SEARCH

SEARCH BY CITATION

Keywords:

  • blood–brain barrier;
  • endothelin-1;
  • interleukin-1β;
  • neuropathogenesis;
  • tumour necrosis factor-α

Abstract

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Materials
  5. In vitro human BBB model
  6. Flow cytometry
  7. Exposure of the in vitro human BBB model to TNF-α
  8. Enzyme immunometric assay for ET-1
  9. Enzyme-linked immunosorbent assay (ELISA) for IL-1β in cell culture supernatants
  10. RNA extraction and real-time RT–PCR
  11. Quantification of real-time PCR for ET-1
  12. Endothelial cell permeability
  13. Data analysis
  14. Results
  15. TNF-α induced production of ET-1 in an in vitro co-culture model of the human BBB
  16. ET-1 failed to increase brain endothelial permeability in the absence of astrocytes
  17. Exposure of the in vitro human BBB model to TNF-α induced IL-1β mRNA synthesis by astrocytes
  18. ET-1 increased expression of IL-1β in single cultures of human primary astrocytes
  19. Effect of IL-1β on BBB permeability
  20. Discussion
  21. Acknowledgement
  22. References

Evidence suggests that endothelin-1 (ET-1) plays an essential role in brain inflammation. However, whether ET-1 contributes directly to blood–brain barrier (BBB) breakdown remains to be elucidated. Using an in vitro BBB model consisting of co-cultures of human primary astrocytes and brain microvascular endothelial cells (BMVECs), we first investigated the expression of ET-1 by BMVECs upon stimulation with tumour necrosis factor (TNF)-α, which plays an essential role in the induction and synthesis of ET-1 during systemic inflammatory responses. Increased ET-1 mRNA was detected in the human BMVECs 24 h after TNF-α treatment. This was correlated with an increase in ET-1 levels in the culture medium, as determined by sandwich immunoassay. Both TNF-α and ET-1 increased the permeability of human BMVECs to a paracellular tracer, sucrose, but only in the presence of astrocytes. The increase in BMVEC permeability by TNF-α was partially prevented by antibody neutralization of ET-1 and completely by monoclonal antibody against IL-1β. Concomitantly, TNF-α induced IL-1β mRNA expression by astrocytes in co-culture and this effect was partially prevented by ET-1 antibody neutralization. In parallel experiments, treatment of human primary astrocytes in single cultures with ET-1 for 24 h induced IL-1β mRNA synthesis and IL-1β protein secretion in the cell culture supernatant. Taken together, these results provide evidence for paracrine actions involving ET-1, TNF-α and IL-1β between human astrocytes and BMVECs, which may play a central role in BBB breakdown during CNS inflammation.

Abbreviations used
BBB

blood–brain barrier

BMVEC

brain microvascular endothelial cell

ELISA

enzyme-linked immunosorbent assay

ET-1

endothelin-1

IL

interleukin

mAb

monoclonal antibody

PBS

phosphate-buffered saline

TNF

tumour necrosis factor

Endothelin-1 (ET-1) is a 21-amino-acid peptide considered to belong to the cytokine family. Isolated from endothelial cells, ET-1 has been found to be one of the most potent vasoconstrictor peptides in humans (Yanagisawa et al. 1988). In addition, ET-1 has been implicated as a mediator of cerebrovascular responses in ischaemic stroke and subarachnoid haemorrhage (Masaoka et al. 1989; Kohno et al. 1990; Suzuki et al. 1990; Yasuda et al. 1990; Lampl et al. 1997). ET-1 also exerts a wide spectrum of effects on non-vascular tissues, including those of the CNS. Recent evidence demonstrated the neuropathological significance of ET-1, as shown by the correlation between increased blood–brain barrier (BBB) permeability (Narushima et al. 1999; Chi et al. 2001), and increased ET-1 levels in CSF and CNS parenchyma (Rolinski et al. 1999), although its prime role in this process and the underlying mechanisms remain to be elucidated.

The role of cytokines such as interleukin (IL)-1β and tumour necrosis factor (TNF)-α in the neuropathogenesis of brain inflammation is well established (Griffin et al. 1994; Boven et al. 1999). IL-1β has been shown to be associated with the pathophysiology of demyelinating disorders such as multiple sclerosis and viral infections of the CNS (Clerici et al. 2001; Luomala et al. 2001; Niino et al. 2001). Recent evidence has further demonstrated the pathological significance of IL-1β (Samad et al. 2001). Thus, inflammation is a key component in traumatic brain injury pathophysiology.

As the release of ET-1 can be modulated by inflammatory cytokines such as TNF-α (Ohta et al. 1990; Yoshizumi et al. 1990; Ehrenreich et al. 1993; Kugaya et al. 1997), we first investigated the expression of ET-1 by the major cellular component of the BBB, brain microvascular endothelial cells (BMVECs), upon stimulation with TNF-α. In addition, ET-1-induced effects on BBB permeability were examined. Particular emphasis was placed on the paracrine effects of ET-1 on IL-1β production by human primary astrocytes. Here we show that TNF-α induced the production of ET-1 in an in vitro model of human BBB. Both TNF-α and ET-1 induced permeability changes in human BMVECs cultured above astrocytes but not in a single monolayer culture of BMVECs. This effect was associated with TNF-α-induced IL-1β synthesis by astrocytes which was prevented by ET-1 antibody neutralization. ET-1 treatment of human primary astrocytes in single culture induced IL-1β synthesis in these cells. We therefore suggest that paracrine actions involving ET-1, TNF-α and IL-1β between astrocytes and brain endothelial cells may have a role in BBB breakdown during CNS inflammation.

Materials

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Materials
  5. In vitro human BBB model
  6. Flow cytometry
  7. Exposure of the in vitro human BBB model to TNF-α
  8. Enzyme immunometric assay for ET-1
  9. Enzyme-linked immunosorbent assay (ELISA) for IL-1β in cell culture supernatants
  10. RNA extraction and real-time RT–PCR
  11. Quantification of real-time PCR for ET-1
  12. Endothelial cell permeability
  13. Data analysis
  14. Results
  15. TNF-α induced production of ET-1 in an in vitro co-culture model of the human BBB
  16. ET-1 failed to increase brain endothelial permeability in the absence of astrocytes
  17. Exposure of the in vitro human BBB model to TNF-α induced IL-1β mRNA synthesis by astrocytes
  18. ET-1 increased expression of IL-1β in single cultures of human primary astrocytes
  19. Effect of IL-1β on BBB permeability
  20. Discussion
  21. Acknowledgement
  22. References

The following reagents were purchased: ET-1 from Biovalley (Marne la Vallée, France); ET-1, β-actin, cyclophilin and IL-1β primers from MWG Biotech (Courtabeuf, France); [U-14C]sucrose (350 mCi/mmol) from Amersham Pharmacia Biotech (Amersham, UK); enhanced avian RT–PCR kit and recombinant human TNF-α from Sigma (St Louis, MO, USA); isotypic mouse IgG1 monoclonal antibody from Boehringer Mannheim Biochemica (Meylan, France); R-phycoerythrin-conjugated secondary antibodies from Jackson Immunoresearch (West Baltimore, MD, USA); platinum quantitative PCR SuperMix-UDG from Life Technologies (Noisy le Grand, France); and iCycler PCR Reaction Mix SYBR Green I from Bio-Rad Laboratories (Hercules, CA, USA). Mouse monoclonal antibody (mAb) anti-ET-1 was produced in the laboratory.

