SEARCH

SEARCH BY CITATION

Keywords:

  • antioxidants;
  • hippocampus;
  • neurotoxicity;
  • peroxiredoxin-3;
  • reactive oxygen species

Abstract

  1. Top of page
  2. Abstract
  3. Experimental procedures
  4. Cloning of rat Prx-3 cDNA and construction of expression vector for Prx-3/GFP chimera
  5. Construction and preparation of recombinant adenoviral vectors
  6. In vivo adenoviral gene transfer and microinjection of ibotenic acid
  7. Real-time quantitative RT-PCR analysis
  8. Immunohistochemistry
  9. Histochemistry
  10. Peripheral type benzodiazepine binding sites (PTBBS) assay
  11. Western blot analysis
  12. Results
  13. Immunohistochemical analysis of Prx-3 in rat brain
  14. Microinjection of ibotenic acid reduces Prx-3 mRNA amount in the hippocampus
  15. In vivo gene transfer of Ad/β-gal and Ad/Prx-3
  16. Adenoviral Prx-3 gene transfer suppresses an increase in PTBBS evoked by microinjection of ibotenic acid
  17. Histochemical analysis confirms that Prx-3 protects against neuronal cell death
  18. Prx-3 prevents tyrosine nitration of hippocampal proteins in vivo
  19. Mitochondrial localization of Prx-3/GFP chimera in NIH-3T3 cell
  20. Discussion
  21. References

Mitochondria are involved in excitotoxic damage of nerve cells. Following the breakdown of the calcium-buffering ability of mitochondria, mitochondrial calcium overload induces reactive oxygen species (ROS) bursts that produce free radicals and open permeability transition pores, ultimately leading to neuronal cell death. In the present study, we focused on a mitochondrial antioxidant protein, peroxiredoxin-3 (Prx-3), to investigate the mechanism by which toxic properties of ROS were up-regulated in mitochondria of damaged nerve cells. Immunohistochemical analysis revealed that Prx-3 protein exists in mitochondria of rat hippocampus, whereas we found a significant decrease in Prx-3 mRNA and protein levels associated with an increase in nitrated proteins in the rat hippocampus injured by microinjection of ibotenic acid. Furthermore, in vivo adenoviral gene transfer of Prx-3 completely inhibited protein nitration and markedly reduced gliosis, a post-neuronal cell death event. Since mitochondrial Prx-3 seems to be neuroprotective against oxidative insults, our findings suggest that Prx-3 up-regulation might be a useful novel approach for the management of neurodegenerative diseases.

Abbreviations used
AD

Alzheimer's disease

ATP

adenosine triphosphate

DG

dentate gyrus

GFP

green fluorescent protein

HD

Huntington's disease

H2O2

hydrogen peroxide

NO

nitric oxide

ONOO

peroxynitrite

PBS

phosphate-buffered saline

PCR

polymerase chain reaction

PD

Parkinson's disease

PI

propidium iodide

Prx

peroxiredoxin

PTBBS

peripheral type benzodiazepine binding sites

ROS

reactive oxygen species

SCOT

succinyl-CoA:3-oxoacid CoA-transferase

SOD

superoxide dismutase

X-gal

5-bromo-4-chloro-3-indolyl-d-galactopyranoside

Mitochondria are known to be integrally involved in many cellular mechanisms, such as Ca2+ homeostasis (Rizzuto et al. 1994), programmed cell death (Kluck et al. 1997), ischemic delayed neuronal death (Abe et al. 1995) and excitotoxic neuronal death (Ankarcrona et al. 1995). In addition, several genetic or idiopathic abnormalities of mitochondrial functions are reported to occur both in normal aging and in many neurodegenerative diseases such as Parkinson's disease (PD), Alzheimer's disease (AD), Huntington's disease (HD) and Friedreich's ataxia (Graeber et al. 1998; Tabrizi and Schapira 1999).

Excitotoxicity is a common pathological mechanism involved in such neurodegenerative diseases, including PD, AD and HD (Scallet and Ye 1997). Several reports have indicated that excitotoxicity is closely related to mitochondrial calcium overload. Mitochondrial calcium overload leads to a compensatory activation of respiration (Territo et al. 2000) which, in turn, increases the excessive generation of reactive oxygen species (ROS). Long-term generation of ROS irreversibly injures the mitochondrial electron transport system (Tan et al. 1998), which induces further robust ROS generation (Luetjens et al. 2000) and activates the processes of apoptosis or severe depletion of adenine triphosphate (ATP) resulting in necrosis (Almeida and Bolanos 2001). Excitotoxicity, mitochondrial injury and ROS burst have been widely accepted as the pathophysiological mechanisms in various neural diseases (Nicholls and Budd 1998). Thus, the protection of physiological mitochondrial functions in pathological conditions or aging may be particularly important for inhibition of progressive dementia and maintenance of higher functions of the neural network.

We became interested in the functions of peroxiredoxin-3 (Prx-3), originally isolated by Yamamoto et al. in 1989 and designated MER5 (Yamamoto et al. 1989), also known as antioxidant protein-1 (AOP-1, Mitsumoto et al. 2001), because Prx-3 is a mitochondrial antioxidant protein and a member of the peroxiredoxin family that can scavenge not only hydrogen peroxide (H2O2) in co-operation with thiol, but also peroxynitrite (ONOO) by itself (Bryk et al. 2000). In mammals, six distinct Prx family members have been identified (Prx-1 through -6), and all members contain conserved reactive cysteine residue(s) in the active site(s) that are essential for the enzymatic oxidation–reduction reaction. Among Prx family members, Prx-3 is unique as it is specifically localized in the mitochondria, whereas Prx-1 and -2 exist in the cytosol (Kang et al. 1998) and Prx-5 exists both in mitochondria and in peroxisomes (Knoops et al. 1999). Overexpression of Prx-2 was shown to weaken the activation of nuclear factor-κB induced by H2O2 (Kang et al. 1998). Furthermore, a bacterial Prx, AhpC, was shown to protect both bacterial and mammalian cells from reactive nitric oxide intermediates (Chen et al. 1988). Although a broad range of antioxidant activities against ROS have been reported, there is no report describing the existence, regulation or protective function(s) of Prx-3 in hippocampus.

ONOO is produced by nitric oxide (NO) and superoxide anions, and irreversibly inhibits multiple mitochondrial respiratory complexes (Brown 1999). Mitochondrial nitric oxide synthase (mtNOS), recently identified as neuronal NOS (Kanai et al. 2001), is activated by the increase of matrix calcium concentration (Ghafourifar and Richter 1997). Thus, the excitotoxic mitochondrial calcium overload might cause activation of mtNOS and the subsequent augmentation of ONOO generation.

We hypothesized that one mechanism of excitotoxicity could be that local generation of ONOO in mitochondria causes mitochondrial damage which, in turn, leads to cellular damage. To investigate the function of Prx-3 as a mitochondrial ONOO scavenger in vivo, we constructed and prepared a recombinant adenovirus expressing Prx-3 cDNA. We report here that in vivo adenoviral gene transfer of Prx-3 completely inhibited protein nitration and markedly reduced gliosis in rats with ibotenic acid-induced hippocampal injury.

