• Please log in or register to access this feature.

SEARCH

SEARCH BY CITATION

Keywords:

  • glia;
  • membrane protein;
  • neuron;
  • palmitoylation;
  • ubiquitination

Abstract

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. cDNA library screening
  5. RNA analysis
  6. In situ hybridization
  7. Antibody production
  8. Subcellular fractionation and immunoblotting
  9. Expression vectors
  10. Ubiquitination analysis in cells
  11. In vitro ubiquitination assay
  12. Palmitoylation analysis
  13. Results
  14. Novel primary structures of Momo and Sakura and their mRNA expression
  15. Cellular distributions of Momo and Sakura proteins
  16. Ubiquitination induced by overexpression of Momo and Sakura in cortical culture
  17. In vitro ubiquitination of Momo and Sakura and their interaction with various E2 components
  18. Dependency of ubiquitination on C-terminal RING finger
  19. Membrane association via the N-terminal domain of Momo and Sakura
  20. Palmitoylation of Sakura
  21. Discussion
  22. Acknowledgements
  23. References

Ubiquitin (Ub) ligation is implicated in active protein metabolism and subcellular trafficking and its impairment is involved in various neurologic diseases. In rat brain, we identified two novel Ub ligases, Momo and Sakura, carrying double zinc finger motif and RING finger domain. Momo expression is enriched in the brain gray matter and testis, and Sakura expression is more widely detected in the brain white matter as well as in many peripheral organs. Both proteins associate with the cell membranes of neuronal and/or glial cells. We examined their Ub ligase activity in vivo and in vitro using viral expression vectors carrying myc-tagged Momo and Sakura. Overexpression of either Momo or Sakura in mixed cortical cultures increased total polyubiquitination levels. In vitro ubiquitination assay revealed that the combination of Momo and UbcH4 and H5c, or of Sakura and UbcH4, H5c and H6 is required for the reaction. Deletion mutagenesis suggested that the E3 Ub ligase activity of Momo and Sakura depended on their C-terminal domains containing RING finger structure, while their N-terminal domains influenced their membrane association. In agreement, Sakura associating with the membrane was specifically palmitoylated. Although the molecular targets of their Ub ligation remain to be identified, these findings imply a novel function of the palmitoylated E3 Ub ligase(s).

Abbreviations used
DTT

dithiothreitol

E1

ubiquitin-activating enzyme

E2

ubiquitin-conjugating enzyme

E3

ubiquitin ligase

IAP

inhibitor of apoptosis

MOI

multiplicity of infection

ORF

open reading frame

PAGE

polyacrylamide gel electrophoresis

PBS

phosphate-buffered saline

PCR

polymerase chain reaction

SDS

sodium dodecyl sulfate

SSC

sodium chloride/sodium citrate buffer

Ub

ubiquitin

The RING finger structure, named after a peculiar amino acid sequence found in ‘Really Interesting New Gene’, represents the zinc binding motif of Cys-X2-Cys-X9/39-Cys-X1/3-His-X2/3-Cys/His-X2-Cys-X4-48-Cys-X2-Cys (Lovering et al. 1993). At present, more than 100 members of this family contain this structure and most of them are suggested to function as a ubiquitin (Ub) ligase (E3) (Lorick et al. 1999). The RING finger proteins such as APC11 and Rbx1/ROC1 were initially isolated as oncogenes and probed to be E3 enzymes in the APC/C and SCF complexes (Tyers and Willems 1999). Although morphologic neuropathology indicates that brain neurons or glia contain Ub-containing inclusion bodies in a variety of neurologic diseases, biological implication of Ub accumulation in these diseases remains to be characterized (DiFiglia et al. 1997; Alves-Rodrigues et al. 1998; Hardy and Gwinn-Hardy 1998; Cummings et al. 1999). Recent progresses in molecular neurology have revealed that some neurodegenerative diseases involve impaired protein ubiquitination and abnormal proteolysis leading to neuronal death. Parkin, identified as a gene product responsible for familial Parkinsonism, contains RING finger domain and functions as an E3 Ub ligase in the nervous system (Kitada et al. 1998; Shimura et al. 2000; Chung et al. 2001b). These observations suggest that the Ub ligase activity of RING finger proteins may contribute to the pathogenesis of many neurodegenerative diseases.

The molecular roles of protein ubiquitination underlying oncogenesis have been intensively investigated and are correlated with catabolism of the regulatory proteins of cell growth and/or the cell cycle (Kamura et al. 1999; Joazeiro et al. 1999; Skowyra et al. 1999; Zachariae and Nasmyth 1999; Honda and Yasuda 2000; Ruffner et al. 2001). Although there are many unique membrane proteins in the nervous system, only a few E3 ligases corresponding to the substrates have been identified (i.e. Parkin, Siah and NEDD4). Siah is an enzyme that transfers Ub to the netrin-1 receptor, DDC (deleted in colorectal cancer), and is suggested to control degradation of the metabotropic glutamate receptor 1 (Hu and Fearon 1999; Ishikawa et al. 1999). NEDD4 is another member of the Ub ligase family that shares a common protein motif named HECT (homologous to E6AP C-terminus) and ubiquitinates amiloride-sensitive sodium channels (Staub et al. 1997). Although most of the targets for Ub ligases localize at special subcellular membrane components to exert their unique functions, the interaction of the Ub ligase with membranes is often indirect and mediated by other molecules (Kavsak et al. 2000; Shenoy et al. 2001; Soubeyran et al. 2002). Thus, it remains to be determined how membrane-bound neural proteins are ubiquitinated and catabolized in neurons and glia, and whether the dysfunction of these processes is associated with human neurodegenerative diseases.

In the present study, we have characterized the novel E3 Ub ligase and its homologue that both associate with neural cell membranes. Their distributions in the brain as well as their enzyme activities as a Ub ligase are examined and discussed.

cDNA library screening

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. cDNA library screening
  5. RNA analysis
  6. In situ hybridization
  7. Antibody production
  8. Subcellular fractionation and immunoblotting
  9. Expression vectors
  10. Ubiquitination analysis in cells
  11. In vitro ubiquitination assay
  12. Palmitoylation analysis
  13. Results
  14. Novel primary structures of Momo and Sakura and their mRNA expression
  15. Cellular distributions of Momo and Sakura proteins
  16. Ubiquitination induced by overexpression of Momo and Sakura in cortical culture
  17. In vitro ubiquitination of Momo and Sakura and their interaction with various E2 components
  18. Dependency of ubiquitination on C-terminal RING finger
  19. Membrane association via the N-terminal domain of Momo and Sakura
  20. Palmitoylation of Sakura
  21. Discussion
  22. Acknowledgements
  23. References

A Sal I-EcoR I genomic fragment spanning 75 bp (849–923 nt; AATCCTGGCTCGGAATTTTGTCAACTATTCTGGCTGCTGTGAAAAGTGGGAGCTGGTGGAGAAAGTCAACCGGCT) was isolated as a part of the down-stream gene by monitoring the binding activity of the neuronal transcription factor HIT-4 (Hirano et al. 2001). Subsequently, 300 000 plaques of the lambda Zap library carrying rat hippocampal cDNA (Stratagene, La Jolla, CA, USA) were screened against the genomic sequence. Eleven clones were isolated and subjected to automatic DNA sequencing (ABI 7700; Applied Bio Instruments, Foster City, CA, USA). All positive clones contained the same sequence and one clone contained a 1952-bp cDNA corresponding to a full open reading frame of Momo. To obtain cDNA homologues to the Momo gene, the same library was screened again at a lower stringency with the entire cDNA fragment for Momo. Accordingly, we obtained its homologue covering the entire translation frame and named the clone Sakura. The nucleotide sequence of Sakura cDNA was 2808 bp long.

RNA analysis

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. cDNA library screening
  5. RNA analysis
  6. In situ hybridization
  7. Antibody production
  8. Subcellular fractionation and immunoblotting
  9. Expression vectors
  10. Ubiquitination analysis in cells
  11. In vitro ubiquitination assay
  12. Palmitoylation analysis
  13. Results
  14. Novel primary structures of Momo and Sakura and their mRNA expression
  15. Cellular distributions of Momo and Sakura proteins
  16. Ubiquitination induced by overexpression of Momo and Sakura in cortical culture
  17. In vitro ubiquitination of Momo and Sakura and their interaction with various E2 components
  18. Dependency of ubiquitination on C-terminal RING finger
  19. Membrane association via the N-terminal domain of Momo and Sakura
  20. Palmitoylation of Sakura
  21. Discussion
  22. Acknowledgements
  23. References

PolyA + RNA was extracted and purified from adult male Sprague–Dawley rats (SLC, Shizuoka, Japan) using the acid guanidium–phenol–chloroform method (Chomczynski and Sacchi 1987). RNA samples were denatured in the presence of 50% formamide and 6% formaldehyde, separated on a 1.5% formaldehyde-agarose gel, and transferred onto a nylon membrane (Pall Scientific, East Hills, NY, USA). A 32P-labeled cDNA probe was generated using the Random primed DNA labeling kit (Boehringer Mannheim). The probe (2 × 106 cpm/mL) was hybridized to filters for 20 h at 42°C in 50% formamide, 5 × sodium chloride/sodium citrate buffer (SSC), 5 × Denhardt's solution and 1% sodium dodecyl sulfate (SDS) followed by washing with 0.1 × SSC, 0.1% SDS at 60°C, and exposure to films.

