SEARCH

SEARCH BY CITATION

Keywords:

  • Drosophila;
  • free radical;
  • gene regulation;
  • MnSOD;
  • transcription

Summary

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgments
  8. References

The transcription of manganese superoxide dismutase (MnSOD), expression of which is essential for detoxification of superoxide radicals from mitochondria, has been shown to be regulated in vitro by many factors and conditions including oxidative stress, cytokines, lipopolysaccharide, cytoplasmic myc (c-myc), p53 and tumour necrosis factors. Here we describe genomic regions in Drosophila melanogaster with regulatory effects on transcription of the MnSOD gene at an organism-wide level. To understand the integrated regulation of MnSOD expression we screened chromosomes of D. melanogaster to locate deficiencies that altered the expression of MnSOD. Suppressors of MnSOD were screened by assessing the relative message abundance of MnSOD in 149 deletions covering approximately 81% of the Drosophila genome. The chromosomal deficiency Df(2R)017 significantly up-regulated MnSOD mRNA by 1.7-fold. Deficiency in four other genomic intervals, Df(1)ct-J4, Df(2L)BSC4, Df(3L)66C-G28 and Df(3R)Scr, down-regulated MnSOD expression. Changes in MnSOD expression were positively associated with paraquat sensitivity of the deletion genotypes. Thus, at least one candidate enhancer and four candidate suppressors exist in the Drosophila genome to regulate the transcriptional activity of the MnSOD gene in vivo.


Introduction

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgments
  8. References

Eukaryotes carry several forms of superoxide dismutases (SOD): manganese SOD (MnSOD), copper–zinc SOD (Cu–ZnSOD) and extracellular SOD (ECSOD). Each is deployed to catalyse the conversion of superoxide radicals (O2) into hydrogen peroxide. Encoded by the nuclear genome, SOD acts in many sites; MnSOD and Cu–ZnSOD function independently in the inner mitochondrial membrane and in the cell cytoplasm, respectively, whereas ECSOD is active only in the extracellular space (Oury et al., 1994). Dismutation of superoxide radicals by MnSOD in the inner mitochondrial matrix is essential for viability. Loss of MnSOD in mice causes impaired brain and heart development, abnormal muscle fatigue, behavioural abnormality and aberrant liver lipid metabolism (Li et al., 1995; Lebovitz et al., 1996; Wallace, 2001). Notably, dismutation of superoxide radicals by MnSOD is thought to be a major determinant of lifespan and aging (Sohal & Weindruch, 1996; Finkel & Holbrook, 2000). The loss of MnSOD leads to shortened lifespan, whereas increased production of MnSOD in adult Drosophila melanogaster extends the lifespan up to 40% (Sun et al., 2002), and feeding an MnSOD/catalase mimetic to Caenorhabditis elegans extends the lifespan of wild-type worms by 54% (Melov et al., 2000). Similar mimetics have the ability partially to rescue the short-lifespan phenotype of the MnSOD knockout mouse (Melov et al., 2001). Because MnSOD expression is vital for survival and normal life expectancy, it is important to understand how MnSOD expression is regulated in vivo across tissues and throughout the life course.