Cloning of rat Prx-3 cDNA and construction of expression vector for Prx-3/GFP chimera

  1. Top of page
  2. Abstract
  3. Experimental procedures
  4. Cloning of rat Prx-3 cDNA and construction of expression vector for Prx-3/GFP chimera
  5. Construction and preparation of recombinant adenoviral vectors
  6. In vivo adenoviral gene transfer and microinjection of ibotenic acid
  7. Real-time quantitative RT-PCR analysis
  8. Immunohistochemistry
  9. Histochemistry
  10. Peripheral type benzodiazepine binding sites (PTBBS) assay
  11. Western blot analysis
  12. Results
  13. Immunohistochemical analysis of Prx-3 in rat brain
  14. Microinjection of ibotenic acid reduces Prx-3 mRNA amount in the hippocampus
  15. In vivo gene transfer of Ad/β-gal and Ad/Prx-3
  16. Adenoviral Prx-3 gene transfer suppresses an increase in PTBBS evoked by microinjection of ibotenic acid
  17. Histochemical analysis confirms that Prx-3 protects against neuronal cell death
  18. Prx-3 prevents tyrosine nitration of hippocampal proteins in vivo
  19. Mitochondrial localization of Prx-3/GFP chimera in NIH-3T3 cell
  20. Discussion
  21. References

Total RNA was isolated from Sprague–Dawley rat hearts and the first cDNA strand was synthesized as described previously (Chomczynski and Sacchi 1987). The rat Prx-3 cDNA fragment including the entire open reading frame from nucleotide number 5 to 802 (accession number NM_022540) was amplified by polymerase chain reaction (PCR) using 5′-AACCGCGGTCGTGGCTCTTGCGTTCTCT-3′ (forward primer) and 5′-GCGCTAGCTTATTGATGGACCTTCTCAAAG-3′ (reverse primer) and cloned into pCRII (Invitrogen, San Diego, CA, USA). DNA sequence analysis using the ABI PRISM 310 genetic analyzer (Applied Biosystems, Foster City, CA, USA) revealed that there were two base changes in the PCR-amplified region in comparison with the sequence registered in the NCBI database (Matsumoto et al. 1999) (accession number NM_022540). These two base changes (CCA to ACA and CCC to GCC) accompanied two amino acid changes, from Pro-213 and Pro-232 to Thr-213 and Ala-232, respectively. These base changes were observed in three independent clones from independent PCR products in separate experiments. The reason for these changes is not clear at present but may be related to the difference in the strain of rats used for the experiment. It should be noted, however, that both Thr-213 and Ala-232 were conserved in human and mouse Prx-3 (NCBI accession numbers are XP_055573 and P20108, respectively). Thus, these two amino acid changes (Thr-213 and Ala-232) are not expected to markedly affect Prx-3 protein function. The expression vector for Prx-3 fused with green fluorescent protein (GFP) at the C-terminus (Prx-3/GFP) was constructed using pQBI25 (Takara-Shuzo, Tokyo, Japan).

Construction and preparation of recombinant adenoviral vectors

  1. Top of page
  2. Abstract
  3. Experimental procedures
  4. Cloning of rat Prx-3 cDNA and construction of expression vector for Prx-3/GFP chimera
  5. Construction and preparation of recombinant adenoviral vectors
  6. In vivo adenoviral gene transfer and microinjection of ibotenic acid
  7. Real-time quantitative RT-PCR analysis
  8. Immunohistochemistry
  9. Histochemistry
  10. Peripheral type benzodiazepine binding sites (PTBBS) assay
  11. Western blot analysis
  12. Results
  13. Immunohistochemical analysis of Prx-3 in rat brain
  14. Microinjection of ibotenic acid reduces Prx-3 mRNA amount in the hippocampus
  15. In vivo gene transfer of Ad/β-gal and Ad/Prx-3
  16. Adenoviral Prx-3 gene transfer suppresses an increase in PTBBS evoked by microinjection of ibotenic acid
  17. Histochemical analysis confirms that Prx-3 protects against neuronal cell death
  18. Prx-3 prevents tyrosine nitration of hippocampal proteins in vivo
  19. Mitochondrial localization of Prx-3/GFP chimera in NIH-3T3 cell
  20. Discussion
  21. References

A cytomegalovirus promoter-driven expression cassette containing Prx-3 cDNA in the sense orientation was constructed using pQBI25. A cosmid vector for β-galactosidase was purchased from Takara-Shuzo. The adenoviral vectors with deletions of both E1 and E3 were constructed according to the instructions provided by the manufacturer (Takara-Shuzo). Recombinant adenoviruses, Ad/Prx-3 and control Ad/β-gal, containing cytomegalovirus-driven Prx-3 and β-galactosidase expression unit, respectively, were prepared, amplified in 293 cells and purified by cesium chloride density gradient centrifugation. The titre was determined by plaque assay. Stock titres were approximately 1011 pfu/mL.

In vivo adenoviral gene transfer and microinjection of ibotenic acid

  1. Top of page
  2. Abstract
  3. Experimental procedures
  4. Cloning of rat Prx-3 cDNA and construction of expression vector for Prx-3/GFP chimera
  5. Construction and preparation of recombinant adenoviral vectors
  6. In vivo adenoviral gene transfer and microinjection of ibotenic acid
  7. Real-time quantitative RT-PCR analysis
  8. Immunohistochemistry
  9. Histochemistry
  10. Peripheral type benzodiazepine binding sites (PTBBS) assay
  11. Western blot analysis
  12. Results
  13. Immunohistochemical analysis of Prx-3 in rat brain
  14. Microinjection of ibotenic acid reduces Prx-3 mRNA amount in the hippocampus
  15. In vivo gene transfer of Ad/β-gal and Ad/Prx-3
  16. Adenoviral Prx-3 gene transfer suppresses an increase in PTBBS evoked by microinjection of ibotenic acid
  17. Histochemical analysis confirms that Prx-3 protects against neuronal cell death
  18. Prx-3 prevents tyrosine nitration of hippocampal proteins in vivo
  19. Mitochondrial localization of Prx-3/GFP chimera in NIH-3T3 cell
  20. Discussion
  21. References

The delivery of adenovirus to rat hippocampus was performed basically as described previously (Nishimura et al. 1998). Briefly, male Wistar rats (11–12 weeks old) were anesthetized with sodium pentobarbital and placed in a stereotaxic apparatus. We exposed the skull and made a 0.5 mm burr hole. Through the burr hole, a fine glass micropipette attached to a 25 µL Hamilton microsyringe was unilaterally introduced into the dorsal region of the left hippocampus according to the brain atlas of Paxinos and Watson (1986) (stereotactic co-ordinates: anterior, 4.5 mm caudal to bregma; lateral, 2.7 mm left lateral to midline; ventral, 3.0 mm ventral to dural surface at toothbar setting at approximately 1–2 mm below the interaural line). Ad/Prx-3 or Ad/β-gal (5 µL) suspended in 1 m mannitol solution dissolved in phosphate-buffered saline (PBS) was administered with a slow injection speed (0.25 µL/min). Rats that received a total of 8.5 × 106 pfu of Ad/Prx-3, Ad/β-gal or only 1 m mannitol solution did not exhibit apparent abnormal behaviors or seizures. Three days after virus infection, rats were re-operated on as described above, except that 1 µL of 0.6 µg ibotenic acid instead of adenovirus solution was injected (0.1 µL/min). All experimental procedures involving animals were approved by the animal experimentation ethics committee of our institution.