In situ hybridization

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. cDNA library screening
  5. RNA analysis
  6. In situ hybridization
  7. Antibody production
  8. Subcellular fractionation and immunoblotting
  9. Expression vectors
  10. Ubiquitination analysis in cells
  11. In vitro ubiquitination assay
  12. Palmitoylation analysis
  13. Results
  14. Novel primary structures of Momo and Sakura and their mRNA expression
  15. Cellular distributions of Momo and Sakura proteins
  16. Ubiquitination induced by overexpression of Momo and Sakura in cortical culture
  17. In vitro ubiquitination of Momo and Sakura and their interaction with various E2 components
  18. Dependency of ubiquitination on C-terminal RING finger
  19. Membrane association via the N-terminal domain of Momo and Sakura
  20. Palmitoylation of Sakura
  21. Discussion
  22. Acknowledgements
  23. References

Sense oligoDNAs (AGCACTGGTCCATTCAGGTTTACACCGAGTTCTGACTTTCCTACCTAC for Momo, ACAAGTCACCTCTGTGTTAGCCCAGGATCAGGAAACTCAGCAGGCCATT for Sakura) and antisense oligoDNAs (GTAGGTAGGAAAGTCAGAACTCGGTGTAAACCTGAATGGACCAGTGCT for Momo, AATGGCCTGCTGAGTTTCCTGATCCTGGGCTAACACAGAGGTGACTTGT for Sakura) were selected not to have any significant homology to other genes and labeled with terminal deoxynucleotide transferase (Toyobo Biotech, Osaka, Japan) and [α-35S]dATP (New England Nuclear, Japan, ∼3000 Ci/mmol) (Katagiri et al. 1993). Brain sections were incubated with the hybridization solution [50% formamide, 5 × SSC, 5 × Denhardt's solution, 1 mm EDTA, 0.1 m dithiothreitol (DTT) and 0.5 mg/mL denatured salmon sperm DNA] followed by the solution containing [35S]-labeled oligoDNA (4 × 106 cpm/mL). After overnight hybridization at 42°C, sections were washed with 2 × SSC/4 mm DTT followed by 0.1 × SSC/4 mm DTT and dehydrated with ethanol. Sections were first processed in a BAS 2000 phosphoimager (Fuji Film, Tokyo, Japan) and then exposed to BioMax™ MS film (Eastman Kodak, Rochester, NY, USA).

Antibody production

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. cDNA library screening
  5. RNA analysis
  6. In situ hybridization
  7. Antibody production
  8. Subcellular fractionation and immunoblotting
  9. Expression vectors
  10. Ubiquitination analysis in cells
  11. In vitro ubiquitination assay
  12. Palmitoylation analysis
  13. Results
  14. Novel primary structures of Momo and Sakura and their mRNA expression
  15. Cellular distributions of Momo and Sakura proteins
  16. Ubiquitination induced by overexpression of Momo and Sakura in cortical culture
  17. In vitro ubiquitination of Momo and Sakura and their interaction with various E2 components
  18. Dependency of ubiquitination on C-terminal RING finger
  19. Membrane association via the N-terminal domain of Momo and Sakura
  20. Palmitoylation of Sakura
  21. Discussion
  22. Acknowledgements
  23. References

Recombinant fusion proteins of the N-terminal portion of Momo (1–93 amino acids) and Sakura (1–103 amino acids) were produced in an Escherichia coli BL21 strain from a prokaryotic expression vector, pGEX–2T (Pharmacia, Uppsala, Sweden). Cell lysate from E. coli was purified with a gluthathione-conjugated affinity column (Pharmacia) and subjected to SDS–polyacrylamide gel elecrophoresis (PAGE). An induced protein band (36 kDa for Momo or 37 kDa for Sakura) was recovered and emulsified with Freund's complete adjuvants and used to immunize rabbits. Serum batches showing higher titers were subjected to antigen-affinity chromatography. The affinity column had a bed of Affi-Gel 10 (1 mL; Bio-Rad Laboratories, Hercules, CA, USA) that was coupled to synthetic peptides (1 mg; H-GAVRGQQSAFAGATGPFRFTPN-OH for Momo or H-LDGQPEEVPPPQGARMQAYSNPG-OH for Sakura), or the recombinant proteins used as the antigen. The peptide sequences were derived from their human orthologues (GenBank #AAM29180 for Momo and #AAM29181 for Sakura). As the antigen-affinity purified antibodies cross-reacted with many unidentified proteins (data not shown), the peptide affinity-purified rabbit antibodies for Momo and Sakura were used for immunoblotting.

Subcellular fractionation and immunoblotting

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. cDNA library screening
  5. RNA analysis
  6. In situ hybridization
  7. Antibody production
  8. Subcellular fractionation and immunoblotting
  9. Expression vectors
  10. Ubiquitination analysis in cells
  11. In vitro ubiquitination assay
  12. Palmitoylation analysis
  13. Results
  14. Novel primary structures of Momo and Sakura and their mRNA expression
  15. Cellular distributions of Momo and Sakura proteins
  16. Ubiquitination induced by overexpression of Momo and Sakura in cortical culture
  17. In vitro ubiquitination of Momo and Sakura and their interaction with various E2 components
  18. Dependency of ubiquitination on C-terminal RING finger
  19. Membrane association via the N-terminal domain of Momo and Sakura
  20. Palmitoylation of Sakura
  21. Discussion
  22. Acknowledgements
  23. References

Cerebral cortex and medulla, cerebellar cortex and medulla, and their whole tissues of postnatal day 9 rats were dissected under a macroscope (Olympus, Tokyo, Japan) and homogenized with 10 volumes of 0.25 m sucrose/phosphate-buffered saline (PBS) with a Potter-type homogenizer. Cultured cells were similarly homogenized in 0.25 m sucrose/PBS. Unbroken cells and nuclei were removed by centrifugation at 600 × g for 10 min at 4°C. To obtain a crude mitochondrial fraction (P2), the supernatant was centrifuged at 5000 × g for 10 min at 4°C. Supernatants were further separated into a microsomal fraction (P3) and a cytoplasmic fraction (S3). Both S3 and P3 fractions were denatured and separated by SDS–PAGE using 4–20% gradient gel (NEN, Tokyo, Japan), and then transferred to a nitrocellulose membrane (Schleicher and Schuell, Dassel, Germany). The membrane was incubated with the affinity-purified anti-Momo antibody (10 µg/mL), anti-Sakura antibody (2.5 µg/mL), anti-GM130 (5 µg/mL; BD Transduction Laboratories, Lexington, KY, USA), or anti-catalase (10 µg/mL of Cathepsin C; Nordic Immunological Laboratories, Tilburg, the Netherlands). Immunoreactivity was detected with a goat anti-rabbit immunoglobulin conjugated to peroxidase (1 : 10 000) followed by a chemiluminescence reaction combined with film exposure (Western Lighting Chemiluminescence Reagent Plus; Perkin Elmer, Boston, MA, USA).

Expression vectors

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. cDNA library screening
  5. RNA analysis
  6. In situ hybridization
  7. Antibody production
  8. Subcellular fractionation and immunoblotting
  9. Expression vectors
  10. Ubiquitination analysis in cells
  11. In vitro ubiquitination assay
  12. Palmitoylation analysis
  13. Results
  14. Novel primary structures of Momo and Sakura and their mRNA expression
  15. Cellular distributions of Momo and Sakura proteins
  16. Ubiquitination induced by overexpression of Momo and Sakura in cortical culture
  17. In vitro ubiquitination of Momo and Sakura and their interaction with various E2 components
  18. Dependency of ubiquitination on C-terminal RING finger
  19. Membrane association via the N-terminal domain of Momo and Sakura
  20. Palmitoylation of Sakura
  21. Discussion
  22. Acknowledgements
  23. References

Momo (1–381 amino acids) and Sakura (1–362 amino acids) cDNAs containing their entire coding regions were amplified by polymerase chain reaction (PCR) using KOD plus polymerase (Toyobo Biotech). The PCR products were inserted into the pCi vector (Promega Corp., Madison, WI, USA) carrying a myc-tag sequence at their amino-terminal end; pCi + myc-Momo and pCi + myc-Sakura. The N- and C-terminal portions of Momo and Sakura were deleted using the PCR technique and subcloned again into the pCi + myc vector; pCi + myc-ΔN-Momo and pCi + myc-ΔN-Sakura, and pCi + myc-ΔC-Momo and pCi + myc-ΔC-Sakura, respectively. The expression vector carrying FLAG-tagged Ub was also cotransfected into HEK293 cells; pcDNA3.1(+) FLAG-Ub (Shimura et al. 2000).

Modified Sindbis virus vector plasmid (pSinEGdsp#9) originated from pSinRep5 (Invitrogen, Carlsbad, CA, USA) as described previously (Kawamura et al. 2003). The pSinEGdsp#9 plasmid carried duplicated subgenomic promoters (Psg). The myc-tagged Momo and Sakura fragments were inserted into multiple cloning sites (Xba I-Mlu I) of the pSinEGdsp#9 vector to generate pSin + myc-Momo/EG and pSin + myc-Sakura/EG plasmids, respectively. Additionally the third Psg was inserted into pSinEGdsp#9 and used for the coexpression of FLAG-tagged Ub; pSin + myc-Momo/FLAG-Ub/EG and pSin + myc-Sakura/FLAG-Ub/EG. Viral genome RNA was transcribed using an Invitroscript™ Cap Kit (Invitrogen), and cotransfected with a helper mRNA (DH-26S) (Invitrogen) in BHK cells by electroporation (Gene Pulser, Bio-Rad). The titer of Sindbis virus vector was determined by monitoring EGFP-positive cells. Typically, the viral titer was greater than 108 infectious unit/mL.