Classic in vitro studies have demonstrated that MnSOD mRNA expression is induced more than 10 fold when cells were treated with tumour necrosis factor-α (TNF-α) and with the cytokine interleukin-1 (IL-1) (Masuda et al., 1988; Wong & Goeddel, 1988). Nuclear run-on and steady-state mRNA analysis have confirmed that these agents transiently regulate MnSOD expression (Wong et al., 1989; Visner et al., 1990; Borg et al., 1992; Tsan et al., 1992). Recent observations suggest that transcriptional induction of MnSOD mRNA augments the expression of MnSOD protein because TNF-α or IL-1 increase intracellular Reactive Oxygen Species (ROS), which activates the transcription factors NF-κB and AP-1 (Sen & Packer, 1996; Das et al., 1995; Borello & Demple, 1997; Manna et al., 1998). In a variety of organisms, the 5′MnSOD promoter region carries potential binding sites for NF-κB and AP-1 (Jones et al., 1995). Yet, despite the presence of these binding sites, in vitro reporter assays have failed to show that MnSOD promoter elements are activated following treatment with TNF-α or IL, most likely because MnSOD expression is also modified by enhancer elements. Indeed, the MnSOD promoter region harbours response elements such as C/EBP, ARE and CREB1/ATF-1 (St. Clair et al., 2002), and additional enhancers have been identified in the second intron of both mouse and human MnSOD (Jones et al., 1997; Xu et al., 1999). The regulatory complexity of MnSOD was further revealed when overexpression of E2F and c-myc suppressed MnSOD transcription, which in turn promoted apoptosis (Tanaka et al., 2002). Together, these in vitro observations show how MnSOD regulation can be complex and diverse. We might expect the in vivo regulation of MnSOD and its related phenotypes to present equal complexity.

D. melanogaster offers a powerful system to identify integrated organism-wide regulators of MnSOD and to understand the phenotypic consequences of these systems. The MnSOD gene of Drosophila shares 60% amino acid identity with the mammalian gene (Duttaroy et al., 1994). The Drosophila MnSOD gene also shares regulatory elements with mammals in their potential binding sites for AP1, CREB and NF-κB transcription factors (Duttaroy et al., 1997). To understand the functional significance of these parallels, here we describe regions of the genome where putative factors may regulate MnSOD transcription. We have screened the D. melanogaster genome with a panel of 149 genomic deficiencies and measured MnSOD mRNA levels under conditions of genetic hemizygosity. We find at least five genomic intervals with modifiers for MnSOD transcription activity in D. melanogaster and show that the modified transcription is associated with a whole organism phenotype of resistance to the exogenous oxidative stress agent paraquat, indicative of altered MnSOD function.

Results

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgments
  8. References

Expression patterns of MnSOD

Relative to reference rp49 mRNA, whole body mRNA of MnSOD is equally expressed in male and female flies of the wild-type background (Fig. 1). By contrast, among age-matched males and females, MnSOD levels varied among tissues (Fig. 1). Similar levels of expression were observed in tissue of heads but the level of MnSOD in male muscle was 1.64-fold greater than in similar female tissue. An even greater difference was detected between male and female gonads, where a 2.62-fold higher level of MnSOD mRNA was found in the testis compared with the ovary. Tissue and sex specificity in MnSOD message abundance suggests that the organism-wide regulation of MnSOD may include both cis- and trans-elements.

image

Figure 1. Sex-specific expression of MnSOD mRNA in different tissues of Drosophila. Bars represent the MnSOD and rp49 mRNA ratio. This ratio is 1.0 (dotted line) when mRNA is extracted from whole body samples. Male testis and muscle showed significantly higher levels of MnSOD mRNA expression relative to female ovary and muscle.

Download figure to PowerPoint

MnSOD expression also varies as a function of development (Fig. 2). MnSOD levels were minimal in embryos (0–24 h post fertilization) and increased substantially during the first instar larval stage to a level maintained through the juvenile stages. At pupation, MnSOD expression decreased slightly to approximately 84% of the rp49 reference. Thus, MnSOD mRNA expression shows marked temporal and spatial regulatory variation.

image

Figure 2. Regulation of MnSOD expression during development. MnSOD is expressed at a lower level during embryogenesis than in the larva, pupa or adult.

Download figure to PowerPoint

Genomic regulators of integrated organismal MnSOD expression

These patterns of expression suggest that MnSOD is endogenously regulated throughout the fly life cycle in response to ontogeny, gender and age. The genome of Drosophila presumably carries transcriptional elements to modify the integrated organism-wide expression of the MnSOD gene. These factors may or may not resemble those factors known to regulate MnSOD in cell culture.

