal and 6-OHDA-lesioned rats (anaesthetized and awake), STN-HFS increased striatal extracellular levels of DOPAC and HVA in comparison to baseline and non-stimulated controls, whereas DA levels remained unchanged (Paul et al. 2000; Meissner et al. 2001; Meissner et al. 2002).

The STN-HFS enhanced extracellular DA in the striatum after inhibition of DA reuptake. Since nomifensine does not only block DA reuptake but also the carrier-mediated release of DA (Butcher et al. 1988; Zetterström et al. 1988; Arbuthnott et al. 1990b), it is likely that the observed STN-HFS-induced increase in DA is of an exocytotic nature. Apart from changes in DA release, there was a concurrent increase in DA metabolites after STN-HFS in rats with inhibited striatal DA reuptake. Several explanations may account for this observation: (i) ineffective DA reuptake inhibition with 1 mm nomifensine allowing DA reuptake and intra- or extraneuronal metabolism; (ii) DA carrier-independent reuptake followed by intra- or extraneuronal reuptake and metabolism or (iii) a separate activation of DA release and intraneuronal DA metabolism with subsequent diffusion of DOPAC to the extracellular space. However, the former two options are less likely, since (i) lower nomifensine concentrations have already been reported to almost completely suppress amphetamine-induced striatal DA release via the DA transporter (Zetterström et al. 1988) and (ii) there are no data demonstrating the possibility of a DA carrier-independent reuptake. Furthermore, since DA-releasing agents, such as potassium, veratrine (i.e. exocytotic DA release) and amphetamine (i.e. non-exocytotic DA release), decrease extracellular levels of DOPAC (Zetterström et al. 1983; Imperato and Di Chiara 1984; Butcher et al. 1988; Zetterström et al. 1988; Gerhardt and Maloney 1999), an isolated effect of STN-HFS on DA release cannot explain the concomitant increase in DOPAC. Thus, enhanced DA may be derived from the exocytotic releasable pool, whereas enhanced extracellular DA metabolite levels may result from increased metabolism of the cytoplasmic newly synthesized DA pool.

In the present study, we observed a gradual decrease in DA, DOPAC and HVA in non-stimulated controls treated with 1 mm nomifensine. Since absolute DA baseline values were increased 52-fold in comparison to non-drug-treated animals, the pronounced decrease in extracellular DA, DOPAC and HVA during the observation period (duration of striatal nomifensine infusion > 5 h) probably results from continued augmented stimulation of DA autoreceptors that modulate synthesis and release (Galloway et al. 1986).

In rats pre-treated with pargyline, STN-HFS also induced an increase in striatal extracellular DA. Pargyline inhibits MAO-catalysed DA metabolism (Planz et al. 1972; Roth et al. 1976; Waldmeier and Maitre 1976), thereby accumulating intraneuronal DA and increasing resting DA release (Butcher et al. 1990; Di Chiara et al. 1993; Elverfors et al. 1997). This is further corroborated by the present data, showing a threefold increase in striatal extracellular DA levels in pargyline-treated animals. Since the different DA storage pools are in a dynamic equilibrium allowing the exchange of DA with each other (Justice et al. 1988; Arbuthnott et al. 1990b), pargyline treatment may have facilitated STN-HFS-induced DA release, as has previously been observed for the DA-releasing substances potassium, veratrine and amphetamine (Butcher et al. 1988; Butcher et al. 1990). In pargyline pre-treated rats, striatal extracellular DOPAC and HVA concentrations increased continuously after STN-HFS and in non-stimulated controls. This increase was small in comparison to baseline values of non-drug-treated animals and probably reflects recovery of striatal MAO activity due to resynthesis of the enzyme (Panova et al. 2000).

Since STN-HFS-increased DA release was only measurable after pharmacological inhibition of DA reuptake and metabolism, it may be argued that the relevance of this effect may be limited in terms of functional efficacy. However, several investigators have correlated changes in movement and behaviour with increased striatal DA metabolism but unchanged DA release (Diana et al. 1989; Sabol et al. 1990; Cenci et al. 1992; Nakahara et al. 1992; Paul et al. 2000), suggesting that undetectable changes in striatal DA release may be sufficient to induce alterations in movement and behaviour.