Ubiquitination analysis in cells

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. cDNA library screening
  5. RNA analysis
  6. In situ hybridization
  7. Antibody production
  8. Subcellular fractionation and immunoblotting
  9. Expression vectors
  10. Ubiquitination analysis in cells
  11. In vitro ubiquitination assay
  12. Palmitoylation analysis
  13. Results
  14. Novel primary structures of Momo and Sakura and their mRNA expression
  15. Cellular distributions of Momo and Sakura proteins
  16. Ubiquitination induced by overexpression of Momo and Sakura in cortical culture
  17. In vitro ubiquitination of Momo and Sakura and their interaction with various E2 components
  18. Dependency of ubiquitination on C-terminal RING finger
  19. Membrane association via the N-terminal domain of Momo and Sakura
  20. Palmitoylation of Sakura
  21. Discussion
  22. Acknowledgements
  23. References

Primary cortical cells were prepared from embryos of Sprague–Dawley rats (embryonic day 18) as previously described (Narisawa-Saito et al. 1999). The primary culture contained 5–10% glial population and were infected at a multiplicity of infection (MOI) of 1–2 for 1 h at 37°C. The cells were harvested at 22–24-h postinfection and lysed in solubilizing buffer [50 mm Tris-HCl (pH 7.5), 150 mm NaCl, 1% NP-40, and protease inhibitors (2 µg/mL aprotinin, 0.5 µg/mL leupeptin, and 1 µg/mL pepstatin A)]. Alternatively, pCi vectors carrying Momo, Sakura, and their mutants were transfected into HEK293 cells using an alternative calcium phosphate method (Chen and Okayama 1988). The cells were harvested at 42–44-h post-transfection, and lysed with the above solubilizing buffer. During infection or transfection, cells were often treated with 50 µm MG132 (Peptide Inc. Osaka, Japan) for 6 h unless otherwise noted.

Cell lysates were sonicated using a Handy Sonic (Tomy Seiko Co., Ltd, Tokyo, Japan) and centrifuged at 12 000 g for 20 min at 4°C. Protein concentrations of the supernatants were determined using a micro-BCA Protein Assay Reagent (Pierce, Rockford, IL, USA). Each supernatant including 200 µg of protein was incubated with anti-myc rabbit polyclonal antibody (1 µg) and Protein G Sepharose beads (10 µL; Amersham Pharmacia, Buckinghamshire, UK). The immunoprecipitates were eluted from the beads by boiling in 2 × SDS sample buffer and subjected to immunoblotting. The membranes were probed with anti-FLAG (M2), biotin-conjugated anti-FLAG (M2) antibodies (both from Sigma), or an anti-myc monoclonal antibody (9E10; ATCC, Manassas, VA, USA). After washing the membranes, the immunoreaction was detected with the secondary antibodies or streptoavidin conjugated to horseradish peroxidase. Bands were visualized using Western Lighting Chemiluminescence Reagent Plus (Perkin Elmer).

In vitro ubiquitination assay

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. cDNA library screening
  5. RNA analysis
  6. In situ hybridization
  7. Antibody production
  8. Subcellular fractionation and immunoblotting
  9. Expression vectors
  10. Ubiquitination analysis in cells
  11. In vitro ubiquitination assay
  12. Palmitoylation analysis
  13. Results
  14. Novel primary structures of Momo and Sakura and their mRNA expression
  15. Cellular distributions of Momo and Sakura proteins
  16. Ubiquitination induced by overexpression of Momo and Sakura in cortical culture
  17. In vitro ubiquitination of Momo and Sakura and their interaction with various E2 components
  18. Dependency of ubiquitination on C-terminal RING finger
  19. Membrane association via the N-terminal domain of Momo and Sakura
  20. Palmitoylation of Sakura
  21. Discussion
  22. Acknowledgements
  23. References

Semi-purified myc-Momo and myc-Sakura were obtained from cultured cortical neurons infected with Sindbis viral vectors carrying Momo and Sakura, respectively. Culture lysate (200 µg protein) was subjected to immunoprecipitation with 1 µg of anti-myc rabbit IgG-linked protein G Sepharose beads. The immunoprecipitate served as a putative E3 Ub ligase in an in vitro ubiquitination assay with an ATP regenerating system (Suzuki et al. 1999). In brief, 50 µL of reaction mixture contained 10 µL protein G Sepharose bead slurries of the immunoprecipitate, 50 mm Tris-HCl (pH 7.5), 10 mm MgCl2, 20 mm ATP, 0.5 mm DTT, 0.6 U/mL inorganic pyrophosphatase (Sigma), 5 µm MG132, 100 ng of purified recombinant mouse E1 (Ub activating enzyme) (Suzuki et al. 1999), 0.5–1 µm (His)6-tagged E2 enzyme (Murata et al. 2001), 1 mg/mL bovine Ub (Sigma) and 125I-labeled Ub (4 × 106 cpm). The mixture was incubated at 30°C for 2 h. After terminating the reaction by adding 3 × SDS sample buffer, 25 µL of the reaction mixture was separated by SDS–PAGE on a 4–20% gradient gel and visualized by autoradiography.

Producing bacterial recombinant Momo and Sakura, we also tested their E3 activity in vitro (Matsuda et al. 2001; Imai et al. 2003). cDNA for Momo and Sakura was subcloned to a prokaryotic expression vector, pMAL-p2 (New England BioLabs, Beverly, MA). Recombinant Momo and Sakura were produced in E. coli as a fusion protein of maltose binding protein, and purified with amylose resin (New England BioLabs). In vitro ubiquitination assay was carried out similarly in the presence of E1 and UbcH4 (E2).

Palmitoylation analysis

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. cDNA library screening
  5. RNA analysis
  6. In situ hybridization
  7. Antibody production
  8. Subcellular fractionation and immunoblotting
  9. Expression vectors
  10. Ubiquitination analysis in cells
  11. In vitro ubiquitination assay
  12. Palmitoylation analysis
  13. Results
  14. Novel primary structures of Momo and Sakura and their mRNA expression
  15. Cellular distributions of Momo and Sakura proteins
  16. Ubiquitination induced by overexpression of Momo and Sakura in cortical culture
  17. In vitro ubiquitination of Momo and Sakura and their interaction with various E2 components
  18. Dependency of ubiquitination on C-terminal RING finger
  19. Membrane association via the N-terminal domain of Momo and Sakura
  20. Palmitoylation of Sakura
  21. Discussion
  22. Acknowledgements
  23. References

The HEK293 cells were metabolically labeled with [3H]palmitic acid as described previously (Topinka and Bredt 1998). In brief, 40 h after transfection, cells were labeled with 1 mCi/mL [3H]palmitic acid (50 Ci/mmol; New England Nuclear) for 5 h in the presence of cerulenin (2 µg/mL; Sigma) and fatty acid-free bovine serum albumin (10 µg/mL; Sigma). Proteins in the cell suspension (5%) were precipitated with a 50% v/v concentration of acetone to monitor whole [3H]palmitic acid incorporation. The remaining cell suspension (95%) was homogenized in 0.25 m sucrose/PBS by passing through a 25-gauge needle. Unbroken cells and nuclei were removed by centrifugation at 600 × g for 10 min at 4°C. To obtain a soluble fraction (S) and a crude membrane fraction (P), the supernatant was centrifuged at 100 000 × g for 60 min at 4°C. The P fraction was solubilized with RIPA buffer [50 mm Tris-HCl (pH 7.5), 150 mm NaCl, 1% Triton X-100, 1% sodium deoxycholate and protease inhibitors]. Both S and P fractions (200 µg) were subjected to an immunoprecipitation reaction with 1 µg of anti-myc rabbit polyclonal antibody followed by western blotting or autoradiography. For autoradiography, an SDS–PAGE gel was treated with Amplify (Amersham Pharmacia) and exposed to Hyperfilm™ MP (Amersham Pharmacia) at − 80°C.

Novel primary structures of Momo and Sakura and their mRNA expression

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. cDNA library screening
  5. RNA analysis
  6. In situ hybridization
  7. Antibody production
  8. Subcellular fractionation and immunoblotting
  9. Expression vectors
  10. Ubiquitination analysis in cells
  11. In vitro ubiquitination assay
  12. Palmitoylation analysis
  13. Results
  14. Novel primary structures of Momo and Sakura and their mRNA expression
  15. Cellular distributions of Momo and Sakura proteins
  16. Ubiquitination induced by overexpression of Momo and Sakura in cortical culture
  17. In vitro ubiquitination of Momo and Sakura and their interaction with various E2 components
  18. Dependency of ubiquitination on C-terminal RING finger
  19. Membrane association via the N-terminal domain of Momo and Sakura
  20. Palmitoylation of Sakura
  21. Discussion
  22. Acknowledgements
  23. References

We isolated a novel RING finger protein, Momo, and its structural homologue named Sakura from the rat cDNA library (Fig. 1a). Momo cDNA (2224 bp) contained the largest open reading frame, which encodes 381 amino acid residues (42695 Da), while Sakura cDNA (3107 bp) encoded a protein of 362 amino acid residues (40407 Da) (GenBank accession #AY157968 for rat Momo and #AY157969 for rat Sakura). The overall nucleotide homology between Momo and Sakura was 62% and their amino acid identity was 46%. The Pfam domain search program revealed that Momo and Sakura both contain two distinct zinc finger domains; consecutive two C2C2 zinc finger motifs (Klug and Schwabe 1995) and a RING finger motif (Freemont 2000). The duplicated C2C2 zinc finger motifs are located at the amino terminal region and the RING finger motif at the carboxyl terminal region. In addition, there is a putative site(s) for protein palmitoylation at most N-terminals of both Momo and Sakura. The double cysteine residues (Cys-Cys, Cys-X-Cys, or Cys-X-X-Cys) flanked by hydrophobic amino acids represent a potential palmitoylation signal (Mumby 1997). A GenBank search revealed that the Drosophila CG17019-PA gene has a 48% amino acid homology to Sakura over the entire coding region (Adams et al. 2000). Thus, Sakura is thought to be a mammalian orthologue for the Drosophila CG17019-PA gene, although a Drosophila mutant for the CG17019-PA gene has been not isolated. Their structural similarity to the RING finger proteins suggests that Momo and Sakura might function as an E3 Ub ligase.