In vitro human BBB model

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Materials
  5. In vitro human BBB model
  6. Flow cytometry
  7. Exposure of the in vitro human BBB model to TNF-α
  8. Enzyme immunometric assay for ET-1
  9. Enzyme-linked immunosorbent assay (ELISA) for IL-1β in cell culture supernatants
  10. RNA extraction and real-time RT–PCR
  11. Quantification of real-time PCR for ET-1
  12. Endothelial cell permeability
  13. Data analysis
  14. Results
  15. TNF-α induced production of ET-1 in an in vitro co-culture model of the human BBB
  16. ET-1 failed to increase brain endothelial permeability in the absence of astrocytes
  17. Exposure of the in vitro human BBB model to TNF-α induced IL-1β mRNA synthesis by astrocytes
  18. ET-1 increased expression of IL-1β in single cultures of human primary astrocytes
  19. Effect of IL-1β on BBB permeability
  20. Discussion
  21. Acknowledgement
  22. References

The in vitro BBB model consisted of human BMVECs co-cultured with human primary astrocytes (Bio Whittaker, Emrainville, France) as described previously (Mégard et al. 2002). All cell strains tested negative for human immunodeficiency virus 1 and hepatitis B DNA by PCR. BMVECs and astrocytes stained positively for 1,1′-dioctadecyl-3,3,3′,3′-tetramethylindocarbocyanine perchlorate acetylated low-density lipoprotein and glial fibrillary acid protein respectively. Briefly, astrocytes (5 × 104 cells) were plated on transwell plates (Costar; Dutscher, Brumath, France) in an astrocyte-specific basal medium (Bio whittaker). After 72 h, BMVECs (5 × 104 cells) were seeded on the upper side of a collagen-coated polytetrafluoroethylene polyester polystyrene TranswellR membrane (Costar; pore size 0.4 µm, diameter 12 mm, insert growth area 1 cm2) in the BMVEC-specific medium (0.5 mL). The microplates were then incubated at 37°C in an atmosphere containing 5% CO2. Under these experimental conditions, BMVECs formed a confluent monolayer within 15–20 days (Mégard et al. 2002).

Flow cytometry

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Materials
  5. In vitro human BBB model
  6. Flow cytometry
  7. Exposure of the in vitro human BBB model to TNF-α
  8. Enzyme immunometric assay for ET-1
  9. Enzyme-linked immunosorbent assay (ELISA) for IL-1β in cell culture supernatants
  10. RNA extraction and real-time RT–PCR
  11. Quantification of real-time PCR for ET-1
  12. Endothelial cell permeability
  13. Data analysis
  14. Results
  15. TNF-α induced production of ET-1 in an in vitro co-culture model of the human BBB
  16. ET-1 failed to increase brain endothelial permeability in the absence of astrocytes
  17. Exposure of the in vitro human BBB model to TNF-α induced IL-1β mRNA synthesis by astrocytes
  18. ET-1 increased expression of IL-1β in single cultures of human primary astrocytes
  19. Effect of IL-1β on BBB permeability
  20. Discussion
  21. Acknowledgement
  22. References

Flow cytometric analysis of cells was performed on a FACS-Calibur cytometer (Becton-Dickinson, Rungis, France). For cytoplasmic staining, cells were scraped and fixed with Cytofix/cytopermeTM solution (Pharmingen, Rungis, France) for 20 min at 4°C. The cells were washed and resuspended in 50 µL perm/wash (Pharmingen) and labelled for 30 min on ice with primary specific antibodies (1 µg/mL) followed by a further 30 min with phycoerythrin-conjugated goat anti-mouse IgG-F(ab′)2 antibody in the presence of human serum (10%). Unstained cells were used as background control. Negative control analyses were carried out using isotype-matched irrelevant antibodies in place of primary antibody.

Exposure of the in vitro human BBB model to TNF-α

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Materials
  5. In vitro human BBB model
  6. Flow cytometry
  7. Exposure of the in vitro human BBB model to TNF-α
  8. Enzyme immunometric assay for ET-1
  9. Enzyme-linked immunosorbent assay (ELISA) for IL-1β in cell culture supernatants
  10. RNA extraction and real-time RT–PCR
  11. Quantification of real-time PCR for ET-1
  12. Endothelial cell permeability
  13. Data analysis
  14. Results
  15. TNF-α induced production of ET-1 in an in vitro co-culture model of the human BBB
  16. ET-1 failed to increase brain endothelial permeability in the absence of astrocytes
  17. Exposure of the in vitro human BBB model to TNF-α induced IL-1β mRNA synthesis by astrocytes
  18. ET-1 increased expression of IL-1β in single cultures of human primary astrocytes
  19. Effect of IL-1β on BBB permeability
  20. Discussion
  21. Acknowledgement
  22. References

On the day of the experiments, inserts containing the monolayer of human BMVECs co-cultured with astrocytes were transferred on to a new plate. Cell monolayers were treated with increasing doses of TNF-α (0.005–0.5 µg/mL) for 3 and/or 24 h. After exposure to TNF-α, the supernatant above the model was removed and frozen for enzymatic immunometric assay of ET-1. The BMVECs comprising the monolayer were washed with phosphate-buffered saline (PBS) and then lysed for total RNA extraction.

Enzyme immunometric assay for ET-1

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Materials
  5. In vitro human BBB model
  6. Flow cytometry
  7. Exposure of the in vitro human BBB model to TNF-α
  8. Enzyme immunometric assay for ET-1
  9. Enzyme-linked immunosorbent assay (ELISA) for IL-1β in cell culture supernatants
  10. RNA extraction and real-time RT–PCR
  11. Quantification of real-time PCR for ET-1
  12. Endothelial cell permeability
  13. Data analysis
  14. Results
  15. TNF-α induced production of ET-1 in an in vitro co-culture model of the human BBB
  16. ET-1 failed to increase brain endothelial permeability in the absence of astrocytes
  17. Exposure of the in vitro human BBB model to TNF-α induced IL-1β mRNA synthesis by astrocytes
  18. ET-1 increased expression of IL-1β in single cultures of human primary astrocytes
  19. Effect of IL-1β on BBB permeability
  20. Discussion
  21. Acknowledgement
  22. References

Immunometric assays using acetylcholinesterase conjugate were performed in 96-well microtitre plates coated with anti-ET-1 monoclonal antibody (mAb Endo-18) as described previously (Créminon et al. 1993). Briefly, 100 µL ET-1 solution (standard or sample) were added to each well with 100 µL enzyme tracer (anti-ET-1 mAb Endo-4) labelled with acetylcholinesterase enzyme used at a concentration of 5 or 10 Ellman units/mL). Immunoreaction was allowed to proceed for various times at 20°C. The plates were then washed and solid phase-bound acetylcholinesterase activity was determined by addition of 200 µL Ellman's reagent and measured at a wavelength of 414 nm.