Real-time quantitative RT-PCR analysis

  1. Top of page
  2. Abstract
  3. Experimental procedures
  4. Cloning of rat Prx-3 cDNA and construction of expression vector for Prx-3/GFP chimera
  5. Construction and preparation of recombinant adenoviral vectors
  6. In vivo adenoviral gene transfer and microinjection of ibotenic acid
  7. Real-time quantitative RT-PCR analysis
  8. Immunohistochemistry
  9. Histochemistry
  10. Peripheral type benzodiazepine binding sites (PTBBS) assay
  11. Western blot analysis
  12. Results
  13. Immunohistochemical analysis of Prx-3 in rat brain
  14. Microinjection of ibotenic acid reduces Prx-3 mRNA amount in the hippocampus
  15. In vivo gene transfer of Ad/β-gal and Ad/Prx-3
  16. Adenoviral Prx-3 gene transfer suppresses an increase in PTBBS evoked by microinjection of ibotenic acid
  17. Histochemical analysis confirms that Prx-3 protects against neuronal cell death
  18. Prx-3 prevents tyrosine nitration of hippocampal proteins in vivo
  19. Mitochondrial localization of Prx-3/GFP chimera in NIH-3T3 cell
  20. Discussion
  21. References

For this study, microinjection of ibotenic acid was performed bilaterally and one lateral hippocampus was taken as an individual experiment, because microinjection of the same amount of dye did not spread towards the other side of the hippocampus and injury evoked by microinjection of ibotenic acid was confined to only one side of the hippocampus (data not shown). Hippocampuses were isolated 6 h after microinjection of ibotenic acid. Immediately after isolation, total RNA was extracted. DNase-treated (Ambion Inc., Austin, TX, USA) total RNA (1 µg) was reverse transcribed. Using an aliquot of the resulting cDNA, the respective cDNA fragments were amplified by real-time quantitative multiplex PCR with the primer sets and probe listed in Table 1. The primers and probes were designed using Primer ExpressTM version 1.0 (Applied Biosystems) and synthesized. We confirmed that the primers and probes used for the PCR amplifications did not match with other sequences using BLAST. The data were expressed as mean ± SEM. Statistical comparisons between two groups were examined using the unpaired Student's t-test. A p-value less than 0.05 denoted the presence of a statistically significant difference.

Table 1.  Primers and probes used for real-time quantitative RT-PCR analysis
Primers and probes  Sequence (5′-3′) (position)Amplified fragment length (sequence identification)
Prx-3 mRNA (NM_007452)Forward primerTGCAGTTTCAGTGGATTCCCA (440–460)81 bp (NM_022540)
Reverse primerTTCATGTGGCCCAAACCA (520–503) 
TaqMan probeFAM-TCTTGCCTGGATCAACACACCAAGAAAG (470–497) 
GAPDH mRNA (NM_017008)Forward primerTGCACCACCAACTGCTTAG (478–496)177 bp (NM_017008)
Reverse primerGGATGCAGGGATGATGTTC (654–636) 
TaqMan probeFAM- CAGAAGACTGTGGATGGCCCCTC (577–599) 
SOD-1 mRNA (NM_017050)Forward primerGCGGATGAAGAGAGGCATG (319–337)62 bp (NM_017050)
Reverse primerGCCACACCGTCCTTTCCA (380–363) 
TaqMan probeFAM-TGGAGACCTGGGCAATGTGGCTG (339–361) 
Catalase mRNA (NM_012520)Forward primerACGGGTGCTCAGCCTCC (1671–1687)62 bp (NM_012520)
Reverse primerAGGCTTGTGCCCTGCTTC (1732–1715) 
TaqMan probeFAM-CAGCCTGCACTGAGGAGATCCCTCA (1689–1713) 

Immunohistochemistry

  1. Top of page
  2. Abstract
  3. Experimental procedures
  4. Cloning of rat Prx-3 cDNA and construction of expression vector for Prx-3/GFP chimera
  5. Construction and preparation of recombinant adenoviral vectors
  6. In vivo adenoviral gene transfer and microinjection of ibotenic acid
  7. Real-time quantitative RT-PCR analysis
  8. Immunohistochemistry
  9. Histochemistry
  10. Peripheral type benzodiazepine binding sites (PTBBS) assay
  11. Western blot analysis
  12. Results
  13. Immunohistochemical analysis of Prx-3 in rat brain
  14. Microinjection of ibotenic acid reduces Prx-3 mRNA amount in the hippocampus
  15. In vivo gene transfer of Ad/β-gal and Ad/Prx-3
  16. Adenoviral Prx-3 gene transfer suppresses an increase in PTBBS evoked by microinjection of ibotenic acid
  17. Histochemical analysis confirms that Prx-3 protects against neuronal cell death
  18. Prx-3 prevents tyrosine nitration of hippocampal proteins in vivo
  19. Mitochondrial localization of Prx-3/GFP chimera in NIH-3T3 cell
  20. Discussion
  21. References

Rats were deeply anesthetized and perfused via the heart with 50 mL of saline and then with 50 mL of 4%para-formaldehyde in PBS. Brains were isolated and soaked in 10% sucrose (wt/vol) in PBS for 24 h. The brains were then cryosectioned to produce 7 µm sections. These sections were then washed three times with TBST buffer [50 mm Tris-HCl (pH 7.5), 150 mm NaCl, 0.1% Tween 20 (vol/vol)] and boiled for 1 min using a microwave oven. After blocking with bovine serum albumin, the sections were incubated with 1/1000 diluted mouse monoclonal anti-AOP antibody (Sigma Aldrich Co., St. Louis, MO, USA) and with 1/500 diluted rabbit polyclonal anti-superoxide dismutase (SOD)-2 (Mn-SOD) antibody (Stressgen Biotechnologies Corporation, Victoria, BC Canada) for double staining. After several washings, the sections were stained with 1/500 diluted Alexa Fluor 488 labeled goat anti-mouse IgG antibody (Molecular Probes, Eugene, OR, USA) and with Alexa Fluor 633 labeled goat anti-rabbit IgG antibody (Molecular Probes) for double staining. The nucleus was stained with propidium iodide (PI) when visualizing only Prx-3. Visualizations of all sections were carried out using confocal microscopy (LSM510META Carl Zeiss Co., Let, Jena, Germany), except for wide area visualizations which were done by conventional fluorescent microscopy.

Peripheral type benzodiazepine binding sites (PTBBS) assay

  1. Top of page
  2. Abstract
  3. Experimental procedures
  4. Cloning of rat Prx-3 cDNA and construction of expression vector for Prx-3/GFP chimera
  5. Construction and preparation of recombinant adenoviral vectors
  6. In vivo adenoviral gene transfer and microinjection of ibotenic acid
  7. Real-time quantitative RT-PCR analysis
  8. Immunohistochemistry
  9. Histochemistry
  10. Peripheral type benzodiazepine binding sites (PTBBS) assay
  11. Western blot analysis
  12. Results
  13. Immunohistochemical analysis of Prx-3 in rat brain
  14. Microinjection of ibotenic acid reduces Prx-3 mRNA amount in the hippocampus
  15. In vivo gene transfer of Ad/β-gal and Ad/Prx-3
  16. Adenoviral Prx-3 gene transfer suppresses an increase in PTBBS evoked by microinjection of ibotenic acid
  17. Histochemical analysis confirms that Prx-3 protects against neuronal cell death
  18. Prx-3 prevents tyrosine nitration of hippocampal proteins in vivo
  19. Mitochondrial localization of Prx-3/GFP chimera in NIH-3T3 cell
  20. Discussion
  21. References

Rats were deeply anesthetized 12 days after microinjection. The hippocampus was isolated and frozen until use. Frozen tissues were homogenized in a fourfold volume of homogenization buffer [10 mm Tris–HCl (pH 7.4), 0.32 m sucrose, 2 mm EDTA, 1 mm EGTA and 10 KIU/µL aprotinin] and centrifuged at 23 000 g at 4°C for 10 min. The protein concentration was determined using a BCA Protein Assay Reagent (Pierce Chemical Co., Rockford, IL, USA). For saturation binding assays, tissue solution was incubated at 25°C for 60 min in the dark with 8 nm[3H]PK11195 (specific radioactivity is 3163.5 GBq/mm; New England Nuclear, Boston, MA, USA) in a final volume of 200 µL. Non-specific binding was determined in the presence of 4 µm unlabeled PK11195. The incubation was terminated by rapid vacuum filtration (Whatman GF/B filter paper). Subsequently, the filters were washed twice with 3 mL chilled Tris–HCl buffer. Radioactivity remaining on the filter was measured using a scintillation counter (BETAPlate, Perkin Elmer Life Sciences Inc., Boston, MA, USA) and the ligand levels bound to cell membranes were calculated. The specific binding of the ligand was calculated by subtracting non-specific binding from total binding. The protein content in the crude cell membrane was determined using a BCA Protein Assay Reagent (Pierce) and a ligand level per gram of protein was calculated. For statistical analysis of the PTBBS assay, significant differences were determined by one-way analysis of variance (one-way anova) followed by post-hoc testing with the Tukey–Kramer test. Experimental data were presented as mean ± SEM. A p-value less than 0.05 denoted the presence of a statistically significant difference.