To identify transcriptional modifiers of MnSOD expression acting at the organismal level, we screened a series of deficiencies that spanned approximately 81% of the Drosophila euchromatic genome (Fig. 3A) (White et al., 1994; McCall & Steller, 1997; Nicholls & Gelbert, 1998). Each deletion eliminates one allele for all loci within the interval and reduces dominance-independent affects of each allele. Trans-factors for MnSOD within these intervals can be detected by changes in MnSOD message abundance (Fig. 3B).

image

Figure 3. A. Schematic representation of all 149 genomic deletions used for localizing MnSOD transcriptional modifiers in the Drosophila genome. The extent of each deletion interval is denoted. Deletions are defined in maps (Berkley Drosophila Genome Project, annotation Release 3.0) based on recombination (A), cytology of polytene chromosome (B) and molecular distance (C) flybase 1996. Genomic intervals capable of modifying MnSOD transcription activity are indicated by a dark line. B. Schematic representation of the genetic screen performed to identify regulators of MnSOD expression.

Download figure to PowerPoint

Because the ratio of MnSOD to rp49 mRNA in wild-type Drosophila is constant across the first 5 days post-eclosion (Fig. 4A), in each deficiency genotype we operationally define changes in MnSOD as the level relative to rp49. Although the deficiency may alter rp49 itself and thus the relative expression ratio, our independent assays of stress resistance help confirm that MnSOD levels are the actual targets of modification.

image

Figure 4A. Semiquantitative RT-PCR analysis of MnSOD and rp49 transcripts across early adult ages based on whole body RNA extraction. B. Distribution of log10-transformed values of MnSOD/rp49 ratios for all 149 deletions tested. The grey areas represent the bootstrapped estimates of log10 values for upper and lower 95% confidence intervals (log10 ± 2SD).

Download figure to PowerPoint

To infer when changes in MnSOD were significant, we bootstrapped a null distribution of luminosity ratios (Fig. 4) and estimated the standard deviation (0.267) and significance cut-off values (Campbell & Heyer, 2002) from a normalized form of this distribution. Observed luminosity ratios for each deletion line are superimposed on Fig. 4. Only five of the 149 tested genomic regions significantly altered MnSOD expression; thus, 96% of the fly genome has no obvious influence on MnSOD transcription activity. One deletion interval, Df(2R)017, up-regulates MnSOD transcription by a factor of 1.7-fold (Fig. 5). Df(2R)017 is a 330-kb deletion on the second chromosome (Fig. 3A). MnSOD transcriptional activity was significantly suppressed in four deletions: Df(1)ct-J4, Df(2L)BSC4, Df(3L)66C-G28 and Df(3R)Scr. In particular, Df(3R)Scr reduced MnSOD mRNA by about 80% compared with the rp49 control value (Fig. 5).

image

Figure 5. MnSOD expression from significant deletion lines: up-regulated in Df(2R)017, down-regulated in Df(1)ct-J4, Df(2L)BSC4, Df(3L)66C-G28 and Df(3R)Scr. Peak intensities are expressed in luminosity values corrected for background.

Download figure to PowerPoint

MnSOD transcription activity and paraquat sensitivity

We measured paraquat (methyl violgen) stress resistance in each of the candidate MnSOD regulatory deletion heterozygotes to confirm independently whether transcript changes are associated with inferred changes in MnSOD rather than with variation in the reference transcript rp49. Exposure to a 10 mm paraquat solution kills 50% of wild-type flies in 48 h (Fig. 6), as observed previously by Phillips et al. (1989). Df(2R)017, which increased MnSOD transcription, also improved survival of flies exposed to paraquat (Fig. 6). Flies carrying the deletions Df(1)ct-J4 and Df(3L)66C-G28, which reduce MnSOD transcription, were also more sensitive to paraquat (Fig. 6).

image

Figure 6. Paraquat sensitivity of MnSOD-modified lines. Median survival of Canton-S wild type (thick line) is approximately 48 h.

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgments
  8. References

The tested series of 149 deficiencies covers all of chromosome X, 87% of the second chromosome and 70% of the third chromosome. Candidate modifier loci for organism-wide regulation of MnSOD in D. melanogaster are listed from the intervals of Df(2R)017, Df(2L)BSC4, Df(1)ct-J4, Df(3L)66C-G28 and Df(3R)Scr in Table 1.