Figure 1. Structure and tissue distributions of Momo and Sakura. (a) Deduced amino acid sequence is aligned for Momo and Sakura. Identical amino acids are boxed in gray. Gaps between conserved amino acids are indicated by dashes. Core residues of C2C2 zinc finger and RING finger are marked with closed circles. Asterisks indicate putative palmitoylation sites. (b) Northern blot hybridization was performed with the poly(A) + mRNAs extracted from six areas of the brain as well as seven tissues from peripheral organs. The membrane was hybridized with the random [32P]dCTP labeled 370-nt Dra I-Dra I Momo cDNA fragment or the 292-nt Stu I-Stu I Sakura cDNA fragment. (c) in situ hybridization was performed with sagittal sections (10-µm thick) of adult rat brain. Each section was probed with the sense or antisense oligoDNAs, which were end-labeled with [35S]dATP. Sense and antisense probes for Momo contained 48 base oligoDNA (nt. 103–150) in the ORF (upper panel). Sense and antisense probes for Sakura contained 49 base oligoDNA (nt. 546–594) in its ORF region (lower panel).

Download figure to PowerPoint

image

To study mRNA distribution of Momo and Sakura, we performed northern blotting among brain regions and peripheral tissues examined in rats, a signal for Momo mRNA was detected at the 2.6-kb position and weakly at 5-kb position in the brain and testis (Fig. 1b). In contrast, Sakura mRNA appeared as multiple sizes of 1.6, 3.8 and 7 kb on northern blots. As we employed stringent washing conditions for blotting, these bands presumably reflected mRNA species produced from a single gene through alternative splicing or differential poly A addition. Relatively higher signals for Sakura mRNA were detected in the brain, liver, kidney, lung, and spleen. Only in the testis, the major signal for Sakura mRNA appeared as a 1.6-kb band. In contrast to the uniform distribution of Momo mRNA in the brain, Sakura mRNA was most enriched in the midbrain, including the pituitary and in the brain stem regions. In situ hybridization analysis revealed a more precise distribution in the brain: a stronger signal for Momo mRNA was detected in the pituitary as well as in the molecular layer of the cerebellar cortex (Fig. 1c). In contrast, Sakura mRNA was detected in the corpus callosum, brain stem, spinal cord and cerebellar white matter.

Cellular distributions of Momo and Sakura proteins

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. cDNA library screening
  5. RNA analysis
  6. In situ hybridization
  7. Antibody production
  8. Subcellular fractionation and immunoblotting
  9. Expression vectors
  10. Ubiquitination analysis in cells
  11. In vitro ubiquitination assay
  12. Palmitoylation analysis
  13. Results
  14. Novel primary structures of Momo and Sakura and their mRNA expression
  15. Cellular distributions of Momo and Sakura proteins
  16. Ubiquitination induced by overexpression of Momo and Sakura in cortical culture
  17. In vitro ubiquitination of Momo and Sakura and their interaction with various E2 components
  18. Dependency of ubiquitination on C-terminal RING finger
  19. Membrane association via the N-terminal domain of Momo and Sakura
  20. Palmitoylation of Sakura
  21. Discussion
  22. Acknowledgements
  23. References

To confirm the distributions of Momo and Sakura in neurons or glial cells, protein lysates from cerebellar gray matter and white matter were prepared and subjected to western blotting (Fig. 2). When Momo and Sakura genes were overexpressed in cortical cultures containing neurons and glial cells, Momo immunoreactivity appeared as four bands around 38–45 kDa, and the Sakura immunoreactivity as two bands around 46 kDa and 40 kDa (Fig. 2a,b; left). Some bands exhibited higher or lower mobility in a gel in comparison with their calculated molecular sizes. The mobility shift might reflect their post-translational modifications including palmitoylation, myristylation, and proteolytic processing (Kahns et al. 2002). Momo immunoreactivity was most enriched in the gray matter fractions of the cerebral cortex and cerebellar cortex while Sakura immunoreactivity was recovered mainly in the white matter fractions. The sizes of the endogenous Momo and Sakura immunoreactivities matched those in positive controls. Momo and Sakura lack a transmembrane region and a typical signal peptide motif for membrane anchoring, but they both carry putative palmitoylation site(s) in the N-terminal region to interact with the membrane via a fatty acid moiety (Resh 1999). The membrane (P3) and cytoplasmic (S3) fractions were prepared from the cerebellum. Western blotting of each fraction revealed that the immunoreactivity for both Momo and Sakura was enriched in the membrane fraction. Almost none of the Sakura immunoreactivity was recovered in the cytosolic fraction.

Figure 2. Cellular distribution of Momo and Sakura detected by western blot using their autologous antibodies. Overexpressed Momo (a) or Sakura (b) protein by Sindbis vector was analyzed as a positive control (left panels). Sindbis vector alone was used for mock infection as a negative control. Open triangles indicate bands that specifically reacted with an anti-Momo antibody and closed triangles indicate immunoreactive bands for an anti-Sakura antibody. In the center panels, tissue distribution of endogenous Momo (a) and Sakura (b) proteins is shown. The cerebrum and cerebellum were isolated and separated into gray and white matters. In the right panels, subcellular localization of endogenous Momo (a) and Sakura (b) proteins in the cerebellum. Cytoplasmic fraction (S3) and microsomal fraction (P3) were indicated as cytosol and membrane, respectively.

Download figure to PowerPoint

image

Ubiquitination induced by overexpression of Momo and Sakura in cortical culture

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. cDNA library screening
  5. RNA analysis
  6. In situ hybridization
  7. Antibody production
  8. Subcellular fractionation and immunoblotting
  9. Expression vectors
  10. Ubiquitination analysis in cells
  11. In vitro ubiquitination assay
  12. Palmitoylation analysis
  13. Results
  14. Novel primary structures of Momo and Sakura and their mRNA expression
  15. Cellular distributions of Momo and Sakura proteins
  16. Ubiquitination induced by overexpression of Momo and Sakura in cortical culture
  17. In vitro ubiquitination of Momo and Sakura and their interaction with various E2 components
  18. Dependency of ubiquitination on C-terminal RING finger
  19. Membrane association via the N-terminal domain of Momo and Sakura
  20. Palmitoylation of Sakura
  21. Discussion
  22. Acknowledgements
  23. References

Using rat cortical cultures containing both neurons and glial cells, we assessed their biological activity as a Ub ligase. Myc-tagged Momo and/or FLAG-tagged Ub were overexpressed in cultured cortical cells using the Sindbis virus expression system (Kawamura et al. 2003) (Fig. 3a). Incorporation of FLAG-tagged Ub into total protein was monitored by western blotting using the anti-FLAG antibody (Fig. 3b). When cortical cultures were transfected with the viral vector carrying FLAG-tagged Ub alone, basal ligation of the tagged-Ub was only detected in the presence of a proteasome inhibitor, MG132, as observed by broad bands. There was no apparent influence of the Momo expression on total ubiquitination levels. We also examined Momo-dependent ubiquitination in the immune complex of an anti-myc antibody (Fig. 3c). The overexpression of myc-tagged Momo induced polyubiquitination of target protein(s) in the Momo-carrying immune complex. The ubiquitination was less pronounced in the absence of the proteasome inhibitor, MG132. Although cortical neurons endogenously expressed Momo, basal reaction of ubiqutination was almost undetectable because the strength of basal Momo expression was less than one hundredth of that by Sindbis virus-mediated overexpression (data not shown). Thus, these results suggest that Momo is involved in polyubiquitination.

Figure 3. Ubiquitination assay of Momo protein in cortical culture. (a) Structures of recombinant Sindbis virus RNA: the upper is a FLAG-Ub expression construct and the lower is a coexpression construct for myc-Momo and FLAG-Ub. The duplicated/triplicated subgenomic promoter (Psg), viral replication essential genes (nsp1–4), cap-dependent translation initiation site (CAP), and polyA tail (AAA) are indicated. Virus infectious units were determined by the expression of the enhanced green fluorescent protein (EGFP) and adjusted among cultures. (b) Overexpression of myc-Momo and/or FLAG-Ub proteins in cortical culture. Total cell lysates were subjected to western blotting using the anti-FLAG (M2) antibody (top) and anti-myc (9E10) antibody (bottom). (c) Ubiquitinated protein(s) in the immunocomplexes with myc-Momo. Immunoprecipitated protein complexes prepared by an anti-myc polyclonal antibody were subjected to immunoreaction with the anti-FLAG antibody for ubiquitination (top) and anti-myc antibody (9E10) for Momo (bottom). There was no apparent mobility shift of myc-Momo (data not shown). Open triangles indicate Momo immunoreactivity.