Western blot analysis

  1. Top of page
  2. Abstract
  3. Experimental procedures
  4. Cloning of rat Prx-3 cDNA and construction of expression vector for Prx-3/GFP chimera
  5. Construction and preparation of recombinant adenoviral vectors
  6. In vivo adenoviral gene transfer and microinjection of ibotenic acid
  7. Real-time quantitative RT-PCR analysis
  8. Immunohistochemistry
  9. Histochemistry
  10. Peripheral type benzodiazepine binding sites (PTBBS) assay
  11. Western blot analysis
  12. Results
  13. Immunohistochemical analysis of Prx-3 in rat brain
  14. Microinjection of ibotenic acid reduces Prx-3 mRNA amount in the hippocampus
  15. In vivo gene transfer of Ad/β-gal and Ad/Prx-3
  16. Adenoviral Prx-3 gene transfer suppresses an increase in PTBBS evoked by microinjection of ibotenic acid
  17. Histochemical analysis confirms that Prx-3 protects against neuronal cell death
  18. Prx-3 prevents tyrosine nitration of hippocampal proteins in vivo
  19. Mitochondrial localization of Prx-3/GFP chimera in NIH-3T3 cell
  20. Discussion
  21. References

Homogenized samples prepared as described above were subjected to 12.5% sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE). Nitrated proteins were visualized by western blotting using a mouse monoclonal anti-nitrotyrosine antibody (Upstate Biolab, Lake Placid, NY, USA) and peroxidase (POD) immunostain kit (Wako Pure Chemical Industries, Osaka, Japan) according to the protocol provided by the manufacturer. Prx-3 was also visualized using a mouse monoclonal anti-AOP antibody (Sigma Aldrich Co.) 1/3000 dilution as the first antibody. To confirm the amount of loaded proteins, total proteins were also visualized by Coomassie Brilliant Blue (CBB) staining.

Immunohistochemical analysis of Prx-3 in rat brain

  1. Top of page
  2. Abstract
  3. Experimental procedures
  4. Cloning of rat Prx-3 cDNA and construction of expression vector for Prx-3/GFP chimera
  5. Construction and preparation of recombinant adenoviral vectors
  6. In vivo adenoviral gene transfer and microinjection of ibotenic acid
  7. Real-time quantitative RT-PCR analysis
  8. Immunohistochemistry
  9. Histochemistry
  10. Peripheral type benzodiazepine binding sites (PTBBS) assay
  11. Western blot analysis
  12. Results
  13. Immunohistochemical analysis of Prx-3 in rat brain
  14. Microinjection of ibotenic acid reduces Prx-3 mRNA amount in the hippocampus
  15. In vivo gene transfer of Ad/β-gal and Ad/Prx-3
  16. Adenoviral Prx-3 gene transfer suppresses an increase in PTBBS evoked by microinjection of ibotenic acid
  17. Histochemical analysis confirms that Prx-3 protects against neuronal cell death
  18. Prx-3 prevents tyrosine nitration of hippocampal proteins in vivo
  19. Mitochondrial localization of Prx-3/GFP chimera in NIH-3T3 cell
  20. Discussion
  21. References

It is well known that mitochondria are involved in excitotoxic neural cell death. Although Prx-3 is known as a mitochondrial antioxidant protein, there is no report describing histochemically the existence of Prx-3 in brain. Therefore, we examined the expression of Prx-3 protein in rat brain by immunohistochemistry. The representative results are presented in Fig. 1. As shown in Figs 1a and 1b, Prx-3 immunoreactive signals were detected in hippocampus, including dentate gyrus (DG) and CA1 regions. Confocal microscopic analysis revealed that Prx-3 exists in the granules surrounding the PI-stained nucleus in hippocampal CA1 neural layer (Figs 1c and 1d). Granular immunoreactivity of Prx-3 was also observed in hippocampal DG (Fig. 1e), CA3 (Fig. 1f) and cortex (Fig. 1g). To investigate further whether granular immunoreactive signals exist in mitochondria, we performed double staining with anti-Prx-3 and anti-SOD-2 antibodies. Figure 1(j) shows the superimposition of immunoreactivity of Prx-3 (green) (Fig. 1h) and that of SOD-2 (red) (Fig. 1i). The data indicated that Prx-3 is clearly co-localized with mitochondrial SOD-2, suggesting that Prx-3 exists in mitochondria. We noticed in some areas that Prx-3 immunoreactivity was also detected in PI-stained nucleus (Figs 1c–g). The reason for this localization is not clear at present, but it might be due to the cross-reactivity of the first antibody to other nuclear proteins as there was no immunoreactive signal without the first antibody (data not shown).

image

Figure 1. Prx-3 expression in adult rat brain detected by immunohistochemistry. Brains were fixed in situ by perfusion with 4%para-formaldehyde (v/v) in PBS, isolated and soaked in 10% sucrose (wt/vol) in PBS for another 24 h, and then cryosectioned. Sections (7 µm thick) were stained immunohistochemically as described in Experimental procedures. Prx-3 was visualized using a mouse monoclonal anti-AOP (Prx-3) antibody (green) (b–h and j). Nucleus was stained with propidium iodide (red) (a and c–g). SOD-2 was visualized with anti-Mn-SOD (SOD-2) antibody (red) (i and j). (a and b) Typical sections from 3.5 mm posterior to the bregma in a posterior direction stained with propidium iodide (red) (a) or with anti-Prx-3 antibody (green) (b). (c and d) CA1 region was double-stained with propidium iodide (red) and with anti-Prx-3 antibody (green). Area within square marked in (c) was enlarged in (d). (e–g) DG (e), CA3 (f) and cortex (g) regions were double-stained with propidium iodide (red) and with anti-Prx-3 antibody (green). (h–j) CA1 region was stained with anti-Prx-3 antibody (green) (h) or with anti-SOD-2 antibody (red) (i). Superimposition of two signals is shown in (j). Scale bars = 0.1 mm (a and b) or 10 µm (c–j).

Download figure to PowerPoint

Microinjection of ibotenic acid reduces Prx-3 mRNA amount in the hippocampus

  1. Top of page
  2. Abstract
  3. Experimental procedures
  4. Cloning of rat Prx-3 cDNA and construction of expression vector for Prx-3/GFP chimera
  5. Construction and preparation of recombinant adenoviral vectors
  6. In vivo adenoviral gene transfer and microinjection of ibotenic acid
  7. Real-time quantitative RT-PCR analysis
  8. Immunohistochemistry
  9. Histochemistry
  10. Peripheral type benzodiazepine binding sites (PTBBS) assay
  11. Western blot analysis
  12. Results
  13. Immunohistochemical analysis of Prx-3 in rat brain
  14. Microinjection of ibotenic acid reduces Prx-3 mRNA amount in the hippocampus
  15. In vivo gene transfer of Ad/β-gal and Ad/Prx-3
  16. Adenoviral Prx-3 gene transfer suppresses an increase in PTBBS evoked by microinjection of ibotenic acid
  17. Histochemical analysis confirms that Prx-3 protects against neuronal cell death
  18. Prx-3 prevents tyrosine nitration of hippocampal proteins in vivo
  19. Mitochondrial localization of Prx-3/GFP chimera in NIH-3T3 cell
  20. Discussion
  21. References