In reserpine pre-treated rats, DA levels remained below the detection limit of 10 fmol/20 µL dialysate, whereas baseline concentrations of DA metabolites were only slightly decreased in comparison to non-drug-treated animals. Interestingly, STN-HFS was followed by an increase in striatal extracellular DOPAC and HVA, whereas DA remained below the detection limit. These experiments were performed to further test the hypothesis that the STN-HFS-induced increase in striatal extracellular DOPAC is due to independent activation of DA metabolism and does not derive from released and retaken-up DA. Under physiological conditions, the major portion of striatal extracellular DA derives from exocytotic DA release (Elsworth and Roth 1997). Reserpine treatment dramatically decreases striatal extracellular DA by preventing intraneuronal DA reuptake to the vesicular DA storage pool (Dahlström et al. 1965; Guldberg and Broch 1971) without exerting pronounced effects on the cytoplasmic newly synthesized DA pool and consequently on extracellular DOPAC concentrations (Callaway et al. 1989; Arbuthnott et al. 1990b; Wong et al. 1993; Kannari et al. 2000). Since the reserpine-sensitive vesicular storage pool is believed to be the origin of exocytotic DA release (Arbuthnott et al. 1990b; Justice et al. 1988), the STN-HFS-induced increase in DA metabolites may reflect enhanced metabolism of the cytoplasmic newly synthesized DA pool.

A synthesis of the results after reserpine pre-treatment and reuptake inhibition suggests that the STN-HFS-induced increase in DOPAC does not originate from metabolism of exocytotic DA release. The question remains whether there is any physiological significance of an increase in synthesis and metabolism of a transmitter that is unrelated to its increased release. In this respect, increased intracellular DA concentrations have been shown to cause measurable electrophysiological effects, including a depressant effect on spike activity (Krnjevic et al. 1978) and could, therefore, participate in the overall mechanism by which STN-HFS modulates striatal DA activity.

The present microdialysis experiments were completed under extreme conditions. The conclusions drawn during nomifensine, pargyline and reserpine treatment should be cautiously extended to non-drug conditions, as these compounds have very strong pharmalogical effects on DA synthesis and metabolism. Consequently, DA release and metabolism may both be forced to follow unusual pathways. However, this problem applies to all pharmacological experiments. Moreover, other techniques are still limited by the stimulation artefact. Thus, the methods used in our experiments are presently the best available to further characterize the impact of STN-HFS on the neuronal activity of the nigrostriatal system.

All of the above-reported changes strongly suggest that STN-HFS enhances striatal DA release and metabolism. In general, such an increase in DA release and metabolism could be triggered by modification of either the activity or the protein biosynthesis of the rate-limiting enzyme, TH (Kumer and Vrana 1996). Indeed, STN-HFS increased striatal TH activity, whereas TH gene expression remained unchanged. This could be related to transient short-term activation of TH via protein kinase-mediated Ser19, Ser31 or Ser40 phosphorylation (Haycock et al. 1992; Lindgren et al. 2001) and could further explain the activation of DA metabolism via increased DA synthesis. The reversibility and delayed increase in DOPAC and HVA are in agreement with such a transient short-term activation of TH activity. Furthermore, assuming a sustained level of increased striatal DA release under continued STN-HFS, enhanced DA synthesis could also renew the releasable DA pool.

In conclusion, the present data show that STN-HFS induces (i) an increase in striatal exocytotic DA release; (ii) an independent activation of striatal DA metabolism and (iii) an activation of striatal TH activity without changes in TH gene expression.

High-frequency stimulation of the STN is believed to exert its main effects via the basal ganglia output structures (Benazzouz and Hallett 2000). However, the present results support and extend our previous findings (Paul et al. 2000; Meissner et al. 2001) suggesting that the effectiveness of STN-HFS in PD patients may also be partially mediated via the striatal DA system (i.e. improving motor and non-motor symptoms such as cognitive deficits). Furthermore, since STN-HFS induced a similar relative increase in DA metabolites in normal and 6-OHDA-lesioned rats (anaesthetized and awake) in our previous studies (Paul et al. 2000; Meissner et al. 2001; Meissner et al. 2002), whereas absolute baseline values were decreased in relation to the extent of the lesion, all of the above-reported changes may also occur in remaining nigral DA neurones in late-stage PD, contributing to the overall effect of STN-HFS in PD.