Download figure to PowerPoint

image

When myc-tagged Sakura was similarly expressed by a Sindbis virus expression vector together with FLAG-tagged Ub, a similar ubiquitination reaction in the absence of the MG132 was observed in total ubiquitination as well as in the immune complex of Sakura (Fig. 4). In contrast to the reaction with Momo, however, marked amounts of polyubiquitinated protein(s) induced by the Sakura expression were not influenced by the presence or absence of the inhibitor, MG132. The results suggest that the ubiquitination by Sakura is relatively stable and might not be recognized by the conventional MG132-sensitive 26S proteasome (Hershko and Ciechanover 1998).

Figure 4. Ubiquitination assay of Sakura protein in cortical culture. (a) Structures of recombinant Sindbis virus RNA for FLAG-Ub expression and for coexpression of myc-Sakura and FLAG-Ub are shown. The viral transcription and translation essential elements (Psg, nsp1–4, CAP, AAA signals) and a marker protein (EGFP) are shown in the RNA constructs as referred in the legend for Fig. 4. (b) Overexpression of myc-Sakura and/or FLAG-Ub proteins in cortical culture. Total cell lysates were subjected to western blotting using the anti-FLAG (M2) antibody (top) and anti-myc (9E10) antibody (bottom). (c) Ubiquitinated protein(s) in the immunocomplexes with myc-Sakura. The protein complex immunoprecipitated with anti-myc polyclonal antibody were subjected to immunoblotting with anti-FLAG antibody for ubiquitination (top) and anti-myc antibody (9E10) for Sakura (bottom). Closed triangles indicate Sakura immunoreactivity.

Download figure to PowerPoint

image

In vitro ubiquitination of Momo and Sakura and their interaction with various E2 components

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. cDNA library screening
  5. RNA analysis
  6. In situ hybridization
  7. Antibody production
  8. Subcellular fractionation and immunoblotting
  9. Expression vectors
  10. Ubiquitination analysis in cells
  11. In vitro ubiquitination assay
  12. Palmitoylation analysis
  13. Results
  14. Novel primary structures of Momo and Sakura and their mRNA expression
  15. Cellular distributions of Momo and Sakura proteins
  16. Ubiquitination induced by overexpression of Momo and Sakura in cortical culture
  17. In vitro ubiquitination of Momo and Sakura and their interaction with various E2 components
  18. Dependency of ubiquitination on C-terminal RING finger
  19. Membrane association via the N-terminal domain of Momo and Sakura
  20. Palmitoylation of Sakura
  21. Discussion
  22. Acknowledgements
  23. References

We attempted to reconstitute the ubiquitination in vitro with a purified recombinant Ub activating enzyme (E1) and various Ub conjugating enzymes (E2; Ubc) as well as Momo or Sakura as a Ub ligase (E3). Each UbcH3, H4, H5c, H6, and H8 was tested as an E2 enzyme and ubiquitination reaction was monitored in vitro in the presence of 125I-labeled Ub. The combination of immunoprecipitated myc-tagged Momo with UbcH4 and H5c, but not with UbcH3, H6, nor H8, triggered ubiquitination (Fig. 5a). The immune complex of myc-tagged Momo alone failed to induce ubiquitination (data not shown). Western blotting for the anti-myc antibody suggested that the polyubiquitination might include self-ubiquitination of Momo as the amounts of authentic Momo were reduced and its size shifted to higher molecular ranges, although the shift was not apparent in the ubiquitination assay using cultured neural cells (see Fig. 3c). In contrast, myc-tagged Sakura recruited UbcH4, H5c and H6 to induce polyubiquitination (Fig. 5c). In contrast to the potential self-ubiquitination of Momo, the Sakura-induced self-ubiquitination was not apparent in the western blots with the anti-myc antibody. In the absence of Momo or Sakura, however, there was no endogenous ubiquitination (Fig. 5b).

Figure 5. Detection of an E3 ligase activity of Momo and Sakura by in vitro ubquitination assay. Cultured cortical cells were infected with Sin + myc-Momo/EG (a), SinEGdsp as control (b) or Sin + myc-Sakura/EG (c) (see Materials and methods). Cells were treated with MG132 for 6 h before harvesting. The protein samples immunoprecipitated with a myc-antibody (IP-myc) are indicated by myc-Momo (M), an endogenous protein control (–), and myc-Sakura (S). In the upper panels, polyubiquitinated signals were detected at high molecular regions by autoradiography. In parallel, one-third of the sample of all experiments was applied for immunoblotting with an anti-myc (9E10) antibody to detect myc-Momo or myc-Sakura in the immunoprecipitates (lower panels). The original positions (kDa) of Momo and Sakura are indicated by open and closed triangles, respectively. E1; recombinant Ub activating enzyme, E2; recombinant Ub conjugating enzymes of UbcH3 (3), UbcH4 (4), UbcH5 (5c), UbcH6 (6) and UbcH8 (8). (d) Ubiquitination reaction was reconstituted in vitro with the bacterial recombinant Momo (M) and Sakura (S). They were produced in E. coli as a fusion protein of maltose binding protein and purified. In vitro ubiquitination assay was carried out for 3 h in the presence of the recombinant mouse E1 and UbcH4, and followed by immunoblotting using the anti-maltose binding protein antibody. The zero time point is used as a control.

Download figure to PowerPoint

image

To avoid the possibility that the immune complexes carried not only Momo or Sakura but also other E3 enzyme(s) and thus caused the in vitro ubiqutination, we attempted to reconstitute the reaction using purified recombinant Momo or Sakura (Fig. 5d). Momo and Sakura proteins were produced in E. coli as a fusion protein of maltose binding protein. Incubation of the recombinant Momo and Sakura with the purified E1 enzyme and UbcH4 similarly caused their self-ubiquitination as monitored by immunoblotting using the anti-maltose binding protein antibody. However, we cannot rule out the possibility that the self-ubiquitination might result from their overexpression or the lack of proper substrates, as we failed to detect the self-ubiquitination in the brain or neural cells.

Dependency of ubiquitination on C-terminal RING finger

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. cDNA library screening
  5. RNA analysis
  6. In situ hybridization
  7. Antibody production
  8. Subcellular fractionation and immunoblotting
  9. Expression vectors
  10. Ubiquitination analysis in cells
  11. In vitro ubiquitination assay
  12. Palmitoylation analysis
  13. Results
  14. Novel primary structures of Momo and Sakura and their mRNA expression
  15. Cellular distributions of Momo and Sakura proteins
  16. Ubiquitination induced by overexpression of Momo and Sakura in cortical culture
  17. In vitro ubiquitination of Momo and Sakura and their interaction with various E2 components
  18. Dependency of ubiquitination on C-terminal RING finger
  19. Membrane association via the N-terminal domain of Momo and Sakura
  20. Palmitoylation of Sakura
  21. Discussion
  22. Acknowledgements
  23. References

The structural dependency of Momo- and Sakura-mediated ubiquitination was examined in a human embryonic kidney cell line, HEK293. We produced deletion mutants of myc-tagged Momo and Sakura, omitting their N-terminal portion containing the palmitoylation sites/double zinc finger domain (ΔN) or their C-terminal region containing the RING finger domain (ΔC) (Fig. 6a). The transfection of cDNA for wild-type Momo and Sakura as well as that for mutants resulted in a significant level of protein expression in HEK293 cells, although the N-terminal deletion appeared to reduce their stability (Fig. 6b). The transfection of wild-type Momo cDNA together with the FLAG-tagged Ub increased Ub immunoreactivity as revealed with the anti-FLAG antibody (Fig. 6c). The deletions in the N-terminal as well as in the C-terminal of Momo significantly diminished the Ub immunoreactivity in the ubiquitination reaction in culture. In contrast, while the C-terminal deletion mutant of Sakura almost completely abolished the ubiquitination reaction, its N-terminal deletion only influenced the sensitivity of the Sakura-induced ubiquitination to the proteasome inhibitor, MG132, but not the ubiquitination itself (Fig. 6d). These results confirm that the RING finger domain of Momo and Sakura has a primary role in ubiquitination.

Figure 6. Mutation analysis of Momo and Sakura proteins in an in vivo ubiquitination assay. (a) Constructs of N-terminal and C-terminal deletion mutants of Momo and Sakura proteins. (b) In HEK293 cells, protein expression of these deletion mutants was confirmed by immunoblotting using an anti-myc (9E10) antibody. (c) Ubiquitinated protein(s) in the immunocomplexes with wild Momo and its deletion mutants. The cells coexpressed FLAG-Ub with wild myc-Momo (WT), N-terminal deletion mutant (ΔN) or C-terminal deletion mutant (ΔC) were treated with or without 10 µm of MG132 for 6 h before harvesting. For experimental control, the pCi + myc vector was mock transfected. Immunoprecipitates with an anti-myc polyclonal antibody were subjected to western blotting with a biotinylated anti-FLAG (M2) antibody (top) and with an anti-myc (9E10) antibody (bottom). (d) Ubiquitination in the immunocomplexes of myc-Sakura and its deletion mutants was monitored similarly.