Enzyme-linked immunosorbent assay (ELISA) for IL-1β in cell culture supernatants

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Materials
  5. In vitro human BBB model
  6. Flow cytometry
  7. Exposure of the in vitro human BBB model to TNF-α
  8. Enzyme immunometric assay for ET-1
  9. Enzyme-linked immunosorbent assay (ELISA) for IL-1β in cell culture supernatants
  10. RNA extraction and real-time RT–PCR
  11. Quantification of real-time PCR for ET-1
  12. Endothelial cell permeability
  13. Data analysis
  14. Results
  15. TNF-α induced production of ET-1 in an in vitro co-culture model of the human BBB
  16. ET-1 failed to increase brain endothelial permeability in the absence of astrocytes
  17. Exposure of the in vitro human BBB model to TNF-α induced IL-1β mRNA synthesis by astrocytes
  18. ET-1 increased expression of IL-1β in single cultures of human primary astrocytes
  19. Effect of IL-1β on BBB permeability
  20. Discussion
  21. Acknowledgement
  22. References

ELISAs for human IL-1β in the astrocyte cell culture supernatants were performed using the OptEIATM human IL-1β set (Pharmingen). Briefly, after added 100 µL of diluted capture antibody to each well, 100 µL standard or sample was added with 100 µL biotinylated anti-human IL-1β polyclonal antibody. Immunoreaction was allowed to proceed for 30 min at room temperature. The plates were then washed and 100 µL avidin–horseradish peroxidase conjugate was added to each well and incubated for 30 min at room temperature. After addition of 100 µL tetramethylbenzidine and hydrogen peroxide substrate solution, the absorbance was read at 450 nm.

RNA extraction and real-time RT–PCR

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Materials
  5. In vitro human BBB model
  6. Flow cytometry
  7. Exposure of the in vitro human BBB model to TNF-α
  8. Enzyme immunometric assay for ET-1
  9. Enzyme-linked immunosorbent assay (ELISA) for IL-1β in cell culture supernatants
  10. RNA extraction and real-time RT–PCR
  11. Quantification of real-time PCR for ET-1
  12. Endothelial cell permeability
  13. Data analysis
  14. Results
  15. TNF-α induced production of ET-1 in an in vitro co-culture model of the human BBB
  16. ET-1 failed to increase brain endothelial permeability in the absence of astrocytes
  17. Exposure of the in vitro human BBB model to TNF-α induced IL-1β mRNA synthesis by astrocytes
  18. ET-1 increased expression of IL-1β in single cultures of human primary astrocytes
  19. Effect of IL-1β on BBB permeability
  20. Discussion
  21. Acknowledgement
  22. References

Total RNA was isolated from the cell samples with GenElute (Mammalian total RNA kit; Sigma) and quantified by optical density. Of the total RNA, 1.25 µg was used for RT with enhanced avian reverse transcriptase (Sigma) according to the manufacturer's instructions. Of the cDNA product, 5 µL was added to 45 µL containing platinum quantitative PCR super Mix UDG [60 U/mL, Platinum Taq DNA polymerase, 40 mm Tris-HCl (pH 8.4), 100 mm KCl, 6 mm MgCl2, 400 µm dGTP, 400 µm dATP, 400 µm dCTP, 800 µm dUTP, 40 U/mL uracil DNA glycosylase (UDG)], each primer at 300 nm and iCycler PCR Reaction Mix SYBR Green I. The primers used and PCR conditions are summarized in Table 1. After amplification, a melting curve was obtained by heating at 55°C and fluorescence data were collected at 0.5°C/s.

Table 1.  Nucleotide sequences of probes used in RT–PCR assays and amplification conditions
 SequenceRT–PCR conditions
ET-1Sense 5′ GAGAAACCCACTCCCAGTCC 3′ Antisense 5′ GATGTCCAGGTGGCAGAAGT 3′94°C for 105 s, 60°C for 30 s, 72°C for 30 s; 50 cycles
β-ActinSense 5′ ACGGGGTCACCCACACTGTGC 3′ Antisense 5′ CTAGAAGCATTGCGGTGGACGATG 3′94°C for 105 s, 60°C for 30 s, 72°C for 30 s; 50 cycles
IL-1βSense 5′ GGGCCTCAAGGAAAAGAATC 3′ Antisense 5′ CTGCTTGAGAGGTGCTGATG 3′94°C for 30 s, 60°C for 30 s, 72°C for 45 s; 50 cycles

Quantification of real-time PCR for ET-1

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Materials
  5. In vitro human BBB model
  6. Flow cytometry
  7. Exposure of the in vitro human BBB model to TNF-α
  8. Enzyme immunometric assay for ET-1
  9. Enzyme-linked immunosorbent assay (ELISA) for IL-1β in cell culture supernatants
  10. RNA extraction and real-time RT–PCR
  11. Quantification of real-time PCR for ET-1
  12. Endothelial cell permeability
  13. Data analysis
  14. Results
  15. TNF-α induced production of ET-1 in an in vitro co-culture model of the human BBB
  16. ET-1 failed to increase brain endothelial permeability in the absence of astrocytes
  17. Exposure of the in vitro human BBB model to TNF-α induced IL-1β mRNA synthesis by astrocytes
  18. ET-1 increased expression of IL-1β in single cultures of human primary astrocytes
  19. Effect of IL-1β on BBB permeability
  20. Discussion
  21. Acknowledgement
  22. References

Quantitative analysis of the iCycler iQTM data was performed employing iCycler analysis software (Bio-Rad, Marnes la Coquette, France). The data analysis is divided into two phases: a specificity control for the amplification reaction using the melting curve program of the iCycler iQTM software, followed by use of the quantification program. The SYBR Green I signal of each sample is plotted against the number of cycles. The iCycler iQTM analysis software is used to remove background by setting a noise band. This fluorescence threshold is used to determine cycle numbers that correlate inversely with the log of the initial template concentration. As described by others (Hofmann et al. 2001; Smith et al. 2001), we used the expression of β-actin to normalize the expression data for the ET-1 gene. β-Actin was used as an active and endogenous reference to correct for differences in the amount of total RNA added to a reaction and to compensate for different levels of inhibition during RT of RNA and during PCR.