References

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Animals
  5. Drug treatment
  6. Surgery and microdialysis
  7. Tyrosine hydroxylase activity assay
  8. Semi quantitative measurement of tyrosine hydroxylase mRNA using RT-PCR
  9. Histological verification
  10. Data analysis
  11. Results
  12. High-frequency stimulation in non-drug-treated animals
  13. High-frequency stimulation after dopamine reuptake inhibition
  14. High-frequency stimulation after monoamine oxidase inhibition
  15. High-frequency stimulation after dopamine depletion
  16. Tyrosine hydroxylase activity and tyrosine hydroxylase mRNA expression
  17. Discussion
  18. Acknowledgements
  19. References
  • Arbuthnott G. W., Fairbrother I. S. and Butcher S. P. (1990a) Brain microdialysis studies on the control of dopamine release and metabolism in vivo. J. Neurosci. Meth. 34, 7381.
  • Arbuthnott G. W., Fairbrother I. S. and Butcher S. P. (1990b) Dopamine release and metabolism in the rat striatum: an analysis by ‘in vivo’ brain microdialysis. Pharmacol. Ther. 48, 281293.
  • Benabid A. L., Benazzouz A., Hoffmann D., Limousin P., Krack P. and Pollak P. (1998) Long-term electrical inhibition of deep brain targets in movement disorders. Mov. Disord. 13, 119125.
  • Benazzouz A. and Hallett M. (2000) Mechanism of action of deep brain stimulation. Neurology 55, S13S16.
  • Bowyer J. F., Frame L. T., Clausing P., Nagamoto-Combs K., Osterhout C. A., Sterling C. R. and Tank A. W. (1998) Long-term effects of amphetamine neurotoxicity on tyrosine hydroxylase mRNA and protein in aged rats. J. Pharmacol. Exp. Ther. 286, 10741085.
  • Bruet N., Windels F., Bertrand A., Feuerstein C., Poupard A. and Savasta M. (2001) High frequency stimulation of the subthalamic nucleus increases the extracellular contents of striatal dopamine in normal and partially dopaminergic denervated rats. J. Neuropathol. Exp. Neurol. 60, 1524.
  • Butcher S. P., Fairbrother I. S., Kelly J. S. and Arbuthnott G. W. (1988) Amphetamine-induced dopamine release in the rat striatum: an in vivo microdialysis study. J. Neurochem. 50, 346355.
  • Butcher S. P., Fairbrother I. S., Kelly J. S. and Arbuthnott G. W. (1990) Effects of selective monoamine oxidase inhibitors on the in vivo release and metabolism of dopamine in the rat striatum. J. Neurochem. 55, 981988.
  • Callaway C. W., Kuczenski R. and Segal D. S. (1989) Reserpine enhances amphetamine stereotypies without increasing amphetamine-induced changes in striatal dialysate dopamine. Brain Res. 505, 8390.
  • Cenci M. A., Kalen P., Mandel R. J. and Bjorklund A. (1992) Regional differences in the regulation of dopamine and noradrenaline release in medial frontal cortex, nucleus accumbens and caudate-putamen: a microdialysis study in the rat. Brain Res. 581, 217228.
  • Dahlström A., Fuxe K. and Hillarp N. A. (1965) Site of action of reserpine. Acta Pharmacol. Toxicol. 22, 277292.
  • Diana M., Garcia-Munoz M., Richards J. and Freed C. R. (1989) Electrophysiological analysis of dopamine cells from the substantia nigra pars compacta of circling rats. Exp. Brain Res. 74, 625630.
  • Di Chiara G., Carboni E., Morelli M., Cozzolino A., Tanda G. L., Pinna A., Russi G. and Consolo S. (1993) Stimulation of dopamine transmission in the dorsal caudate nucleus by pargyline as demonstrated by dopamine and acetylcholine microdialysis and Fos immunohistochemistry. Neuroscience 55, 451456.
  • Ehringer H. and Hornykiewicz O. (1960) Verteilung von Noradrenalin und Dopamin (3-Hydroxytyramin) im Gehirn des Menschen und ihr Verhalten bei Erkrankungen des extrapyramidalen Systems. Klin. Wochenschr. 38, 12361239.