Download figure to PowerPoint

image

Membrane association via the N-terminal domain of Momo and Sakura

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. cDNA library screening
  5. RNA analysis
  6. In situ hybridization
  7. Antibody production
  8. Subcellular fractionation and immunoblotting
  9. Expression vectors
  10. Ubiquitination analysis in cells
  11. In vitro ubiquitination assay
  12. Palmitoylation analysis
  13. Results
  14. Novel primary structures of Momo and Sakura and their mRNA expression
  15. Cellular distributions of Momo and Sakura proteins
  16. Ubiquitination induced by overexpression of Momo and Sakura in cortical culture
  17. In vitro ubiquitination of Momo and Sakura and their interaction with various E2 components
  18. Dependency of ubiquitination on C-terminal RING finger
  19. Membrane association via the N-terminal domain of Momo and Sakura
  20. Palmitoylation of Sakura
  21. Discussion
  22. Acknowledgements
  23. References

Using the above deletion constructs, we also monitored subcellular localization of the Momo and Sakura mutant proteins. Wild-type Momo and Sakura as well as the mutant proteins were overexpressed in HEK293 cells, and subsequently the cells were fractionated into crude membrane and cytoplasmic fraction (Fig. 7a). Subcellular fractionation was confirmed by immunoblotting for a Golgi-associated protein, GM130, and a cytoplasmic enzyme, catalase. The cytoplasmic fraction contained larger amounts of catalase while the membrane fraction carried predominantly higher levels of GM130 in all preparations. Synthesized wild-type myc-tagged Momo and Sakura had similar molecular sizes to those in neural culture (see Fig. 2a,b) and were recovered in both the membrane and cytoplasmic fractions under the fractionation condition. In contrast, when cells expressing the Momo and Sakura mutants lacking the N-terminal domain were subjected to the fractionation, these mutant proteins were recovered predominantly in the cytoplasmic fraction. The C-terminal deletion mutants of Momo and Sakura exhibited the same subcellular distributions as their wild types (data not shown). These data indicate that the N-terminal domain of Momo and Sakura was responsible for their membrane association. The cytoplasmic recovery of endogenous Momo and Sakura was quite low in the tissue preparation, however (see Fig. 2). The higher cytoplasmic recovery in HEK293 cells might result from their overexpression in the heterologous non-neural cells.

Figure 7. Subcellular localization of Momo and Sakura proteins in HEK293 cells. The cells were transfected with wild myc-Momo (WT), myc-ΔN-Momo (the N-terminal deletion mutant), wild myc-Sakura (WT) and myc-ΔN-Sakura (the N-terminal deletion mutant). After 42-h post-transfection, cellular proteins were extracted and followed by subcellular fractionation into microsomal fraction (P3) and cytoplasmic fraction (S3). Open triangles mark myc-Momo immunoreactivity and closed triangles indicate myc-Sakura immunoreactivity. Subcellular fractionation was confirmed by their immunoreaction with the anti-GM130 (for membrane fraction) and anti-catalase (for cytoplasmic fraction) antibodies (middle and bottom panels).

Download figure to PowerPoint

image

Palmitoylation of Sakura

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. cDNA library screening
  5. RNA analysis
  6. In situ hybridization
  7. Antibody production
  8. Subcellular fractionation and immunoblotting
  9. Expression vectors
  10. Ubiquitination analysis in cells
  11. In vitro ubiquitination assay
  12. Palmitoylation analysis
  13. Results
  14. Novel primary structures of Momo and Sakura and their mRNA expression
  15. Cellular distributions of Momo and Sakura proteins
  16. Ubiquitination induced by overexpression of Momo and Sakura in cortical culture
  17. In vitro ubiquitination of Momo and Sakura and their interaction with various E2 components
  18. Dependency of ubiquitination on C-terminal RING finger
  19. Membrane association via the N-terminal domain of Momo and Sakura
  20. Palmitoylation of Sakura
  21. Discussion
  22. Acknowledgements
  23. References

Both Momo and Sakura carry the putative signal sites for palmitoylation. To confirm their palmitoylation, we transfected the eukaryotic expression vectors carrying myc-tagged Momo and Sakura cDNAs into HEK293 cells and then allowed cells to incorporate [3H]palmitic acid. HEK293 cells were subjected to the above subcellular fractionation and the crude membrane fraction was solubilized with a mild detergent of Triton X-100 (1%). Myc-tagged Sakura in the cytoplasmic and membrane fractions was immunoprecipitated with the anti-myc antibody, and the immunoprecipitates were subjected to SDS–PAGE followed by autoradiography or immunoblotting for the anti-myc antibody. [3H]palmitic acid incorporation into the protein fraction was confirmed in the presence of an inhibitor for endogenous fatty acid synthesis (Fig. 8a). Film autoradiography revealed a protein band in the membrane fraction that was linked to [3H]palmitic acid and matched the size of Sakura (Fig. 8b). Although immunoblotting confirmed the presence of myc-tagged Sakura both in the membrane and cytoplasmic fractions, only membrane-bound Sakura appeared to be palmitoylated (Fig. 8c). In contrast, we failed to obtain any significant palmitoylation signal for myc-tagged Momo (data not shown). As the expression of Momo was quite restricted in neurons, palmitoylation of Momo might not be completed in the non-neuronal cells. Alternatively, the myc tagging might cause steric hindrance against palmitoylation of Momo. The palmitoylation of Momo remains to be examined with a different approach.

Figure 8. Palmitoylation of Sakura protein in HEK293 cells. (a) Incorporation of [3H]palmitate was detected by autoradiography of total protein extracts. Untransfected cells were used as a negative control for metabolic labeling. (b) Proteins in the crude membrane (P) fraction and cytoplasmic component (S) were immunoprecipitated with an anti-myc polyclonal antibody. The radioactivity of [3H]palmitate in the immunoprecipitates appeared by a film autoradiography and is marked with a closed triangle. (c) An authentic position of immunoreactive myc-Sakura on an immunoblot is indicated by a closed triangle.

Download figure to PowerPoint

image

Discussion

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. cDNA library screening
  5. RNA analysis
  6. In situ hybridization
  7. Antibody production
  8. Subcellular fractionation and immunoblotting
  9. Expression vectors
  10. Ubiquitination analysis in cells
  11. In vitro ubiquitination assay
  12. Palmitoylation analysis
  13. Results
  14. Novel primary structures of Momo and Sakura and their mRNA expression
  15. Cellular distributions of Momo and Sakura proteins
  16. Ubiquitination induced by overexpression of Momo and Sakura in cortical culture
  17. In vitro ubiquitination of Momo and Sakura and their interaction with various E2 components
  18. Dependency of ubiquitination on C-terminal RING finger
  19. Membrane association via the N-terminal domain of Momo and Sakura
  20. Palmitoylation of Sakura
  21. Discussion
  22. Acknowledgements
  23. References

We characterized novel membrane-associating E3 Ub ligases with a RING finger domain, Momo and Sakura. Both E3 Ub ligases are structurally homologous to each other but had distinct distributions in the brain as well as in HEK293 cells. Momo mRNA and protein expression was pronounced in the cerebellar gray matter and Sakura mRNA and protein expression was more limited to the cerebellar white matter and lower brain stem. The mRNA and protein distribution patterns suggest that neurons and oligodendrocytes are likely to express Momo and Sakura, respectively. Although molecular targets of these Ub ligases remain to be identified, these enzymes appear to have a primal role in the nervous system. Structural analysis revealed several unique functional domains; putative palmitoylation sites, double zinc finger structure and RING finger domain. Consistent with possession of the RING finger domain, Momo and Sakura exhibited Ub ligase activity in vitro. In particular, self-ubiquitination of Momo and Sakura was detected in vitro assay as reported in other E3 ligases (Fang et al. 2000; Yang et al. 2000).

The RING finger sequence of Momo exhibited a 42% amino acid identity and 64% similarity to that of IAP (inhibitor of apoptosis) (Strausberg 2002), and that of Sakura 51% identity and 70% similarity to that of IAP. Both Momo and Sakura, however, lack the BIR domain of IAP, which interacts with caspases (Deveraux et al. 1997; Roy et al. 1997). A human orthologue of Momo was recently isolated and termed as hRFI (human RING Finger homologue to IAP type) and its anti-apoptotic activity was examined based on its structural similarity to IAP (Sasaki et al. 2002). In contrast, we failed to detect an influence of Momo or Sakura overexpression on the cell survival of neurons (data not shown). Momo and Sakura also carry C2C2 zinc finger motifs at their N-terminal portion, which contain common cysteine repeats among B-box, RING finger, and other zinc fingers. According to the amino acid alignment therefore the zinc finger region of Momo shares a 32% identity and that of Sakura shares a 30% identity to the cysteine finger, so-called FYVE, of human EEA1 (Mu et al. 1995). Both zinc finger regions of Momo and Sakura, however, lack essential RRHH amino acid residues in the core of the FYVE domain (Stenmark and Aasland 1999). Accordingly, we classified this domain as a conventional C2C2 zinc finger structure. Mutation analysis revealed that the N-terminal domain of Momo and Sakura influenced the ubiquitination reaction. In addition, the lack of a C-terminal RING finger in Momo did not fully inhibit the reaction. In this context, we cannot rule out the possibility that the N-terminal zinc finger structure functions as an E3 Ub ligase. Alternatively, this zinc finger domain might be involved in protein–protein interactions to associate with other components (Kuroda et al. 1996; Rodgers et al. 1996; Lyngso et al. 2000).