Endothelial cell permeability

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Materials
  5. In vitro human BBB model
  6. Flow cytometry
  7. Exposure of the in vitro human BBB model to TNF-α
  8. Enzyme immunometric assay for ET-1
  9. Enzyme-linked immunosorbent assay (ELISA) for IL-1β in cell culture supernatants
  10. RNA extraction and real-time RT–PCR
  11. Quantification of real-time PCR for ET-1
  12. Endothelial cell permeability
  13. Data analysis
  14. Results
  15. TNF-α induced production of ET-1 in an in vitro co-culture model of the human BBB
  16. ET-1 failed to increase brain endothelial permeability in the absence of astrocytes
  17. Exposure of the in vitro human BBB model to TNF-α induced IL-1β mRNA synthesis by astrocytes
  18. ET-1 increased expression of IL-1β in single cultures of human primary astrocytes
  19. Effect of IL-1β on BBB permeability
  20. Discussion
  21. Acknowledgement
  22. References

Permeability experiments were carried out as described previously (Mégard et al. 2002). Briefly, after exposure of the in vitro human BBB model to TNF-α or ET-1, on the day of the experiments inserts containing the monolayer of human BMVECs co-cultured with astrocytes were transferred on to a new plate for permeability experiments. Some 0.5 mL BMVEC-specific medium and 1.5 ml astrocyte-specific medium was added to the upper and basal chamber respectively, then 1 µCi/mL (2 nm) [14C]labelled sucrose was added to the upper chamber. The amount of tracer that passed through the inserts at different time points was determined by scintillation counting, and cleared volume with respect to time was calculated as described elsewhere (Pardridge et al. 1990). Triplicate co-cultures and triplicate control wells were used.

TNF-α induced production of ET-1 in an in vitro co-culture model of the human BBB

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Materials
  5. In vitro human BBB model
  6. Flow cytometry
  7. Exposure of the in vitro human BBB model to TNF-α
  8. Enzyme immunometric assay for ET-1
  9. Enzyme-linked immunosorbent assay (ELISA) for IL-1β in cell culture supernatants
  10. RNA extraction and real-time RT–PCR
  11. Quantification of real-time PCR for ET-1
  12. Endothelial cell permeability
  13. Data analysis
  14. Results
  15. TNF-α induced production of ET-1 in an in vitro co-culture model of the human BBB
  16. ET-1 failed to increase brain endothelial permeability in the absence of astrocytes
  17. Exposure of the in vitro human BBB model to TNF-α induced IL-1β mRNA synthesis by astrocytes
  18. ET-1 increased expression of IL-1β in single cultures of human primary astrocytes
  19. Effect of IL-1β on BBB permeability
  20. Discussion
  21. Acknowledgement
  22. References

To establish ET-1 production by human brain endothelial cells in response to TNF-α treatment, amplification of ET-1 DNA was assessed. To quantify the relative abundance of the ET-1 transcripts, we performed real-time PCR using specific primers (Table 1). Real-time PCR showed that the ET-1 mRNA was 2.7- to 8.5-fold higher in BMVECs treated with TNF-α at 0.1 and 0.5 µg/mL respectively (Figs 1a, c and e), whereas the expression of the control β-actin gene did not differ between untreated and TNF-α-treated brain endothelial cells (Figs 1b and d). To test ET-1 release by endothelial cultures, we used an enzyme immunometric assay to measure the levels in supernatants from untreated and TNF-α-treated brain endothelial cells cultured above astrocytes. We found that the levels of ET-1 were significantly increased by 24 h after treatment (p < 0.001) (Fig. 2).

image

Figure 1. Detection of ET-1 DNA using fluorimetric detection of amplified products using iCycler iQTM. (a, c) PCR amplification versus cycle of ET-1 gene. Twenty-four hours after treatment of the BBB with TNF-α at concentration of 0.5 µg/mL (a) and 0.1 µg/mL (c), total RNA was isolated from three brain endothelial cell samples and pooled. After RT of ET-1 mRNA, amplification of ET-1 cDNA was performed with SYBR Green and the primers shown in Table 1. In (a) dark green and blue lines represent brain endothelial cells treated with 0.5 µg/mL TNF-α and untreated cells respectively. In (c) blue and orange lines represent untreated cells and cells treated with treated with 0.1 µg/mL TNF-α respectively. The threshold cycle was lower for cells treated with 0.5 and 0.1 µg/mL TNF-α than for untreated cells, demonstrating a higher level of expression. Results are representative of one of three independent experiments. (b, d) PCR amplification versus cycle of β-actin gene, 24 h after treatment of the BBB with TNF-α as described above. In (b) light green and orange lines represent the untreated brain endothelial cells and cells treated with 0.5 µg/mL TNF-α respectively. In (d) violet blue and yellow lines represent cells treated with 0.1 µg/mL TNF-α and the corresponding untreated cells respectively. Results are representative of one to three independent experiments. (e) Relative expression of the ET-1 gene in brain endothelial cells assessed by real-time PCR. Exposure of brain cells to TNF-α at 0.1 and 0.5 µg/mL led to an increase in ET-1 mRNA synthesis 2.7- and 8.5-fold above basal levels respectively. Results are means of triplicate experiments using pooled mRNA isolated from three BMVEC cell samples. **p < 0.05 versus unstimulated brain cells (one-way anova, bars represent S.D. of triplicate experiments).

Download figure to PowerPoint

image

Figure 2. ET-1 secretion in response to TNF-α. On the day of the experiments, inserts containing the monolayer of human BMVECs co-cultured with astrocytes were transferred on to a new plate. Cell monolayers were treated with increasing doses of TNF-α (0.005–0.5 µg/mL) for 3 and/or 24 h. After exposure to TNF-α, the supernatant above the model was removed for enzymatic immunometric assay of ET-1. Immunometric assays were performed in triplicate, and mean values from two experiments are expressed as ET-1 production in brain endothelial cells cultured above astrocytes. **p < 0.001 versus unstimulated BBB monolayer (one-way anova taking into account analysis of variance comparison).