  • Elsworth J. D. and Roth R. H. (1997) Dopamine synthesis, uptake, metabolism, and receptors: relevance to gene therapy of Parkinson's disease. Exp. Neurol. 144, 49.
  • Elverfors A., Pileblad E., Lagerkvist S., Bergquist F., Jonason J. and Nissbrandt H. (1997) 3-Methoxytyramine formation following monoamine oxidase inhibition is a poor index of dendritic dopamine release in the substantia nigra. J. Neurochem. 69, 16841692.
  • Galloway M. P., Wolf M. E. and Roth R. H. (1986) Regulation of dopamine synthesis in the medial prefrontal cortex is mediated by release modulating autoreceptors: studies in vivo. J. Pharmacol. Exp. Ther. 236, 689698.
  • Gerhardt G. A. and Maloney R. E. (1999) Microdialysis studies of basal levels and stimulus-evoked overflow of dopamine and metabolites in the striatum of young and aged Fischer 344 rats. Brain Res. 816, 6877.
  • Guldberg H. C. and Broch O. J. (1971) On the mode of action of reserpine on dopamine metabolism in the rat striatum. Eur. J. Pharmacol. 13, 155167.
  • Haycock J. W., Ahn N. G., Cobb M. H. and Krebs E. G. (1992) ERK1 and ERK2, two microtubule-associated protein 2 kinases, mediate the phosphorylation of tyrosine hydroxylase at serine-31 in situ. Proc. Natl Acad. Sci. USA 89, 23652369.
  • Imperato A. and Di Chiara G. (1984) Trans-striatal dialysis coupled to reverse phase high performance liquid chromatography with electrochemical detection: a new method for the study of the in vivo release of endogenous dopamine and metabolites. J. Neurosci. 4, 966977.
  • Justice J. B., Nicolaysen L. C. and Michael A. C. (1988) Modeling the dopaminergic nerve terminal. J. Neurosci. Meth. 22, 239252.
  • Kannari K., Tanaka H., Maeda T., Tomiyama M., Suda T. and Matsunaga M. (2000) Reserpine pretreatment prevents increases in extracellular striatal dopamine following L-DOPA administration in rats with nigrostriatal denervation. J. Neurochem. 74, 263269.
  • Krack P., Limousin P., Benabid A. L. and Pollak P. (1997a) Chronic stimulation of subthalamic nucleus improves levodopa-induced dyskinesias in Parkinson's disease. Lancet 350, 1676.
  • Krack P., Pollak P., Limousin P., Benazzouz A. and Benabid A. L. (1997b) Stimulation of subthalamic nucleus alleviates tremor in Parkinson's disease. Lancet 350, 1675.
  • Krack P., Hamel W., Mehdorn H. M. and Deuschl G. (1999) Surgical treatment of Parkinson's disease. Curr. Opin. Neurol. 12, 417425.
  • Krnjevic K., Lamour Y., MacDonald J. F. and Nistri A. (1978) Intracellular actions of monoamine transmitters. Can. J. Physiol. Pharmacol. 56, 896900.
  • Kumer S. C. and Vrana K. E. (1996) Intricate regulation of tyrosine hydroxylase activity and gene expression. J. Neurochem. 67, 443462.
  • Limousin P., Krack P., Pollak P., Benazzouz A., Ardouin C., Hoffmann D. and Benabid A. L. (1998) Electrical stimulation of the subthalamic nucleus in advanced Parkinson's disease. N. Engl. J. Med. 339, 11051111.
  • Lindberg R. L. and Syvalahti E. K. (1986) Metabolism of nomifensine after oral and intravenous administration. Clin. Pharmacol. Ther. 39, 378383.
  • Lindgren N., Xu Z. Q., Herrera-Marschitz M., Haycock J., Hokfelt T. and Fisone G. (2001) Dopamine D(2) receptors regulate tyrosine hydroxylase activity and phosphorylation at Ser40 in rat striatum. Eur. J. Neurosci. 13, 773780.
  • Lowry O. H., Rosebrough N. J., Farr A. L. and Randall R. J. (1951) Protein measurement with the folin phenol reagent. J. Biol. Chem. 193, 265275.
  • Marsden C. D., Parkes J. D. and Quinn N. (1982) Fluctuations of disability in Parkinson's disease-clinical aspects, in Neurology 2: Movement Disorders (MarsdenC. D. and FahnS., eds), pp. 96122. Butterworth Scientific, London.