Although the indirect interaction of E3 Ub ligases with cell membranes via substrates or other associating proteins is often reported (Kavsak et al. 2000; Shenoy et al. 2001; Soubeyran et al. 2002; Plant et al. 2000), information on the direct membrane anchor of E3 Ub ligases is quite limited. Among various RING finger-type E3 Ub ligases, Sakura is the first reported E3 molecule that is covalently linked to palmitic acid. The palmitoylation is likely to contribute to the membrane binding capability of Sakura. An interesting regulation of the ubiquitination reaction was reported on another type of E3 Ub ligase with respect to membrane association. The E3 Ub ligase, NEDD4, carries the HECT domain in place of the RING finger and exerts Ub ligase activity on amiloride-sensitive epithelial sodium channels (Staub et al. 1997). This HECT-type Ub ligase contains C2 domains that interact with phosphatidyl serine in a calcium-dependent manner (Plant et al. 1997). Thus, ubiquitination and subsequent proteasomal degradation of amiloride-sensitive sodium channels is regulated by the membrane translocation of NEDD4, which is induced by an elevated intracellular Ca2+ level (Staub et al. 2000). Although Sakura and Momo immunoreactivities were enriched in the membrane fraction of the brain preparations (Fig. 2), they were recovered in both cytoplasmic and membrane fractions when it was overexpressed in HEK293 cells. This observation suggests that the palmitoylation of Sakura, and potentially that of Momo, might be regulated to control their subcellular distributions and substrate recognition (Plant et al. 2000). The regulatory mechanism of the palmitoylation remains to be characterized, however.

In the nervous system, an impaired Ub-proteasome pathway is often implicated in neurodegenerative diseases in which there is accumulation of abnormal protein deposits in the nervous system (Paulson 1999; Saigoh et al. 1999; Bence et al. 2001; Chung et al. 2001a). Recent studies indicate that protein ubiquitination serves not only as a signal for proteasomal degradation but also as a routing code for intracellular molecular trafficking (Shih et al. 2000; Dupre et al. 2001; Hicke 2001; Katzmann et al. 2001; Polo et al. 2002). The degradation of Sakura ubiquitination products was not sensitive to an inhibitor of the conventional 26S proteasome, potentially suggesting the use of unconventional lysine sites for Ub ligation. Given the distributions and activities of these Ub ligases, future studies should elucidate their contribution to molecular trafficking as well as to protein degradation.

Acknowledgements

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. cDNA library screening
  5. RNA analysis
  6. In situ hybridization
  7. Antibody production
  8. Subcellular fractionation and immunoblotting
  9. Expression vectors
  10. Ubiquitination analysis in cells
  11. In vitro ubiquitination assay
  12. Palmitoylation analysis
  13. Results
  14. Novel primary structures of Momo and Sakura and their mRNA expression
  15. Cellular distributions of Momo and Sakura proteins
  16. Ubiquitination induced by overexpression of Momo and Sakura in cortical culture
  17. In vitro ubiquitination of Momo and Sakura and their interaction with various E2 components
  18. Dependency of ubiquitination on C-terminal RING finger
  19. Membrane association via the N-terminal domain of Momo and Sakura
  20. Palmitoylation of Sakura
  21. Discussion
  22. Acknowledgements
  23. References

We thank Ms. Yuriko Iwakura and Mr Tadasato Nagano for technical assistance and Ms. Hiromi Kato for typing. We also thank Dr Mako Narisawa-Saito for helpful discussion. The nucleotide sequences of human Momo and Sakura cDNAs were similarly determined and deposited in GenBank (GenBank accession #AAM29180 for human Momo and #AAM29181 for human Sakura). This work was supported by the Japanese Society for the Promotion of Science (RFTF-96L00203) and a Grant-in-Aid for Creative Scientific Research.