Download figure to PowerPoint

ET-1 failed to increase brain endothelial permeability in the absence of astrocytes

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Materials
  5. In vitro human BBB model
  6. Flow cytometry
  7. Exposure of the in vitro human BBB model to TNF-α
  8. Enzyme immunometric assay for ET-1
  9. Enzyme-linked immunosorbent assay (ELISA) for IL-1β in cell culture supernatants
  10. RNA extraction and real-time RT–PCR
  11. Quantification of real-time PCR for ET-1
  12. Endothelial cell permeability
  13. Data analysis
  14. Results
  15. TNF-α induced production of ET-1 in an in vitro co-culture model of the human BBB
  16. ET-1 failed to increase brain endothelial permeability in the absence of astrocytes
  17. Exposure of the in vitro human BBB model to TNF-α induced IL-1β mRNA synthesis by astrocytes
  18. ET-1 increased expression of IL-1β in single cultures of human primary astrocytes
  19. Effect of IL-1β on BBB permeability
  20. Discussion
  21. Acknowledgement
  22. References

Inserts containing the monolayer of the human BMVECs co-cultured with astrocytes were transferred on to a new plate. Endothelial cell monolayers in single cultures were then treated with ET-1 (0.1 and 1 µg/mL) and 0.1–0.5 µg/mL TNF-α for 24 h. The permeability to the paracellular marker sucrose across the cell monolayer was then assessed. We found that the clearance value for sucrose was not significantly different between untreated and treated cultures (Figs 3a and b). However, treatment of the monolayer of human BMVECs with ET-1 or TNF-α at 0.1 and 0.5 µg/mL for 24 h in the presence of astrocytes in the basal chamber significantly increased the permeability of the human BMVECs (Figs 4a and b). With antibody neutralization of ET-1 (10 µg/mL), the increase in BMVEC permeability mediated by TNF-α at 0.5 µg/mL was partially prevented (Fig. 4b).

image

Figure 3. ET-1 (a) and TNF-α (b) failed to induce BBB breakdown after 24 h of treatment in a single culture of BMVECs. Clearance was calculated as the slope of the plot of cleared volume versus time. Experiments were performed twice in quadruplicate. Bars represent S.D. of duplicate experiments.

Download figure to PowerPoint

image

Figure 4. (a) ET-1 induced BBB breakdown in co-cultures of BMVECs and astrocytes. Clearance was calculated as the slope of the plot of cleared volume versus time. Experiments were performed twice in quadruplicate. Bars represent duplicate experiments. *p < 0.05 versus untreated BBB monolayer (two-tailed Student's t-test). (b) TNF-α induced BBB breakdown in co-cultures of BMVECs and astrocytes. Experiments were performed twice in quadruplicate. Bars represent duplicate experiments. ***p < 0.001, **p < 0.05 (one-way anova taking into account analysis of variance).

Download figure to PowerPoint

Exposure of the in vitro human BBB model to TNF-α induced IL-1β mRNA synthesis by astrocytes

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Materials
  5. In vitro human BBB model
  6. Flow cytometry
  7. Exposure of the in vitro human BBB model to TNF-α
  8. Enzyme immunometric assay for ET-1
  9. Enzyme-linked immunosorbent assay (ELISA) for IL-1β in cell culture supernatants
  10. RNA extraction and real-time RT–PCR
  11. Quantification of real-time PCR for ET-1
  12. Endothelial cell permeability
  13. Data analysis
  14. Results
  15. TNF-α induced production of ET-1 in an in vitro co-culture model of the human BBB
  16. ET-1 failed to increase brain endothelial permeability in the absence of astrocytes
  17. Exposure of the in vitro human BBB model to TNF-α induced IL-1β mRNA synthesis by astrocytes
  18. ET-1 increased expression of IL-1β in single cultures of human primary astrocytes
  19. Effect of IL-1β on BBB permeability
  20. Discussion
  21. Acknowledgement
  22. References

To demonstrate the possible participation of ET-1 in BBB disruption, we investigated whether ET-1 produced by the BMVECs in response to TNF-α caused BBB disruption by mechanisms involving IL-1β production. The monolayer of human BMVECs was treated with 0.5 µg/mL TNF-α in the upper chamber. Twenty-four hours after cell treatment, astrocytes in the basal chamber were removed, washed with PBS and then lysed for total RNA extraction. Amplification of IL-1β cDNA was assessed by real-time RT–PCR using the specific primers (Table 1). We found that predominant IL-1β mRNA was 12.5-fold higher in astrocytes when co-cultures were treated with TNF-α. Pretreatment of astrocytes with ET-1 antibody neutralization (10 µg/mL) for 1 h partially prevented IL-1β mRNA synthesis in these cells (Fig. 5).

image

Figure 5. Paracrine effect of ET-1 on human primary astrocytes. TNF-α (0.5 µg/mL) was added to the upper chamber of the experimental system in the presence or absence of monoclonal antibody against ET-1 in the lower chamber. Twenty-four hours after treatment, astrocytes were washed, lysed for RNA extraction, RT–PCR and real-time PCR analysis. PCR amplification versus cycle was then plotted and the relative expression of the IL-1β gene was determined. White bar, untreated human BBB; black bar, cells treated with TNF-α in the absence of mAb anti-ET-1 in the lower chamber; hatched bar, cells treated with TNF-α in the presence of mAb anti-ET-1 (10 µg/mL) in the lower chamber. Results are given as means of triplicate experiments. Bars represent the S.D. of three experiments. *p < 0.05 (two-tailed Student's t-test).

Download figure to PowerPoint

ET-1 increased expression of IL-1β in single cultures of human primary astrocytes

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Materials
  5. In vitro human BBB model
  6. Flow cytometry
  7. Exposure of the in vitro human BBB model to TNF-α
  8. Enzyme immunometric assay for ET-1
  9. Enzyme-linked immunosorbent assay (ELISA) for IL-1β in cell culture supernatants
  10. RNA extraction and real-time RT–PCR
  11. Quantification of real-time PCR for ET-1
  12. Endothelial cell permeability
  13. Data analysis
  14. Results
  15. TNF-α induced production of ET-1 in an in vitro co-culture model of the human BBB
  16. ET-1 failed to increase brain endothelial permeability in the absence of astrocytes
  17. Exposure of the in vitro human BBB model to TNF-α induced IL-1β mRNA synthesis by astrocytes
  18. ET-1 increased expression of IL-1β in single cultures of human primary astrocytes
  19. Effect of IL-1β on BBB permeability
  20. Discussion
  21. Acknowledgement
  22. References

Human primary astrocytes were treated for 24 h with ET-1 (0.5 µg/mL). Real-time RT–PCR showed that ET-1 induced the overexpression of IL-1β mRNA (fivefold higher) in human primary astrocytes after 24 h of treatment (Figs 6a, b and d), whereas the expression of the control β-actin gene did not differ between untreated and ET-1-treated astrocytes (Fig. 6c). To test for IL-1β secretion by astrocyte cultures, we used an ELISA to measure the levels in supernatants from untreated and ET-1-treated astrocytes. We found that the levels of IL-1β had significantly increased by 24 h after treatment with 0.5 µg/mL ET-1 (p < 0.0001) (Fig. 7).

image

Figure 6. ET-1 induced the expression of IL-1β mRNA in human primary astrocytes. (a, b) PCR amplification versus cycle. Twenty-four hours after treatment of astrocytes with 0.5 µg/mL ET-1, total RNA was isolated from three astrocytes samples and pooled. After RT of IL-1β mRNA, amplification of IL-1β cDNA with SYBR Green and primers plotted in Table 1 was performed in triplicate. (a) and (b) represent untreated and ET-1-treated astrocytes respectively. The threshold cycle was lower for ET-1 treated cells (threshold cycle mean of triplicate PCR: 24 cycles) than for untreated cells (28 cycles), demonstrating a higher level of expression. Results are representative of one of three independent experiments. (c) PCR amplification versus cycle of β-actin gene, 24 h after treatment of astocytes with ET-1 as described above. The expression of the control β-actin gene did not differ between untreated and ET-1-treated astrocytes. Results are representative of one of three independent experiments. (d) Relative expression of the IL-1β gene in astrocytes assessed by real-time PCR. Exposure of astrocytes to ET-1 led to a fivefold increase in IL-1β mRNA synthesis above basal levels. Results are means of triplicate experiments using pooled mRNA isolated from three astrocyte cell samples. Bars represent the S.D. of three experiments. **p < 0.001 versus untreated cells (two-tailed Student's t-test).