Ibotenic acid is well known to cause excitotoxic damage of all hippocampal cells including CA1-3 pyramidal cells, dendritic gyrus and hilar cells, without damage of areas and structures outside the hippocampus (Jarrard and Meldrum 1993). To examine the effect of microinjection of ibotenic acid on Prx-3 mRNA amount, we first performed real-time quantitative RT-PCR to measure glyceraldehyde-3-phosphate dehydrogenase (GAPDH), Prx-3, catalase and SOD-1 mRNA levels in ibotenic acid-microinjected hippocampus. As shown in Fig. 2, microinjection of ibotenic acid resulted in a strong reduction of Prx-3 mRNA by approximately 50% at 6 h after microinjection. In contrast, ibotenic acid did not result in a significant reduction in mRNA levels of GAPDH, catalase and SOD-1. Furthermore, the level of β-actin mRNA, used as an internal standard, did not change significantly (data not shown).

image

Figure 2. Prx-3 mRNA levels evoked by microinjection of ibotenic acid in an excitotoxic model. Total RNA was isolated from the hippocampus of sham-operated (solid bars) and ibotenic acid-microinjected (open bars) rats 6 h after microinjection. The mRNA levels were determined by real-time quantitative RT-PCR and expressed relative to the value of β-actin used as an internal control. Data represent the mean ± SEM (n = 4). Statistical comparisons between two groups were examined using the unpaired Student's t-test. *p < 0.05, compared with sham-operated rats.

Download figure to PowerPoint

In vivo gene transfer of Ad/β-gal and Ad/Prx-3

  1. Top of page
  2. Abstract
  3. Experimental procedures
  4. Cloning of rat Prx-3 cDNA and construction of expression vector for Prx-3/GFP chimera
  5. Construction and preparation of recombinant adenoviral vectors
  6. In vivo adenoviral gene transfer and microinjection of ibotenic acid
  7. Real-time quantitative RT-PCR analysis
  8. Immunohistochemistry
  9. Histochemistry
  10. Peripheral type benzodiazepine binding sites (PTBBS) assay
  11. Western blot analysis
  12. Results
  13. Immunohistochemical analysis of Prx-3 in rat brain
  14. Microinjection of ibotenic acid reduces Prx-3 mRNA amount in the hippocampus
  15. In vivo gene transfer of Ad/β-gal and Ad/Prx-3
  16. Adenoviral Prx-3 gene transfer suppresses an increase in PTBBS evoked by microinjection of ibotenic acid
  17. Histochemical analysis confirms that Prx-3 protects against neuronal cell death
  18. Prx-3 prevents tyrosine nitration of hippocampal proteins in vivo
  19. Mitochondrial localization of Prx-3/GFP chimera in NIH-3T3 cell
  20. Discussion
  21. References

To investigate the efficacy of adenoviral gene transfer into the brain, we performed gene transfer of a control vector, Ad/β-gal, carrying β-galactosidase cDNA. Figure 3 shows four representative sections. The Ad/β-gal-infected region was visualized by X-gal staining through β-galactosidase. As shown in Fig. 3, diffuse gene transfer into the DG and CA1 region was confirmed, as described previously (Nishimura et al. 1998). Staining of the DG and CA1 regions was identified from 3 to 4.5 mm (Fig. 3b–d) and 2–4.5 mm (Fig. 3a–d) posterior to the bregma, respectively. To confirm the expression of the transfected Prx-3 gene further, we performed the immunohistochemical analysis using the anti-Prx-3 antibody. As shown in Fig. 4, compared with no-infection control, the overexpression of Prx-3 was confirmed in the DG and CA1 region (Fig. 4).

image

Figure 3. Confirmation of successful in vivo gene transfer. Brains were isolated 3 days after infection with Ad/β-gal into the hippocampus, soaked in 10% formaldehyde (v/v) in PBS for 24 h and in 10% sucrose (wt/vol) in PBS for another 24 h, and then cryosectioned. Sections (12 µm thick) were incubated overnight in PBS containing X-gal. Four typical sections stained with X-gal are shown from 2 mm (a), 3 mm (b), 3.7 mm (c) and 4.5 mm (d) posterior to the bregma, in a posterior direction. Scale bars = 0.5 mm.

Download figure to PowerPoint

image

Figure 4. Confirmation of overexpression of transferred Prx-3. Brains were isolated 3 days after infection with Ad/Prx-3 into the hippocampus, fixed with 4.5%para-formaldehyde (v/v) in PBS, and then cryosectioned (7 µm thick). Prx-3 was visualized by immunohistochemistry. Four typical sections are shown from 2 mm (a), 3 mm (b), 4 mm (c) and 5 mm (d) posterior to the bregma, in a posterior direction. Scale bars = 0.5 mm.

Download figure to PowerPoint

Adenoviral Prx-3 gene transfer suppresses an increase in PTBBS evoked by microinjection of ibotenic acid

  1. Top of page
  2. Abstract
  3. Experimental procedures
  4. Cloning of rat Prx-3 cDNA and construction of expression vector for Prx-3/GFP chimera
  5. Construction and preparation of recombinant adenoviral vectors
  6. In vivo adenoviral gene transfer and microinjection of ibotenic acid
  7. Real-time quantitative RT-PCR analysis
  8. Immunohistochemistry
  9. Histochemistry
  10. Peripheral type benzodiazepine binding sites (PTBBS) assay
  11. Western blot analysis
  12. Results
  13. Immunohistochemical analysis of Prx-3 in rat brain
  14. Microinjection of ibotenic acid reduces Prx-3 mRNA amount in the hippocampus
  15. In vivo gene transfer of Ad/β-gal and Ad/Prx-3
  16. Adenoviral Prx-3 gene transfer suppresses an increase in PTBBS evoked by microinjection of ibotenic acid
  17. Histochemical analysis confirms that Prx-3 protects against neuronal cell death
  18. Prx-3 prevents tyrosine nitration of hippocampal proteins in vivo
  19. Mitochondrial localization of Prx-3/GFP chimera in NIH-3T3 cell
  20. Discussion
  21. References

In vivo gene transfer was performed 2 days before in vivo microinjection of ibotenic acid into the posterior hippocampus. To examine the protective effect of Prx-3 gene transfer, PTBBS were assayed 12 days after microinjection. The increase of PTBBS is well known to reflect gliosis, which occurs after neuronal cell death (Demerle-Pallardy et al. 1991; Saura et al. 1994; Brauner-Osborne et al. 1998). Microinjection of ibotenic acid has been reported to cause a significant increase of PTBBS in the hippocampus (Brauner-Osborne et al. 1998). Figure 5 shows the effect of Prx-3 gene transfer. Adenoviral gene transfer of Ad/β-gal (control) increased the PTBBS approximately fourfold over the sham-operated group. Transfer of Ad/Prx-3 before microinjection significantly reduced the PTBBS compared with that after transfer of Ad/β-gal, which was not statistically different from that of the sham-operated group (Fig. 5). This result suggested that overexpression of Prx-3 in the hippocampus suppressed an increase of PTBBS evoked by microinjection of ibotenic acid.

image

Figure 5. Effect of adenoviral gene transfer of Ad/Prx-3 on an increase of PTBBS evoked by microinjection of ibotenic acid. In vivo gene transfer of Ad/Prx-3 or Ad/β-gal was performed 2 days prior to in vivo microinjection of ibotenic acid into the posterior hippocampus. The hippocampus was isolated from sham-operated (n = 4), Ad/β-gal-infected (n = 5) and Ad/Prx-3-infected (n = 5) rats and subjected to the PTBBS assay 12 days after microinjection of ibotenic acid as described in Experimental procedures. Experimental data represent means ± SEM. Significant differences were determined by one-way analysis of variance (one-way anova) followed by post-hoc testing with the Tukey–Kramer test.