Table 1.  Summary of deletion intervals modifying MnSOD abundance
Deletion factorsLength (kb)No. of open reading frames*Known transcription
  • *

    Total and (number without annotated function).

Df(1)ct-J471863 (21)Cyclin T, Optix, CG12361
Df(2R)01733044 (21)None
Df(2L)BSC412427 (10)retained
Df(3L)66C-G2825966 (48)None
Df(3R)Scr45455 (8)Zfh1, giant, dorsal, switch, eagle, paired

Nearly 60% of the 255 open reading frames within these intervals, including nine transcription factors, have annotated functions that may include acting as transacting regulators of MnSOD. These transcription factors have variously documented functions: (1) CyclinT: large subunit of P-TEFb, the positive transcription elongation factor associated with transcription elongation. (2) Optix: RNA polymerase II transcription factor expressed in embryos and larvae, also essential for eye development. (3) CG12361: a helix-turn-helix transcription factor with no described mutant phenotypes. (4) Retained: a DNA binding protein that contains an AT-rich interaction domain (ARAID), mutants of which affect embryonic and larval muscle cell development. (5) Zn finger homeodomain 1: contains a zinc finger and a homeobox domain. Mutants affect the function of embryonic and larval muscle and of pericardial cells. (6) Giant: belongs to the basic leucine zipper transcription factor family expressed in the embryo. Loss of function affects the peripheral nervous system and abdominal segments, and extends larval development by 4–5 days. (7) Dorsal switch protein1: a transcriptional co-repressor involved in DNA unwinding. Mutants of the Dorsal switch protein gene have poor viability and low fertility, and are defective in locomotion and flight behaviour. (8) Eagle: encodes a C4-type steroid receptor zinc finger essential for specifying the fate of serotonin neurones. Eagle is expressed in the embryo and homozygous mutants exhibit spread-out wings. (9) Paired: a homeodomain transcription factor required for the development of the male accessory gland. Genetic tests directed at each of these factors are needed to determine whether they alone or together contribute to the regulation of MnSOD.

Trans-regulation of oxidative stress response at an organism-wide level is documented at many taxonomic levels. In bacteria, SodA (MnSOD) is regulated by the OxyR transcriptional activator and superoxide response (SoxRS) regulatory proteins (Wu & Weiss, 1992), as well as through networks of regulatory proteins (Storz & Imlay, 1999). Stress activates MnSOD transcription in the yeast Schizosaccharomyces pombe through the Wis1-Spc1 MAPK signal transduction cascade. Spc1 MAPK regulates a variety of trans-regulatory factors including Atf1, Pap1 and Pcr-1, each in response to different stress conditions (Jeong et al., 2001). Organism-wide analysis of cDNA microarrays for Arabidopsis thaleana likewise shows that the oxidative stress response is broadly integrated; 62 cDNAs are repressed and 113 cDNAs induced during the response (Desikan et al., 2001). In C. elegans, expression of the MnSOD gene is mediated by the insulin signalling pathway; long-lived mutant alleles of daf-2 are associated with elevated MnSOD transcripts (Honda & Honda, 1999). Our observations in Drosophila indicate that when studied at the genomic level, a variety of molecular factors may be involved in the regulation of MnSOD.

The potential organism-wide regulators of MnSOD in D. melanogaster revealed by our genomic screen did not coincide with any of the MnSOD regulators described by cellular studies. The tested deficiency regions may contain elements for novel regulatory pathways of the stress response, or new factors that interact with established elements of MnSOD regulation. To determine the specific factors responsible for organism-wide MnSOD regulation in D. melanogaster requires more detailed mapping of the genomic intervals with overlapping deficiencies to produce independent and more narrowly specified candidate cytological regions. Replication with deficiency chromosomes and across different genetic backgrounds will further specify and confirm which factors are most likely to play the central roles in organism-wide regulation of MnSOD, especially in the context of whole animal aging.