Download figure to PowerPoint

image

Figure 7. Representative example of ET-1-mediated secretion of IL-1β in human primary astrocytes. Astrocytes were treated for 24 h with 0.5 µg/mL ET-1. Cell culture supernatants were removed and IL-1β secretion was quantified by specific IL-1β ELISA. Data represent the mean and S.D. of triplicates of representative experiment (n = 3). ***p < 0.0001 versus untreated astrocytes (two-tailed Student's t-test).

Download figure to PowerPoint

Effect of IL-1β on BBB permeability

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Materials
  5. In vitro human BBB model
  6. Flow cytometry
  7. Exposure of the in vitro human BBB model to TNF-α
  8. Enzyme immunometric assay for ET-1
  9. Enzyme-linked immunosorbent assay (ELISA) for IL-1β in cell culture supernatants
  10. RNA extraction and real-time RT–PCR
  11. Quantification of real-time PCR for ET-1
  12. Endothelial cell permeability
  13. Data analysis
  14. Results
  15. TNF-α induced production of ET-1 in an in vitro co-culture model of the human BBB
  16. ET-1 failed to increase brain endothelial permeability in the absence of astrocytes
  17. Exposure of the in vitro human BBB model to TNF-α induced IL-1β mRNA synthesis by astrocytes
  18. ET-1 increased expression of IL-1β in single cultures of human primary astrocytes
  19. Effect of IL-1β on BBB permeability
  20. Discussion
  21. Acknowledgement
  22. References

The effects of IL-1β on BBB permeability were investigated. IL-1β (1 ng/mL) was added to the basal chamber of the experimental system for 24 h. The permeability of the paracellular marker sucrose across human BMVECs co-cultured with astrocytes was then analysed. We found that the cleared volume for sucrose was significantly increased in treated compared with untreated cells (p < 0.0001) (Fig. 8). In order to implicate IL-1β released from astrocytes in the increase in BBB permeability induced by ET-1, blockade experiments were performed with IL-1β monoclonal antibody. Astrocytes were pretreated with 10 µg/mL IL-1β monoclonal antibody for 1 h in the basal chamber before treatment with ET-1 (0.5 µg/mL) for 24 h. The permeability to sucrose across the cell monolayer of human BMVECs was then assessed as described above. Pretreatment of astrocytes with IL-1β antibody for 1 h prevented the increased in BBB permeability induced by ET-1 (p < 0.0001) (Fig. 8).

image

Figure 8. IL-1β-mediated BBB dysfunction. Astrocytes were pretreated with 10 µg/mL IL-1β mAb antibody (▪) for 1 h in the basal chamber of the human BBB model before treatment with ET-1 (0.5 µg/mL; ▵) or IL-1β (1 ng/mL; ◆) for 24 h. The permeability to the paracellular marker sucrose across the cell monolayer of human BMVECs was then assessed, and the cleared volume was calculated and compared with that of untreated cells (□). Experiments were performed twice in triplicate. Bars represent S.D. of duplicate experiments. ***p < 0.0001 (one-way anova taking into account analysis of variance).

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Materials
  5. In vitro human BBB model
  6. Flow cytometry
  7. Exposure of the in vitro human BBB model to TNF-α
  8. Enzyme immunometric assay for ET-1
  9. Enzyme-linked immunosorbent assay (ELISA) for IL-1β in cell culture supernatants
  10. RNA extraction and real-time RT–PCR
  11. Quantification of real-time PCR for ET-1
  12. Endothelial cell permeability
  13. Data analysis
  14. Results
  15. TNF-α induced production of ET-1 in an in vitro co-culture model of the human BBB
  16. ET-1 failed to increase brain endothelial permeability in the absence of astrocytes
  17. Exposure of the in vitro human BBB model to TNF-α induced IL-1β mRNA synthesis by astrocytes
  18. ET-1 increased expression of IL-1β in single cultures of human primary astrocytes
  19. Effect of IL-1β on BBB permeability
  20. Discussion
  21. Acknowledgement
  22. References

The purpose of this study was to evaluate the ability of ET-1 to mediate in vitro BBB breakdown during CNS inflammation and to investigate the underlying mechanisms. We investigated the hypothesis that ET-1 produced by the BMVECS in response to systemic inflammatory responses leads to BBB disruption by mechanisms involving IL-1β synthesis by astrocytes. This was carried out in an in vitro model of the human BBB (Mégard et al. 2002) that exhibits important features of the BBB in vivo. Major findings of this study are that: (i) the pro-inflammatory cytokine TNF-α significantly increased ET-1 mRNA expression by human BMVECS, an effect correlated with an increase in ET-1 levels in the culture supernatant; (ii) both TNF-α and ET-1 increased the permeability of human BMVECS to a paracellular marker (sucrose), but only in the presence of human primary astrocytes; (iii) the increase in BMVEC permeability was partially prevented by antibody neutralization of ET-1; (iv) this effect was associated with TNF-α-induced IL-1β synthesis by human primary astrocytes; (v) TNF-α-induced IL-1β synthesis in astrocytes was mediated by ET-1; (vi) ET-1 induced IL-1β synthesis in these cells; and (vii) IL-1β increased the permeability of BMVECS. Taken together, these findings provide evidence for an immunoregulatory loop between ET-1, TNF-α and IL-1β in the observed alterations in BBB function during CNS inflammation. These findings are discussed below.

It has been shown that the pro-inflammatory cytokine TNF-α contributes to the breakdown of the BBB in the pathogenesis of a number of brain disorders. For example, TNF-α has been found to alter the permeability of bovine brain endothelial cells (Deli et al. 1995) and cause changes in the BBB in vivo (Ramilo et al. 1990; Kim et al. 1992). The same effect has been described in monolayers of rat cerebral endothelial cells (De Vries et al. 1996). However, the interaction of ET-1 and TNF-α in this process has not been demonstrated using an in vitro primary cell preparation (BMVECs and human primary astrocytes) that mimics as closely as possible the normal human BBB.