Download figure to PowerPoint

Histochemical analysis confirms that Prx-3 protects against neuronal cell death

  1. Top of page
  2. Abstract
  3. Experimental procedures
  4. Cloning of rat Prx-3 cDNA and construction of expression vector for Prx-3/GFP chimera
  5. Construction and preparation of recombinant adenoviral vectors
  6. In vivo adenoviral gene transfer and microinjection of ibotenic acid
  7. Real-time quantitative RT-PCR analysis
  8. Immunohistochemistry
  9. Histochemistry
  10. Peripheral type benzodiazepine binding sites (PTBBS) assay
  11. Western blot analysis
  12. Results
  13. Immunohistochemical analysis of Prx-3 in rat brain
  14. Microinjection of ibotenic acid reduces Prx-3 mRNA amount in the hippocampus
  15. In vivo gene transfer of Ad/β-gal and Ad/Prx-3
  16. Adenoviral Prx-3 gene transfer suppresses an increase in PTBBS evoked by microinjection of ibotenic acid
  17. Histochemical analysis confirms that Prx-3 protects against neuronal cell death
  18. Prx-3 prevents tyrosine nitration of hippocampal proteins in vivo
  19. Mitochondrial localization of Prx-3/GFP chimera in NIH-3T3 cell
  20. Discussion
  21. References

The hippocampus was isolated 3 days after microinjection of ibotenic acid, fixed, and cryosectioned to produce 12 µm thick sections. Some sections were subjected to Nissl staining. As shown in Fig. 6, gene transfer of Ad/β-gal alone induced little injury (Figs 6a and 6d), whereas transfer of Ad/β-gal followed by ibotenic acid injection caused significant injury in the dentate gyrus (Fig. 6b) and CA1 (Fig. 6e) region (see regions indicated by arrows). In contrast, gene transfer of Ad/Prx-3 did not cause any injury (Figs 6c and 6f), similar to the effect of Ad/β-gal (Figs 6a and 6d). Qualitative histochemical analysis suggested that in vivo gene transfer of Ad/Prx-3 protected against neural cell death induced by ibotenic acid.

image

Figure 6. Effect of Ad/Prx-3 gene transfer on neural cell death. In vivo gene transfer of Ad/Prx-3 or Ad/β-gal was performed 2 days before in vivo microinjection of ibotenic acid into the posterior hippocampus. The hippocampus was isolated from Ad/β-gal-infected (Ad/β-gal), Ad/β-gal-infected plus ibotenic acid-injected (Ad/β-gal + IBO), and Ad/Prx-3-infected plus ibotenic acid-injected (Ad/Prx-3 + IBO) rats, fixed, and cryosectioned to produce 12 µm thick sections. Sections were subjected to Nissl staining. Two typical groups of sections from approximately 3.6 mm anterior (a–c) and approximately 4.2 mm (d–f) caudal to the bregma are shown. Arrows indicate the dentate gyrus (a–c) and CA1 (d–f) region in which remarkable injury in the Ad/β-gal + ibotenic acid group (b, e) and remarkable protection in the Ad/Prx-3 + ibotenic acid group (c, f) was observed. Scale bars = 0.5 mm.

Download figure to PowerPoint

Prx-3 prevents tyrosine nitration of hippocampal proteins in vivo

  1. Top of page
  2. Abstract
  3. Experimental procedures
  4. Cloning of rat Prx-3 cDNA and construction of expression vector for Prx-3/GFP chimera
  5. Construction and preparation of recombinant adenoviral vectors
  6. In vivo adenoviral gene transfer and microinjection of ibotenic acid
  7. Real-time quantitative RT-PCR analysis
  8. Immunohistochemistry
  9. Histochemistry
  10. Peripheral type benzodiazepine binding sites (PTBBS) assay
  11. Western blot analysis
  12. Results
  13. Immunohistochemical analysis of Prx-3 in rat brain
  14. Microinjection of ibotenic acid reduces Prx-3 mRNA amount in the hippocampus
  15. In vivo gene transfer of Ad/β-gal and Ad/Prx-3
  16. Adenoviral Prx-3 gene transfer suppresses an increase in PTBBS evoked by microinjection of ibotenic acid
  17. Histochemical analysis confirms that Prx-3 protects against neuronal cell death
  18. Prx-3 prevents tyrosine nitration of hippocampal proteins in vivo
  19. Mitochondrial localization of Prx-3/GFP chimera in NIH-3T3 cell
  20. Discussion
  21. References

To investigate whether microinjection of ibotenic acid increases tyrosine nitration of hippocampal proteins, and to assess the effect of Ad/Prx-3 gene transfer, we performed western blotting with an anti-nitrotyrosine antibody. As shown in Fig. 7 (lane A), microinjection of ibotenic acid after gene transfer of Ad/β-gal (control) induced an increase in nitrotyrosine of at least two proteins of approximate molecular weight 52 and 28 kDa, respectively (Ad/β-gal + IBO), compared with the sham-operated group (Sham). In contrast, tyrosine nitration almost completely disappeared following Ad/Prx-3 gene transfer prior to microinjection of ibotenic acid (Ad/Prx-3 + IBO). We next examined the amount of Prx-3 protein by western blotting. As shown in Fig. 7 (lane B), a relatively lower amount of Prx-3 protein was observed in Ad/β-gal + IBO compared with that in Sham, while the amount of Prx-3 protein in Ad/Prx-3 + IBO was almost similar to that in Sham. There seems to be negative correlation between the amount of Prx-3 protein and the extent of protein nitration in Ad/β-gal + IBO. These findings suggested that overexpression of Prx-3 might prevent the protein nitration evoked by microinjection of ibotenic acid.

image

Figure 7. Effect of Ad/Prx-3 gene transfer on tyrosine nitration of hippocampal proteins. The hippocampus from sham-operated (Sham), Ad/α-gal-infected plus ibotenic acid injected (Ad/α-gal + IBO), and Ad/Prx-3-infected plus ibotenic acid-injected (Ad/Prx-3 + IBO) rats was isolated and homogenized 12 days after microinjection of ibotenic acid as described in Experimental procedures. The extracted proteins were subjected to 12.5% SDS-PAGE. Nitrated proteins (a) and Prx-3 protein (b) were visualized by western blotting using an anti-nitrotyrosine antibody (a) and an anti-AOP (Prx-3) antibody (b), respectively. To confirm the amount of loaded proteins, total proteins were also visualized by Coomassie Brilliant Blue (CBB) staining. The CBB-stained gel is shown (c). Three independent samples per group were loaded and visualized. Arrows indicate significantly tyrosine-nitrated proteins. M, molecular weight markers.

Download figure to PowerPoint

Mitochondrial localization of Prx-3/GFP chimera in NIH-3T3 cell

  1. Top of page
  2. Abstract
  3. Experimental procedures
  4. Cloning of rat Prx-3 cDNA and construction of expression vector for Prx-3/GFP chimera
  5. Construction and preparation of recombinant adenoviral vectors
  6. In vivo adenoviral gene transfer and microinjection of ibotenic acid
  7. Real-time quantitative RT-PCR analysis
  8. Immunohistochemistry
  9. Histochemistry
  10. Peripheral type benzodiazepine binding sites (PTBBS) assay
  11. Western blot analysis
  12. Results
  13. Immunohistochemical analysis of Prx-3 in rat brain
  14. Microinjection of ibotenic acid reduces Prx-3 mRNA amount in the hippocampus
  15. In vivo gene transfer of Ad/β-gal and Ad/Prx-3
  16. Adenoviral Prx-3 gene transfer suppresses an increase in PTBBS evoked by microinjection of ibotenic acid
  17. Histochemical analysis confirms that Prx-3 protects against neuronal cell death
  18. Prx-3 prevents tyrosine nitration of hippocampal proteins in vivo
  19. Mitochondrial localization of Prx-3/GFP chimera in NIH-3T3 cell
  20. Discussion
  21. References