Experimental procedures

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgments
  8. References

Drosophila cultures and deficiencies

Flies were maintained in standard cornmeal, sugar and agar medium at 23 ± 1 °C. All Drosophila stocks were obtained from the Bloomington Drosophila Fly Stock Center (http://flybase.bio.indiana.edu). Stocks containing the genomic deletions (149 strains of the ‘deficiency kit’) are maintained as heterozygotes against an appropriate balancer chromosome. All analyses were conducted in these stock-defined states including balancers.

mRNA measurement

Total RNA was prepared with Trizol (Invitrogen Inc., CA, USA) from ∼30 adult flies per experimental group aged 0–4 days. From each extraction, reverse transcription (RT) followed by PCR was carried out for MnSOD and for ribosomal protein-49 (rp49) (Guo et al., 2000; Rikhy et al., 2002). Extraction and RT-PCR were independently replicated for each deficiency strain. First strand synthesis was achieved using 1.0 µg total RNA, with each reaction carrying one of the following primers: 5′GGGACGCACGTTCTTGTACT3′ (MnSOD reverse primer) or 5′TTCCGACCACGTTACAAGAA3′ (rp49 reverse primer). Following the termination of RT reaction (75 °C for 5 min), 1.0 µL of the RT-product from each reaction was used in separate PCR reactions; one carrying an MnSOD forward primer 5′AAGCTGCCCTACGACTATGC3′ and the second with the rp49 forward primer 5′AGCTTCAAGATGACCATCCG3′. PCR was carried out for 25 cycles. Expected sizes of the RT-PCR products were 504 bp for MnSOD and 452 bp for rp49, respectively.

Northern blots were quantified from digital gel images with Kodak 1D gel software. The band peak intensities for MnSOD and rp49 were measured in luminosity values after compensation for the gel background.

Statistical analysis

Log10-transformed values of luminosity intensity (I) of MnSOD were normalized against those of rp49 and represented as a dimensionless ratio (log10IMnSOD/log10Irp49). Transformation reduces the positive correlation between error variance and magnitude of luminosity ratios (Nadon & Shoemaker, 2002). Significant effects of a deficiency on MnSOD will produce luminosity ratios that exceed those expected by chance when the distribution of ratios only reflects environmental and error variance (the null distribution). Because most deletions are expected to produce no genetic effects upon the relative expression of MnSOD to rp49, to estimate the null distribution, we bootstrapped 5000 samples from the observed data (Resample version 1.3; howell, 2002). From the standard error of the estimated null distribution (log transformed), we estimated the standard deviation (SD) and set the upper and lower bounds for the 95% confidence intervals as 2SD. The luminosity ratio of a deletion line exceeding these limits is considered to represent modification of MnSOD expression (Campbell & Heyer, 2002).

Paraquat sensitivity test and longevity assay

Ten cohorts of five males and five females (adult age 0–4 days) each were fed 10 mm paraquat solution dissolved in 1% sucrose soaked on filter pads (Whatman 3 mm). Survival was censused at 12-h intervals. Control flies were treated with 1% sucrose solution without paraquat.

Acknowledgments

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgments
  8. References

Special thanks are due to Ms Mukta Kundu and Mr Sylvester Louis for their help and assistance in this work. We are indebted to Professor William R. Eckberg for critical reading of the manuscript. The work was supported by grants from NIH (1 R15 AG17846-01) and the American Federation for Aging Research (AFAR) to A.D.