TNF-α, which was present in the upper chamber of our experimental system, induced ET-1 production in a dose-dependent manner at the level of the human BBB. Neither TNF-α nor ET-1 directly increased brain endothelial cell permeability. The permeability of treated BMVECs was not statistically different from that of untreated cells. This shows that the effect of TNF-α and ET-1 described previously on BBB permeability was not direct (Burke-Gaffney and Keenan 1993; De Vries et al. 1996; Miller et al. 1996) but rather involved alternative mechanisms. These may include the involvement of parenchymal cellular elements of the brain, as the intracisternal injection of TNF-α in newborn piglets (Megyeri et al. 1992) and the intracisternal application of ET-1 in the dog mediate disruption of the BBB (Narushima et al. 1999). The presence of astrocytes under the monolayer of brain endothelial cells shows the importance of the immunoregulatory loop in the BBB disruption process. Indeed, treatment of BMVECs with TNF-α and/or ET-1 in the presence of human primary astrocytes significantly increased their permeability. Both concentrations of TNF-α (0.1 and 0.5 µg/mL) induced increases in BMVEC permeability with the maximal effect at the highest dose tested (Fig. 4b). The brain endothelial cell permeability induced by TNF-α was partially abrogated by antibody neutralization of ET-1. These findings suggest that ET-1 functions as a mediator between brain endothelial cells and astrocytes, and participates in the BBB breakdown process. We showed a significant dose-dependent increase in BMVEC permeability with TNF-α. Our results suggest mechanisms different from those proposed for BBB breakdown during endothelial cell monolayer treatment with 0.1 µg/mL TNF-α (Brett et al. 1989; Karen et al. 2001; Mark and Muller 1999; Mark et al. 2001), such as G protein-mediated conformational changes in the actin-based cytoskeleton (Brett et al. 1989) and prostaglandin involvement (Karen et al. 2001).

Exposure of BMVECs to TNF-α induced an approximately 12.5-fold increase in IL-1β mRNA synthesis by astrocytes. This effect was partially prevented by ET-1 antibody neutralization. This finding suggests the paracrine action of ET-1 in this process in response to TNF-α by brain endothelial cells. These results agree with the finding of an induction of IL-1β mRNA synthesis in a single culture of human primary astrocytes treated with ET-1 (fivefold above that in untreated astrocytes; Fig. 6d). This is the first report finding of ET-1-induced IL-1β over-expression in human primary astrocytes. Moreover, blockade experiments with the neutralizing monoclonal antibody against IL-1β (Fig. 8) demonstrated that IL-1β is a prime determinant in the increase in brain endothelial cell permeability. This is consistent with previous work that demonstrated a major role of IL-1β in inducing changes in BBB permeability in the rat (Blamire et al. 2000).

In conclusion, our in vitro studies have demonstrated paracrine actions involving ET-1, TNF-α and IL-1β between human primary astrocytes and BMVECs which may play a pivotal role in breakdown of the BBB.