To examine whether the expressed Prx-3 protein remains in the cytoplasm or is indeed specifically translocated to the mitochondria as expected, we finally performed an in vitro experiment using a Prx-3/GFP chimeric construct and NIH-3T3 cells. After transfection of NIH-3T3 cells with Prx-3/GFP chimeric construct, cells were loaded with MitoTracker Red, a mitochondrial indicator. Fluorescent signals of GFP (green) and MitoTracker (red) were visualized under confocal microscopy and shown on the left (green) and in the center (red) (Fig. 8). When two signals were superimposed, yellow color signals were observed (on the right), suggesting that Prx-3/GFP protein is specifically localized in mitchondria.

image

Figure 8. Mitochondrial localization of Prx-3/GFP chimera in NIH-3T3 cell. Non-viral expression vector for Prx-3/GFP chimera was introduced into NIH-3T3 cells using Lipofectamine 2000 (Invitrogen). After 2 days, MitoTracker Red (Molecular Probes) was loaded into the cells. Fluorescent signals of GFP (green) and MitoTracker (red) were visualized under confocal microscopy and shown in the left (green) and in the center (red). Superimposition of two signals is shown in the right. Scale Bar = 10 µm.

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Abstract
  3. Experimental procedures
  4. Cloning of rat Prx-3 cDNA and construction of expression vector for Prx-3/GFP chimera
  5. Construction and preparation of recombinant adenoviral vectors
  6. In vivo adenoviral gene transfer and microinjection of ibotenic acid
  7. Real-time quantitative RT-PCR analysis
  8. Immunohistochemistry
  9. Histochemistry
  10. Peripheral type benzodiazepine binding sites (PTBBS) assay
  11. Western blot analysis
  12. Results
  13. Immunohistochemical analysis of Prx-3 in rat brain
  14. Microinjection of ibotenic acid reduces Prx-3 mRNA amount in the hippocampus
  15. In vivo gene transfer of Ad/β-gal and Ad/Prx-3
  16. Adenoviral Prx-3 gene transfer suppresses an increase in PTBBS evoked by microinjection of ibotenic acid
  17. Histochemical analysis confirms that Prx-3 protects against neuronal cell death
  18. Prx-3 prevents tyrosine nitration of hippocampal proteins in vivo
  19. Mitochondrial localization of Prx-3/GFP chimera in NIH-3T3 cell
  20. Discussion
  21. References

The major finding of the present study was that Prx-3 gene transfer into the brain in vivo protected hippocampal neurons from the excitotoxicity caused by microinjection of ibotenic acid. This result suggests that Prx-3 is a new neuroprotective protein. Although several bacterial studies in vitro have shown that Prx could scavenge both H2O2, in co-operation with thiol, and ONOO by itself (Bryk et al. 2000), to date there is no evidence that Prx-3 can function as a ONOO scavenger in vivo. We demonstrated by western blotting that the excitotoxicity evoked by ibotenic acid induced nitration of hippocampal proteins, and that gene transfer of Prx-3 completely abolished the protein nitration that was probably caused by augmented ONOO. Although we cannot exclude the possibility that Prx-3 may indirectly prevent ONOO production via H2O2 scavenging action (Bryk et al. 2000), to our knowledge, this is the first report suggesting that Prx-3 functions in vivo as a protective ONOO scavenger.

We showed that Prx-3 protein exists in the granules of rat hippocampal CA1-3, DG and cortex, where Prx-3 is co-localized with SOD-2 (Fig. 1). It should be noted that the immunoreactive signal of Prx-3 is relatively low in CA1-2 and DG compared with CA3 region (Fig. 4). These low signals are because CA1-2 and DG regions contain a small number of neuron-like cells and the cells contain a small number of mitochondria per cell, not because of the low amount of Prx-3 protein per mitochondrion. On the other hand, the Prx-3 protein level per cell and per mitochondrion in some cortical neuron-like cells seems to be markedly higher than that in hippocampal cells (Fig. 1). As we suggested here that Prx-3 could be a neuroprotective protein, a lower Prx-3 expression level in hippocampus might be correlated with higher sensitivity of hippocampal neurons to excitotoxic damage (Candelario et al. 2001). SOD-2, an antioxidant enzyme in mitochondria, was identified as one of the major nitrated and inactivated proteins during chronic rejection of human renal allografts (MacMillan-Crow et al. 1996). Nitration of mitochondrial succinyl-CoA:3-oxoacid CoA-transferase (SCOT) is also increased in the hearts and kidneys of lipopolysaccharide-treated rats (Marcondes et al. 2001). Comparing our results with these previous findings, the molecular weights of the two nitrated proteins visible on western blotting (Fig. 7) appeared to be similar to those corresponding to SOD-2 and SCOT. Adenoviral gene transfer of Prx-3 completely abolished nitration of these proteins. There seems to be a negative correlation between the amount of Prx-3 protein and the extent of protein nitration (Fig. 7). Transfected rat Prx-3 cDNA is generally expressed in mitochondria in NIH-3T3 cells (Fig. 8), COS cells and neonatal rat cardiac myocytes (data not shown). Thus, it is tempting to hypothesize that ONOO might be predominantly generated in mitochondria, and that it might primarily nitrate mitochondrial proteins during excitotoxic injury.

Previously, Kim and colleagues reported the presence of significantly low levels of mitochondrial Prx-3 in brains of human patients with AD and Down's syndrome (Kim et al. 2001). We also demonstrated that left ventricular Prx-3 protein and mRNA levels were decreased in a model of rat heart failure (manuscript submitted). Taking these results into consideration, the decrease of Prx-3 mRNA and protein levels might occur in several pathological situations, as a general phenomenon in diverse species.

Why a protective protein is down-regulated at the mRNA level is not known. In this study, we observed a rapid decrease of Prx-3 mRNA levels at 6 h after ibotenic acid microinjection, suggesting the possible existence of a down-regulation system. Given the reported onset of apoptosis within a few hours in excitotoxic injuries (Luetjens et al. 2000), we speculate that one possible down-regulatory mechanism might involve a feedback regulation of apoptotic signals for undergoing complete apoptosis.

Protein nitration is known to be increased in patients with AD (Su et al. 1997). Thus, the decrease of Prx-3 protein in neurodegenerative diseases may not be just the result, but may be a cause of the aggravation. We have demonstrated the protective function of Prx-3 in vivo and therefore, speculate that a strategy for mitochondrial protection via scavenging of mitochondrial ONOO might represent a clinically useful neuroprotective therapy.