References

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgments
  8. References
  • Borello S, Demple B (1997) NF-κB-independent transcriptional induction of the human manganous superoxide dismutase gene. Arch. Biochem. Biophys. 348, 289294.
  • Borg LAH, Cagliero E, Sandler S, Welsh N, Eizirik DL (1992) Interleukin-1b increases the activity of superoxide dismutase in rat pancreatic islets. Endocrinology 130, 28512857.
  • Campbell AM, Heyer LJ (2002) Discovering Genomics, Proteomics and Bioinformatics. Cold Spring Harbor: Cold Spring Harbor Laboratory Press.
  • Das KC, Lewis-Molock Y, White CW (1995) Activation of NF-kB and elevation of MnSOD gene expression by thiol reducing agents in lung adenocarcinoman (A549) cells. Am. J. Physiol. 269, L588L602.
  • Desikan R, Soheila AH, Hancock JT, Neil SJ (2001) Regulation of the Arabidopsis transcriptome by oxidative stress. Plant Physiol. 127, 159172.
  • Duttaroy A, Meidinger R, Kirby K, Carmichael S, Hilliker A, Phillips JP (1994) A manganese superoxide dismutase-encoding cDNA from Drosopohila melanogaster. Gene 143, 223225.
  • Duttaroy A, Parkes T, Emtage P, Kirby K, Boulianne GL, Wang X, Hilliker AJ, Phillips JP (1997) The manganese superoxide dismutase gene of Drosophila: structure, expression and evidence for regulation by MAP kinase. DNA Cell Biol. 16, 391399.
  • Finkel T, Holbrook NJ (2000) Oxidants, oxidative stress, and the biology of aging. Science 408, 239247.
  • Flybase (1996) Flybase: the Drosophila database. Nucl. Acids Res. 24, 5356.
  • Guo H-F, Tong J, Hannan F, Luo L, Zhong Y (2000) A neurofibromatosis-1 regulated pathway is required for learning in Drosophila. Nature 403, 895989.
  • Honda Y, Honda S (1999) The daf-2 gene network for longevity regulates oxidative stress and Mn-superoxide dismutase gene expression in C. elegans. FASEB J. 3, 13851393.
  • Jeong JH, Kwon ES, Roe JH (2001) Characterization of the manganese-containing superoxide dismutase and its gene regulation in stress response of Schizosaccharomyces pombe. Biochem. Biophys. Res. Commun. 283, 908914.
  • Jones PL, Kucera G, Gordon H, Boss JM (1995) Cloning and characterization of the murine manganous superoxide dismutase-encoding gene. Gene 153, 155161.
  • Jones PL, Ping D, Boss JM (1997) Tumor necrosis factor alpha and interleukin 1B regulate murine manganese superoxide dismutase gene through a complex intronic enhancer involving C/EBP B and NF-kB. Mol Cell Biol. 17, 69706981.
  • Lebovitz RM, Zhang H, Vogel H, Cartwright J, Dionne L, Lu N, Huang S, Matzuk MM (1996) Neurodegeneration, myocardial injury, and perinantal death in mitochondraial superoxide dismutase-deficient mice. Proc. Natl Acad. Sci. USA 93, 97829787.
  • Li Y, Huang T-T, Carlson EJ, Melov S, Ursell P, Olson JL, Noble LJ, Yoshimura MP, Christoph B, Chan PH, Wallace DC, Epstein CJ (1995) Dilated cardiomyopathy and neonatal lethality in mutant mice lacking manganese superoxide dismutase. Nature Genet. 11, 376381.
  • Manna SK, Zhang HJ, Yan T, Oberley LW, Agarwal BB (1998) Overexpression of manganese superoxide dismutase suppresses tumor necrosis factor induced apoptosis and activation of nuclear transcription factor-κB and activated protein −1. J. Biol. Chem. 273, 1324513254.
  • Masuda A, Longo DL, Kobyashi Y, Appella E, Oppenheim JJ, Matsusima K (1988) Induction of mitochondrial manganese superoxide dismutase by interleukin-1. FASEB J. 2, 30873091.
  • McCall K, Steller H (1997) Facing death in the fly: genetic analysis of apoptosis in Drosophila. Trends Genet. 13, 222226.