References

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Materials
  5. In vitro human BBB model
  6. Flow cytometry
  7. Exposure of the in vitro human BBB model to TNF-α
  8. Enzyme immunometric assay for ET-1
  9. Enzyme-linked immunosorbent assay (ELISA) for IL-1β in cell culture supernatants
  10. RNA extraction and real-time RT–PCR
  11. Quantification of real-time PCR for ET-1
  12. Endothelial cell permeability
  13. Data analysis
  14. Results
  15. TNF-α induced production of ET-1 in an in vitro co-culture model of the human BBB
  16. ET-1 failed to increase brain endothelial permeability in the absence of astrocytes
  17. Exposure of the in vitro human BBB model to TNF-α induced IL-1β mRNA synthesis by astrocytes
  18. ET-1 increased expression of IL-1β in single cultures of human primary astrocytes
  19. Effect of IL-1β on BBB permeability
  20. Discussion
  21. Acknowledgement
  22. References
  • Blamire A. M., Anthony D. C., Rajagopalan B., Sibson N. R., Perry V. H. and Styles P. (2000) Interleukin-1β-induced changes in blood–brain barrier permeability, apparent diffusion coefficient, and cerebral blood volume in the rat brain: a magnetic resonance study. J. Neurosci. 0, 81538159.
  • Boven L. A., Gomes L., Hery C., Gray F., Verhoef J., Portegies P., Tardieu M. and Nottet H. S. (1999) Increased peroxynitrite activity in AIDS dementia complex: implications for the neuropathogenesis of HIV-1 infection. J. Immunol. 16, 43194327.
  • Brett J., Gerlach H., Nawroth P., Steinberg S., Godman G. and Stern D. (1989) Tumor necrosis factor/cachectin increases permeability of endothelial cell monolayers by a mechanism involving regulatory G proteins. J. Exp. Med. 169, 19771991.
  • Burke-Gaffney A. and Keenan A. K. (1993) Does TNF-alpha directly increase endothelial cell monolayer permeability? Agents Actions 38, Spec No C8385.
  • Chi O. Z., Liu X. and Weiss H. R. (2001) Effects of endothelin-1 on blood–brain barrier permeability during focal cerebral ischemia in rats. Exp. Brain Res. 141, 15.
  • Clerici M., Saresella M., Trabattoni D., Speciale L., Fossati S., Ruzzan S., Cavaretta R., Filippi M., Caputo D. and Ferrante P. (2001) Single-cell analysis of cytokine production shows different immune profiles in multiple sclerosis patients with active or quiescent disease. J. Neuroimmunol. 121, 88101.
  • Créminon C., Frobert Y., Habib A., Maclouf J., Patrono C., Pradelles P. and Grassi J. (1993) Enzyme immunometric assay for endothelin using tandem monoclonal antibodies. J. Immunol. Methods 162, 179192.
  • De Vries H. E., Blom-Roosemalen M. C., Van Oosten M., De Boer A. G., Van Berkel T. J., Breimer D. D. and Kuiper J. (1996) The influence of cytokines on the integrity of the blood–brain barrier in vitro. J. Neuroimmunol. 64, 3743.
  • Deli M. A., Descamps L., Dehouck M. P., Ceccheli T., Joo F., Abraham C. S. and Torpier G. (1995) Exposure of tumor necrosis factor-alpha to luminal membrane of bovine capillary endothelial cells cocultured with astrocytes induces a delayed increase of permeability and cytoplasmic stress formation of actine. J. Neurosci. Res. 41, 717726.
  • Ehrenreich H., Rieckmann P., Sinowatz F., Weih K. A., Arthur L. O., Goebel F. D., Burd P. R., Coligan J. E. and Clouse K. A. (1993) Potent stimulation of monocytic endothelin-1 production by HIV-1 glycoprotein 120. J. Immunol. 150, 46014609.
  • Griffin D. E., Wesselingh S. L. and McArthur J. C. (1994) Elevated central nervous system prostaglandins in human immunodeficiency virus-associated dementia. Ann. Neurol. 35, 592597.
  • Hofmann W. K., De Vos S., Tsukasaki K., Wachsman W., Pinkus G. S., Said J. W. and Koeffler H. P. (2001) Altered apoptosis pathways in mantle cell lymphoma detected by oligonucleotide microarray. Blood 98, 787794.
  • Karen S. M., Trickler W. J. and Miller D. (2001) Tumor necrosis factor-α induces cyclooxygenase-2 expression and prostaglandin release in brain microvessel endothelial cells. J. Pharmacol. Exp. Ther. 297, 10511058.
  • Kim K. S., Wass C. A., Cross A. S. and Opal S. M. (1992) Modulation of blood–brain barrier permeability by tumor necrosis factor and antibody to tumor necrosis factor in rat. Lymphokine Cytokine Res. 11, 293298.
  • Kohno M., Yasunari K., Murakawa K., Yokokawa K., Horio T., Fukui T. and Takeda T. (1990) Plasma immunoreactive endothelin in essential hypertension. Am. J. Med. 88, 614618.
  • Kugaya A., Kagaya A., Zensho H., Oyamada T., Tawara Y., Inagaki M., Uchitomi Y. and Yamawaki S. (1997) Modulation of endothelin-induced intracellular Ca2+ mobilization by interleukin-1 beta and lipopolysaccharide in C6 rat glioma cells. Neuropeptides 31, 187192.
  • Lampl Y., Fleminger G., Gilad R., Galron R., Sarova-Pinhas I. and Sokolovsky M. (1997) Endothelin in cerebrospinal fluid and plasma of patients in early stage of ischemic stroke. Stroke 28, 19511955.
  • Luomala M., Lehtimaki T., Elovaara I., Wang X., Ukkonen M., Mattil K., Laippala P., Koivula T. and Hurme M. (2001) A study of interleukin-1 cluster genes in susceptibility to an severity of multiple sclerosis. J. Neurol. Sci. 185, 123127.
  • Mark K. S. and Miller D. W. (1999) Increased permeability of primary cultured brain microvessel endothelial cell monolayers following TNF-alpha exposure. Life Sci. 64, 19411953.
  • Mark K. S., Trickler W. J. and Miller D. W. (2001) Tumor necrosis factor-alpha induces cyclooxygenase-2 expression and prostaglandin release in brain microvessel endothelial cells. J. Pharmacol. Exp. Ther. 297, 10511058.
  • Masaoka H., Suzuki R., Hirata Y., Emon T. and Hirakawa K. (1989) Raised plasma endothelin aneurysmal subarachnoid hemorrhage. Lancet ii, 1402.
  • Mégard I., Garrigues A., Orlowski S., Clayette P., Jorajuria S., Ezan E. and Mabondzo A. (2002) A co-culture-based model of human blood–brain barrier: application to active transport of indinavir and in vivoin vitro correlation. Brain Res. 927, 153167.
  • Megyeri P., Abrahams C. S., Temesvari P., Kovacs J., Vas T. and Speer C. P. (1992) Recombinant human tumor necrosis factor alpha constricts pial arterioles and increases blood–brain barrier permeability in newborn piglets. Neurosci. Lett. 148, 137140.
  • Miller R. D., Monsul N. T., Vender J. R. and Lehmann J. C. (1996) NMDA- and endothelin-1-induced increases in blood–brain barrier permeability quantitated with Lucifer yellow. J. Neurol. Sci. 136, 3740.
  • Narushima I., Kita T., Kubo K., Yonetani Y., Momochi C., Yoshikawa I., Shimada K. and Nakashima T. (1999) Contribution of endothelin-1 to disruption of blood–brain barrier permeability in dogs. Naunyn Schmiedebergs Arch. Pharmacol. 360, 639645.
  • Niino M., Kikuchi S., Fukazawa T., Yabe I., Sasaki H. and Tashiro K. (2001) Genetic polymorphisms of IL-1beta and IL-1 receptor antagonist in association with multiple sclerosis in Japanese patients. J. Neuroimmunol. 118, 295299.
  • Ohta K., Hirata Y., Imai T., Kanno K., Emori T., Shichiri M. and Marum F. (1990) Cytokine-induced release of endothelin-1 from porcine renal epithelia cells. Biochem. Biophys. Res. Commun. 169, 578584.
  • Pardridge W. M., Triguero D., Yang J. and Cancilla P. A. (1990) Comparison of in vitro and in vivo models of drug transcytosis through the blood–brain barrier. J. Pharmacol. Exp. Ther. 253, 884891.
  • Ramilo O., Saez-Llorens X., Mertsola J., Jafari H., Olsen K. D., Hansen E. J., Yoshinaga M., Ohkawara S., Nariuchi H. and McCracken G. H. (1990) Tumor necrosis factor alpha α/cachectin and interleukin-1β initiate meningeal inflammation. J. Exp. Med. 172, 497507.
  • Rolinski B., Heigermoser A., Lederer E., Bogner J. R., Loch O. and Goebel F. D. (1999) Endothelin-1 is elevated in the cerebrospinal fluid of HIV-infected patients with encephalopathy. Infection 27, 244247.
  • Samad T. A., Moore K. A., Sapirstein A., Billet S., Allchorne A., Poole S., Bonventre J. V. and Woolf C. (2001) Interleukin-1β-mediated induction of Cox-2 in the CNS contributes to inflammatory pain hypersensitivity. Nature 410, 471475.
  • Smith E. R., Allis C. D. and Lucchesi J. C. (2001) Linking global histone acetylation to the transcription enhancement of X-chromosomal genes in Drosophila males. J. Biol. Chem. 276, 3148331486.
  • Suzuki H., Sato S., Suzuki Y., Takekoshi K., Ishihara N. and Shimoda S. (1990) Increased endothelin concentration in CSF from patients with subarachnoid haemorrhage. Acta Neurol. Scand. 81, 553554.
  • Yanagisawa M., Kurihara H., Kimura S., Goto K. and Masaki T. (1988) A novel potent vasoconstrictor peptide produced by vascular endothelial cells. Nature 332, 411415.
  • Yasuda M., Kohno M., Tahara A., Itagane H., Toda I., Akioka K., Teragaki M., Oku H., Takeuchi K. and Takeda T. (1990) Circulating immunoreactive endothelin in ischemic heart disease. Am. Heart J. 119, 801806.
  • Yoshizumi M., Kurihara H., Morita T., Yamashita T., Oh-hashi Y., Sugiyama T., Takaku F., Yanagisawa M., Masaki T. and Yazaki Y. (1990) Interleukin 1 increases the production of endothelin-1 by cultured endothelial cells. Biochem. Biophys. Res. Commun. 166, 324329.