References

  1. Top of page
  2. Abstract
  3. Experimental procedures
  4. Cloning of rat Prx-3 cDNA and construction of expression vector for Prx-3/GFP chimera
  5. Construction and preparation of recombinant adenoviral vectors
  6. In vivo adenoviral gene transfer and microinjection of ibotenic acid
  7. Real-time quantitative RT-PCR analysis
  8. Immunohistochemistry
  9. Histochemistry
  10. Peripheral type benzodiazepine binding sites (PTBBS) assay
  11. Western blot analysis
  12. Results
  13. Immunohistochemical analysis of Prx-3 in rat brain
  14. Microinjection of ibotenic acid reduces Prx-3 mRNA amount in the hippocampus
  15. In vivo gene transfer of Ad/β-gal and Ad/Prx-3
  16. Adenoviral Prx-3 gene transfer suppresses an increase in PTBBS evoked by microinjection of ibotenic acid
  17. Histochemical analysis confirms that Prx-3 protects against neuronal cell death
  18. Prx-3 prevents tyrosine nitration of hippocampal proteins in vivo
  19. Mitochondrial localization of Prx-3/GFP chimera in NIH-3T3 cell
  20. Discussion
  21. References
  • Abe K., Aoki M., Kawagoe J., Yoshida T., Hattori A., Kogure K. and Itoyama Y. (1995) Ischemic delayed neuronal death. A mitochondrial hypothesis. Stroke 26, 14781489.
  • Almeida A. and Bolanos J. P. (2001) A transient inhibition of mitochondrial ATP synthesis by nitric oxide synthase activation triggered apoptosis in primary cortical neurons. J. Neurochem. 77, 676690.
  • Ankarcrona M., Dypbukt J. M., Bonfoco E., Zhivotovsky B., Orrenius S., Lipton S. A. and Nicotera P. (1995) Glutamate-induced neuronal death: a succession of necrosis or apoptosis depending on mitochondrial function. Neuron 15, 961973.
  • Brauner-Osborne H., Nielsen B. and Krogsgaard-Larsen P. (1998) Molecular pharmacology of homologues of ibotenic acid at cloned metabotropic glutamic acid receptors. Eur. J. Pharmacol. 350, 311316.
  • Brown G. C. (1999) Nitric oxide and mitochondrial respiration. Biochim. Biophys. Acta 1411, 351369.
  • Bryk R., Griffin P. and Nathan C. (2000) Peroxynitrite reductase activity of bacterial peroxiredoxins. Nature 407, 211215.
  • Candelario-Jalil E., Al-Dalain S. M., Castillo R., Martinez G. and Fernandez O. S. (2001) Selective vulnerability to kainate-induced oxidative damage in different rat brain regions. J. Appl. Toxicol. 21, 403407.
  • Chen L., Xie Q. W. and Nathan C. (1988) Alkyl hydroperoxide reductase subunit C (AhpC) protects bacterial and human cells against reactive nitrogen intermediates. Mol. Cell 6, 795805.
  • Chomczynski P. and Sacchi N. (1987) Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162, 156159.
  • Demerle-Pallardy C., Duverger D., Spinnewyn B., Pirotzky E. and Braquet P. (1991) Peripheral type benzodiazepine binding sites following transient forebrain ischemia in the rat: effect of neuroprotective drugs. Brain Res. 565, 312320.
  • Ghafourifar P. and Richter C. (1997) Nitric oxide synthase activity in mitochondria. FEBS Lett. 418, 291296.
  • Graeber M. B., Grasbon-Frodl E., Eitzen U. V. and Kosel S. (1998) Neurodegeneration and aging: role of the second genome. J. Neurosci. Res. 52, 16.
  • Jarrard L. E. and Meldrum B. S. (1993) Selective excitotoxic pathology in the rat hippocampus. Neuropathol. Appl. Neurobiol. 19, 381389.
  • Kanai A. J., Pearce L. L., Clemens P. R., Birder L. A., VanBibber M. M., Choi S. Y., De Groat W. C. and Peterson J. (2001) Identification of a neuronal nitric oxide synthase in isolated cardiac mitochondria using electrochemical detection. Proc. Natl Acad. Sci. USA 98, 1412614131.
  • Kang S. W., Chae H. Z., Seo M. S., Kim K., Baines I. C. and Rhee S. G. (1998) Mammalian peroxiredoxin isoforms can reduce hydrogen peroxide generated in response to growth factors and tumor necrosis factor-alpha. J. Biol. Chem. 273, 62976302.
  • Kim S. H., Fountoulakis M., Cairns N. and Lubec G. (2001) Protein levels of human peroxiredoxin subtypes in brains of patients with Alzheimer's disease and Down syndrome. J. Neural. Transm. (Suppl.) 61, 223235.
  • Kluck R. M., Bossy-Wetzel E., Green D. R. and Newmeyer D. D. (1997) The release of cytochrome c from mitochondria: a primary site for Bcl-2 regulation of apoptosis. Science 275, 11321136.
  • Knoops B., Clippe A., Bogard C., Arsalane K., Wattiez R., Hermans C., Duconseille E., Falmagne P. and Bernard A. (1999) Cloning and characterization of AOEB166, a novel mammalian antioxidant enzyme of the peroxiredoxin family. J. Biol. Chem. 274, 3045130458.
  • Luetjens C. M., Bui N. T., Sengpiel B., Munstermann G., Poppe M., Krohn A. J., Bauerbach E., Krieglstein J. and Prehn J. H. (2000) Delayed mitochondrial dysfunction in excitotoxic neuron death: Cytochrome c release and a secondary increase in superoxide production. J. Neurosci. 20, 57155723.
  • MacMillan-Crow L. A., Crow J. P., Kerby J. D., Beckman J. S. and Thompson J. A. (1996) Nitration and inactivation of manganese superoxide dismutase in chronic rejection of human renal allografts. Proc. Natl Acad. Sci. USA 93, 1185311858.
  • Marcondes S., Turko I. V. and Murad F. (2001) Nitration of succinyl-CoA: 3-oxoacid CoA-transferase in rats after endotoxin administration. Proc. Natl Acad. Sci. USA 98, 71467151.
  • Matsumoto A., Okado A., Fujii T., Fujii J., Egashira M., Niikawa N. and Taniguchi N. (1999) Cloning of the peroxiredoxin gene family in rats and characterization of the fourth member. FEBS Lett. 443, 246250.
  • Mitsumoto A., Takanezawa Y., Okawa K., Iwamatsu A. and Nakagawa Y. (2001) Variants of peroxiredoxins expression in response to hydroperoxide stress. Free Radic. Biol. Med. 30, 625635.
  • Nicholls D. G. and Budd S. L. (1998) Mitochondria and neuronal glutamate excitotoxicity. Biochim. Biophys. Acta 1366, 97112.
  • Nishimura I., Uetsuki T., Dani S. U., Ohsawa Y., Saito I., Okamura H., Uchiyama Y. and Yoshikawa K. (1998) Degeneration in vivo of rat hippocampal neurons by wild-type Alzheimer amyloid precursor protein overexpressed by adenovirus-mediated gene transfer. J. Neurosci. 18, 23872398.
  • Paxinos G. and Watson C. (1986) The rat brain in stereotaxic coordinates. Academic Press, Sydney.
  • Rizzuto R., Bastianutto C., Brini M., Murgia M. and Pozzan T. (1994) Mitochondrial Ca2+ homeostasis in intact cells. J. Cell Biol. 126, 11831194.
  • Saura J., Luque J. M., Cesura A. M., Da Prada M., Chan-Palay V., Huber G., Loffler J. and Richards J. G. (1994) Increased monoamine oxidase B activity in plaque-associated astrocytes of Alzheimer brains revealed by quantitative enzyme radioautography. Neuroscience 62, 1530.
  • Scallet A. C. and Ye X. (1997) Excitotoxic mechanisms of neurodegeneration in transmissible spongiform encephalopathies. Ann. NY Acad. Sci. 825, 194205.
  • Su J. H., Deng G. and Cotman C. W. (1997) Neuronal DNA damage precedes tangle formation and is associated with up-regulation of nitrotyrosine in Alzheimer's disease brain. Brain Res. 774, 193199.
  • Tabrizi S. J. and Schapira A. H. (1999) Secondary abnormalities of mitochondrial DNA associated with neurodegeneration. Biochem. Soc. Symp. 66, 99110.
  • Tan S., Sagara Y., Liu Y., Maher P. and Schubert D. (1998) The regulation of reactive oxygen species production during programmed cell death. J. Cell Biol. 141, 14231432.
  • Territo P. R., Mootha V. K., French S. A. and Balaban R. S. (2000) Ca (2+) activation of heart mitochondrial oxidative phosphorylation: role of the F(0)/F(1)-ATPase. Am. J. Physiol. Cell Physiol. 278, C423C435.
  • Yamamoto T., Matsui Y., Natori S. and Obinata M. (1989) Cloning of a housekeeping-type gene (MER5) preferentially expressed in murine erythroleukemia cells. Gene 80, 337343.