  • Meissner W., Reum T., Paul G., Harnack D., Sohr R., Morgenstern R. and Kupsch A. (2001) Striatal dopaminergic metabolism is increased by deep brain stimulation of the subthalamic nucleus in 6-hydroxydopamine lesioned rats. Neurosci. Lett. 303, 165168.
  • Meissner W., Harnack D., Paul G., Reum T., Sohr R., Morgenstern R. and Kupsch A. (2002) Deep brain stimulation of subthalamic neurons increases striatal dopamine metabolism and induces contralateral circling in freely moving 6-hydroxydopamine-lesioned rats. Neurosci. Lett. 328, 105108.
  • Nagatsu T., Oka K. and Kato T. (1979) Highly sensitive assay for tyrosine hydroxylase activity by high-performance liquid chromatography. J. Chromatogr. 163, 247252.
  • Nakahara D., Fuchikami K., Ozaki N., Iwasaki T. and Nagatsu T. (1992) Differential effect of self-stimulation on dopamine release and metabolism in the rat medial frontal cortex, nucleus accumbens and striatum studied by in vivo microdialysis. Brain Res. 574, 164170.
  • Naoi M., Takahashi T. and Nagatsu T. (1988) Simple assay procedure for tyrosine hydroxylase activity by high-performance liquid chromatography employing coulometric detection with minimal sample preparation. J. Chromatogr. 427, 229238.
  • Panova N. G., Axenova L. N. and Medvedev A. E. (2000) The stimulating effects of ethanol consumption on synthesis of rat brain monoamine oxidases and their sensitivity to the irreversible inhibitor, pargyline. Neurosci. Lett. 292, 6668.
  • Paul G., Reum T., Meissner W., Marburger A., Sohr R., Morgenstern R. and Kupsch A. (2000) High frequency stimulation of the subthalamic nucleus influences striatal dopaminergic metabolism in the naive rat. Neuroreport 11, 441444.
  • Paxinos W. and Watson C. (1997) The Rat Brain in Stereotaxic Coordinates. Academic Press, San Diego.
  • Planz G., Quiring K. and Palm D. (1972) Rates of recovery of irreversibly inhibited monoamine oxidases: a measure of enzyme protein turnover. Naunyn Schmiedebergs Arch. Pharmacol. 273, 2742.
  • Roth R. H., Murrin L. C. and Walters J. R. (1976) Central dopaminergic neurons: effects of alterations in impulse flow on the accumulation of dihydroxyphenylacetic acid. Eur. J. Pharmacol. 36, 163171.
  • Sabol K. E., Richards J. B. and Freed C. R. (1990) In vivo dialysis measurements of dopamine and DOPAC in rats trained to turn on a circular treadmill. Pharmacol. Biochem. Behav. 36, 2128.
  • Segal D. S. and Kuczenski R. (1974) Tyrosine hydroxylase activity: regional and subcellular distribution in the brain. Brain Res. 68, 261266.
  • Tokuyama W., Hashimoto T., Li Y. X., Okuno H. and Miyashita Y. (1999) Quantification of neurotrophin-3 mRNA in the rat hippocampal subregions using the RT-PCR-based coamplification method. Brain Res. Brain Res. Protoc. 4, 407414.
  • Waldmeier P. C. and Maitre L. (1976) Comparison of short and long-lasting effects of pargyline on cerebral dopamine metabolism. Naunyn Schmiedebergs Arch. Pharmacol. 294, 133140.
  • Wong P. T., Teo W. L. and Lee T. (1993) A microdialysis study on striatal dopamine, 5-HT and metabolites in conscious rats after various treatments: evidence for extravesicular release of dopamine. Neuroreport 5, 5356.
  • Yahr M. D., Duvoisin R. C., Schear M. J., Barrett R. E. and Hoehn M. M. (1969) Treatment of parkinsonism with levodopa. Arch. Neurol. 21, 343354.
  • Zetterström T., Sharp T., Marsden C. A. and Ungerstedt U. (1983) In vivo measurement of dopamine and its metabolites by intracerebral dialysis: changes after d-amphetamine. J. Neurochem. 41, 17691773.
  • Zetterström T., Sharp T., Collin A. K. and Ungerstedt U. (1988) In vivo measurement of extracellular dopamine and DOPAC in rat striatum after various dopamine-releasing drugs; implications for the origin of extracellular DOPAC. Eur. J. Pharmacol. 148, 327334.