References

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. cDNA library screening
  5. RNA analysis
  6. In situ hybridization
  7. Antibody production
  8. Subcellular fractionation and immunoblotting
  9. Expression vectors
  10. Ubiquitination analysis in cells
  11. In vitro ubiquitination assay
  12. Palmitoylation analysis
  13. Results
  14. Novel primary structures of Momo and Sakura and their mRNA expression
  15. Cellular distributions of Momo and Sakura proteins
  16. Ubiquitination induced by overexpression of Momo and Sakura in cortical culture
  17. In vitro ubiquitination of Momo and Sakura and their interaction with various E2 components
  18. Dependency of ubiquitination on C-terminal RING finger
  19. Membrane association via the N-terminal domain of Momo and Sakura
  20. Palmitoylation of Sakura
  21. Discussion
  22. Acknowledgements
  23. References
  • Adams M. D., Celniker S. E. and Holt R. A. et al. (2002) The genome sequence of Drosophila melanogaster. Science 0, 21852195.
  • Alves-Rodrigues A., Gregori L. and Figueiredo-Pereira M. E. (1998) Ubiquitin, cellular inclusions and their role in neurodegeneration. Trends Neurosci. 21, 516520.
  • Bence N. F., Sampat R. M. and Kopito R. R. (2001) Impairment of the ubiquitin-proteasome system by protein aggregation. Science 292, 15521555.
  • Chen C. A. and Okayama H. (1988) Calcium phosphate-mediated gene transfer: a highly efficient transfection system for stably transforming cells with plasmid DNA. Biotechniques 6, 632638.
  • Chomczynski P. and Sacchi N. (1987) Single-step method of RNA isolation by acid guanidinium thiocyanate–phenol–chloroform extraction. Anal. Biochem. 162, 156159.
  • Chung K. K., Dawson V. L. and Dawson T. M. (2001a) The role of the ubiquitin-proteasomal pathway in Parkinson's disease and other neurodegenerative disorders. Trends Neurosci. 24, S7S14.
  • Chung K. K., Zhang Y., Lim K. L., Tanaka Y., Huang H., Gao J., Ross C. A., Dawson V. L. and Dawson T. M. (2001b) Parkin ubiquitinates the alpha-synuclein-interacting protein, synphilin-1: implications for Lewy-body formation in Parkinson disease. Nat. Med. 7, 11441150.
  • Cummings C. J., Reinstein E., Sun Y., Antalffy B., Jiang Y., Ciechanover A., Orr H. T., Beaudet A. L. and Zoghbi H. Y. (1999) Mutation of the E6-AP ubiquitin ligase reduces nuclear inclusion frequency while accelerating polyglutamine-induced pathology in SCA1 mice. Neuron 24, 879892.
  • Deveraux Q. L., Takahashi R., Salvesen G. S. and Reed J. C. (1997) X-linked IAP is a direct inhibitor of cell-death proteases. Nature 388, 300304.
  • DiFiglia M., Sapp E., Chase K. O., Davies S. W., Bates G. P., Vonsattel J. P. and Aronin N. (1997) Aggregation of huntingtin in neuronal intranuclear inclusions and dystrophic neurites in brain. Science 277, 19901993.
  • Dupre S., Volland C. and Haguenauer-Tsapis R. (2001) Membrane transport: ubiquitylation in endosomal sorting. Curr. Biol. 11, R932R934.
  • Fang S., Jensen J. P., Ludwig R. L., Vousden K. H. and Weissman A. M. (2000) Mdm2 is a RING finger-dependent ubiquitin protein ligase for itself and p53. J. Biol. Chem. 275, 89458951.
  • Freemont P. S. (2000) RING for destruction? Curr. Biol. 10, R84R87.
  • Hardy J. and Gwinn-Hardy K. (1998) Genetic classification of primary neurodegenerative disease. Science 282, 10751079.
  • Hershko A. and Ciechanover A. (1998) The ubiquitin system. Annu. Rev. Biochem. 67, 425479.
  • Hicke L. (2001) A new ticket for entry into budding vesicles-ubiquitin. Cell 106, 527530.
  • Hirano A., Araki K. and Nawa H. (2001) Genbank accession # AF277900.
  • Honda R. and Yasuda H. (2000) Activity of MDM2, a ubiquitin ligase, toward p53 or itself is dependent on the RING finger domain of the ligase. Oncogene 19, 14731476.
  • Hu G. and Fearon E. R. (1999) Siah-1 N-terminal RING domain is required for proteolysis function, and C-terminal sequences regulate oligomerization and binding to target proteins. Mol. Cell. Biol. 19, 724732.
  • Imai N., Matsuda N., Tanaka K., Nakano A., Matsumoto S. and Kang W. K. (2003) The ubiquitin ligase activities of Bombyx mori nucleopolyhedrovirus RING finger proteins. J. Virol. 77, 923930.
  • Ishikawa K., Nash S. R., Nishimune A., Neki A., Kaneko S. and Nakanishi S. (1999) Competitive interaction of seven in absentia homolog-1A and Ca2+/calmodulin with the cytoplasmic tail of group 1 metabotropic glutamate receptors. Genes Cells. 4, 381390.
  • Joazeiro C. A., Wing S. S., Huang H., Leverson J. D., Hunter T. and Liu Y. C. (1999) The tyrosine kinase negative regulator c-Cbl as a RING-type, E2-dependent ubiquitin-protein ligase. Science 286, 309312.
  • Kahns S., Lykkebo S., Jakobsen L. D., Neilsen M. S. and Jensen P. H. (2002) Caspase-mediated Parkin cleavage in apoptotic cell death. J. Biol. Chem. 227, 1530315308.
  • Kamura T., Koepp D. M., Conrad M. N., Skowyra D., Moreland R. J., Iliopoulos O., Lane W. S., Kaelin W. G. Jr, Elledge S. J., Conaway R. C., Harper J. W. and Conaway J. W. (1999) Rbx1, a component of the VHL tumor suppressor complex and SCF ubiquitin ligase. Science 284, 657661.
  • Kawamura M., Namba H., Otsu Y., Hayashi Y., Takei N. and Nawa H. (2003) Characterization of novel bicistronic Sindbis virus vectors, SinEGdsp and SinlRES-EG, in cultured neurons. Recent Research Developments in Neurochemistry. Research Signpost Publisher, India (in press).
  • Katagiri T., Feng X., Ichikawa T., Usui H., Takahashi Y. and Kumanishi T. (1993) Neuron-specific enolase (NSE) and non-neuronal enolase (NNE) mRNAs are co-expressed in neurons of the rat cerebellum: in situ hybridization histochemistry. Brain Res. Mol. Brain Res. 19, 18.
  • Katzmann D. J., Babst M. and Emr S. D. (2001) Ubiquitin-dependent sorting into the multivesicular body pathway requires the function of a conserved endosomal protein sorting complex, ESCRT-I. Cell 106, 145155.
  • Kavsak P., Rasmussen R. K., Causing C. G., Bonni S., Zhu H., Thomsen G. H. and Wrana J. L. (2000) Smad7 binds to Smurf2 to form an E3 ubiquitin ligase that targets the TGF beta receptor for degradation. Mol. Cell 6, 13651375.
  • Kitada T., Asakawa S., Hattori N., Matsumine H., Yamamura Y., Minoshima S., Yokochi M., Mizuno Y. and Shimizu N. (1998) Mutations in the parkin gene cause autosomal recessive juvenile parkinsonism. Nature 392, 605608.
  • Klug A. and Schwabe J. W. (1995) Protein motifs 5: zinc fingers. FASEB J. 9, 597604.
  • Kuroda S., Tokunaga C., Kiyohara Y., Higuchi O., Konishi H., Mizuno K., Gill G. N. and Kikkawa U. (1996) Protein–protein interaction of zinc finger LIM domains with protein kinase C. J. Biol. Chem. 271, 3102931032.
  • Lorick K. L., Jensen J. P., Fang S., Ong A. M., Hatakeyama S. and Weissman A. M. (1999) RING fingers mediate ubiquitin-conjugating enzyme (E2)-dependent ubiquitination. Proc. Natl Acad. Sci. USA 96, 1136411369.
  • Lovering R., Hanson I. M., Borden K. L., Martin S., O'Reilly N. J., Evan G. I., Rahman D., Pappin D. J., Trowsdale J. and Freemont P. S. (1993) Identification and preliminary characterization of a protein motif related to the zinc finger. Proc. Natl Acad. Sci. USA 90, 21122116.
  • Lyngso C., Bouteiller G., Damgaard C. K., Ryom D., Sanchez-Munoz S., Norby P. L., Bonven B. J. and Jorgensen P. (2000) Interaction between the transcription factor SPBP and the positive cofactor RNF4: an interplay between protein binding zinc fingers. J. Biol. Chem. 275, 2614426149.
  • Matsuda N., Suzuki T., Tanaka K. and Nakano A. (2001) Rma1, a novel type of RING finger protein conserved from Arabidopsis to human, is a membrane-bound ubiquitin ligase. J. Cell Sci. 114, 19491957.
  • Mu F. T., Callaghan J. M., Steele-Mortimer O., Stenmark H., Parton R. G., Campbell P. L., McCluskey J., Yeo J. P., Tock E. P. and Toh B. H. (1995) EEA1, an early endosome-associated protein. EEA1 is a conserved alpha-helical peripheral membrane protein flanked by cysteine ‘fingers’ and contains a calmodulin-binding IQ motif. J. Biol. Chem. 270, 1350313511.
  • Mumby S. M. (1997) Reversible palmitoylation of signaling proteins. Curr. Opin. Cell. Biol. 9, 148154.
  • Murata S., Minami Y., Minami M., Chiba T. and Tanaka K. (2001) CHIP is a chaperone-dependent E3 ligase that ubiquitylates unfolded protein. EMBO Rep. 2, 11331138.
  • Narisawa-Saito M., Carnahan J., Araki K., Yamaguchi T. and Nawa H. (1999) Brain-derived neurotrophic factor regulates the expression of AMPA receptor proteins in neocortical neurons. Neuroscience 88, 10091014.
  • Paulson H. L. (1999) Protein fate in neurodegenerative proteinopathies: polyglutamine diseases join the (mis)fold. Am. J. Hum. Genet. 64, 339345.
  • Plant P. J., Yeger H., Staub O., Howard P. and Rotin D. (1997) The C2 domain of the ubiquitin protein ligase Nedd4 mediates Ca2+-dependent plasma membrane localization. J. Biol. Chem. 272, 3232932336.
  • Plant P. J., Lafont F., Lecat S., Verkade P., Simons K. and Rotin D. (2000) Apical membrane targeting of Nedd4 is mediated by an association of its C2 domain with annexin XIIIb. J. Cell Biol. 149, 14731484.
  • Polo S., Sigismund S., Faretta M., Guidi M., Capua M. R., Bossi G., Chen H., De Camilli P. and Di Fiore P. P. (2002) A single motif responsible for ubiquitin recognition and monoubiquitination in endocytic proteins. Nature 416, 451455.
  • Resh M. D. (1999) Fatty acylation of proteins: new insights into membrane targeting of myristoylated and palmitoylated proteins. Biochim. Biophys. Acta 1451, 116.
  • Rodgers K. K., Bu Z., Fleming K. G., Schatz D. G., Engelman D. M. and Coleman J. E. (1996) A zinc-binding domain involved in the dimerization of RAG1. J. Mol. Biol. 260, 7084.
  • Roy N., Deveraux Q. L., Takahashi R., Salvesen G. S. and Reed J. C. (1997) The c-IAP-1 and c-IAP-2 proteins are direct inhibitors of specific caspases. EMBO J. 16, 69146925.
  • Ruffner H., Joazeiro C. A., Hemmati D., Hunter T. and Verma I. M. (2001) Cancer-predisposing mutations within the RING domain of BRCA1: loss of ubiquitin protein ligase activity and protection from radiation hypersensitivity. Proc. Natl Acad. Sci. USA 98, 51345139.
  • Saigoh K., Wang Y. L., Suh J. G., Yamanishi T., Sakai Y., Kiyosawa H., Harada T., Ichihara N., Wakana S., Kikuchi T. and Wada K. (1999) Intragenic deletion in the gene encoding ubiquitin carboxy-terminal hydrolase in gad mice. Nat. Genet. 23, 4751.
  • Sasaki S., Nakamura T., Arakawa H., Mori M., Watanabe T., Nagawa H. and Croce C. M. (2002) Isolation and characterization of a novel gene, hRFI, preferentially expressed in esophageal cancer. Oncogene 21, 50245030.
  • Shenoy S. K., McDonald P. H., Kohout T. A. and Lefkowitz R. J. (2001) Regulation of receptor fate by ubiquitination of activated beta 2-adrenergic receptor and beta-arrestin. Science 294, 13071313.
  • Shih S. C., Sloper-Mould K. E. and Hicke L. (2000) Monoubiquitin carries a novel internalization signal that is appended to activated receptors. EMBO J. 19, 187198.
  • Shimura H., Hattori N., Kubo S., Mizuno Y., Asakawa S., Minoshima S., Shimizu N., Iwai K., Chiba T., Tanaka K. and Suzuki T. (2000) Familial Parkinson disease gene product, parkin, is a ubiquitin-protein ligase. Nat. Genet. 25, 302305.
  • Skowyra D., Koepp D. M., Kamura T., Conrad M. N., Conaway R. C., Conaway J. W., Elledge S. J. and Harper J. W. (1999) Reconstitution of G1 cyclin ubiquitination with complexes containing SCFGrr1 and Rbx1. Science 284, 662665.
  • Soubeyran P., Kowanetz K., Szymkiewicz I., Langdon W. Y. and Dikic I. (2002) Cbl-CIN85-endophilin complex mediates ligand-induced downregulation of EGF receptors. Nature 416, 183187.
  • Staub O., Gautschi I., Ishikawa T., Breitschopf K., Ciechanover A., Schild L. and Rotin D. (1997) Regulation of stability and function of the epithelial Na+ channel (ENaC) by ubiquitination. EMBO J. 16, 63256336.
  • Staub O., Gautschi I., Ishikawa T., Breitschopf K., Staub O., Abriel. H., Plant P., Ishikawa T., Kanelis V., Saleki R., Horisberger J. D., Schild L. and Rotin D. (2000) Regulation of the epithelial Na+ channel by Nedd4 and ubiquitination. Kidney Int. 57, 809815.
  • Stenmark H. and Aasland R. (1999) FYVE-finger proteins – effectors of an inositol lipid. J. Cell Sci. 112, 41754183.
  • Strausberg R. (2002) Genbank accession # AAH32729.
  • Suzuki H., Chiba T., Kobayashi M., Takeuchi M., Suzuki T., Ichiyama A., Ikenoue T., Omata M., Furuichi K. and Tanaka K. (1999) IkappaB alpha ubiquitination is catalyzed by an SCF-like complex containing Skp1, cullin-1, and two F-box/WD40-repeat proteins, betaTrCP1 and betaTrCP2. Biochem. Biophys. Res. Commun. 256, 127132.
  • Topinka J. R. and Bredt D. S. (1998) N-Terminal palmitoylation of PSD− 95 regulates association with cell membranes and interaction with K+ channel Kv1.4. Neuron 20, 125134.
  • Tyers M. and Willems A. R. (1999) One ring to rule a superfamily of E3 ubiquitin ligases. Science 284, 603604.
  • Yang Y., Fang S., Jensen J. P., Weissman A. M. and Ashwell J. D. (2000) Ubiquitin protein ligase activity of IAPs and their degradation in proteasomes in response to apoptotic stimuli. Science 288, 874877.
  • Zachariae W. and Nasmyth K. (1999) Whose end is destruction: cell division and the anaphase-promoting complex. Genes Dev. 13, 20392058.