  • Melov S, Doctrow SR, Schneider JA, Haberson J, Patel M, Coskun PE, Huffman K, Wallace DC, Malfroy B (2001) Lifespan extension and rescue of spongiform encephalopathy in superoxide dismutase 2 nullizygous mice treated with superoxide dismutase-catalase mimetics. J. Neurosci. 21, 83488353.
  • Melov S, Ravenscroft J, Malik S, Gill MS, Walker DW, Clayton PE, Wallace DC, Malfroy B, Doctrow SR, Lithgow GJ (2000) Extension of life-span with superoxide dismutase/catalase mimetics. Science 289, 15671569.
  • Nadon R, Shoemaker J (2002) Statistical issues with microarrays: processing and analysis. Trends Genet. 18, 265271.
  • Nicholls RE, Gelbert WM (1998) Identification of chromosomal regions involved in decapentaplegic function in Drosophila. Genetics 149, 203215.
  • Oury TD, Chang LY, Marklund SL, Day BJ, Crapo JD (1994) Immunocytochemical localization of extracellular superoxide dismutase in human lung. Lab. Invest. 70, 889898.
  • Phillips JP, Campbell SD, Michaud D, Charbonneau M, Hilliker AJ (1989) A null muttaion of cSOD in Drosophila confers hypersensitivity to paraquat and reduced longevity. Proc. Natl Acad. Sci. USA 86, 27612765.
  • Rikhy R, Rikhy R, Kumar V, Mittal R, Krishnan KS (2002) Endophilin is critically required for synapse formation and function in Drosophila melanogaster. J. Neurosci. 22, 74787484.
  • Sen CK, Packer L (1996) Antioxidant and redox regulation of gene expression. FASEB J. 10, 709720.
  • Sohal RS, Weindruch R (1996) Oxidative stress, caloric restriction, and aging. Science 273, 5963.
  • St. Clair DK, Porntadavity S, Xu Y, Kiningham K (2002) Transcriptional regulation of human manganese superoxide dismutase gene. Meth. Enzymol. 349, 306312.
  • Storz G, Imlay JA (1999) Oxidative stress. Curr. Opin. Microbiol. 2, 188194.
  • Sun J, Folk D, Bradley TJ, Tower J (2002) Induced overexpression of mitochondrial Mn-superoxide dismutase extends the life span of adult Drosophila melanogaster. Genetics 16, 661672.
  • Tanaka H, Matsumara I, Ezoe S, Satoh Y, Sakamaki T, Albanese C, Machii T, Pestell R, Kanakura Y (2002) E2F1 and c-Mys potentiate apoptosis through inhibition of NF-kB activity that facilitates MnSOD-mediated ROS elimination. Mol. Cell 9, 10171029.
  • Tsan MF, White JE, Del Vecchio PJ, Shaffer JB (1992) IL-6 enhances TNF-alpha- and IL-1-induced increase of Mn superoxide dismutase mRNA and O2 tolerance. Am. J. Physiol. 263, L22L26.
  • Visner GA, Wallace DC, Wilson JM, Burr IA, Nick HS (1990) Regulation of manganese superoxide dismutase by lipopolysaccharide, interleukin-1, and tumor necrosis factor. Role in the acute inflammatory response. J. Biol. Chem. 265, 28562864.
  • Wallace DC (2001) Mouse models for mitochondrial disease. Am. J. Med. Genet. 106, 7193.
  • White K, Grether ME, Abrams JM, Young L, Farrel K et al. (1994) Genetic control of programmed cell death in Drosophila. Science 264, 677683.
  • Wong GHW, Goeddel WD (1988) Induction of manganous superoxide dismutase by tumor necrosis factor: possible protective mechanism. Science 242, 941944.
  • Wu J, Weiss B (1992) Two-stage induction of the soxRS (superoxide response) regulon of Escherichia coli. J. Bacteriol. 174, 39153920.
  • Xu Y, Kiningham KK, Devalraja MN, Yeh CC, Majima H, Kasarskis EJ, St. Clair DK (1999) An intronic NF-kappaB element is essential for induction of the human manganese superoxide dismutase gene by tumor necrosis factor-alpha and interleukin-1beta. DNA Cell Biol. 18, 709722.