SEARCH

SEARCH BY CITATION

Keywords:

  • inflammatory bowel diseases;
  • interleukin-27 receptor;
  • dextran sulfate sodium;
  • colitis

Abstract

  1. Top of page
  2. Abstract
  3. Materials and Methods
  4. Results
  5. Discussion
  6. Acknowledgments
  7. References

Background: WSX-1, a component of the interleukin (IL)-27 receptor, is a novel class I cytokine receptor with homology to the IL-12 receptor β2 chain. Initially, WSX-1 signaling was reported to play an important role in the promotion of T helper-1 responses, but recent reports have revealed an anti-inflammatory property in WSX-1 signaling. In the present study, we investigated the role of IL-27/WSX-1 signaling in a murine colitis model, dextran sulfate sodium (DSS) colitis, by using WSX-1 knockout (KO) mice. Methods: First, we observed whether WSX-1 KO mice developed colitis spontaneously. Second, we induced DSS colitis in WSX-1 KO and wild-type (WT) mice. Results:WSX-1 KO mice were observed not to develop colitis spontaneously. The severity of DSS colitis was decreased in WSX-1 KO mice in comparison with WT mice in association with a reduced production of interferon-γ, IL-6, and tumor necrosis factor-α by lamina propria mononuclear cells from WSX-1 KO mice and the absence of T-bet expression in the colon from WSX-1 KO mice. Conclusions: This study revealed the inflammatory property of IL-27/WSX-1 signaling in intestinal inflammation. As a result, IL-27/WSX-1 signal pathway may thus be a promising candidate for the therapeutic intervention of human inflammatory bowel diseases such as Crohn's disease and ulcerative colitis.

The pathogenic mechanisms of inflammatory bowel disease (IBD) including Crohn's disease (CD) and ulcerative colitis (UC) have yet to be elucidated despite numerous studies in gastroenterology and mucosal immunology. Recent studies, however, have shown that T helper 1 (TH1) cytokines, such as interleukin-12 (IL-12), IL-18, and interferon-γ (IFN-γ), are upregulated in the gut of patients with CD, thereby demonstrating the activation of TH1 cells to likely be a major pathogenic mechanism in CD.1–5 In contrast, the T cell response pattern in UC is less well defined.

A novel cytokine receptor, WSX-1 was initially identified as a class I cytokine receptor with homology to the IL-12 receptor (IL-12R) β2 chain.6,7 WSX-1 expression is restricted to lymphoid tissues and it tends to be the highest in naïve T cells and natural killer (NK) cells. In an analysis of a Leishmania major infection model, WSX-1 knockout (KO) mice showed susceptibility to L major infection relative to wild-type (WT) mice, associated with an impaired IFN-γ production by naïve CD4+ T cells early in the infection.8 WSX-1 was thus revealed to play an essential role in the initiation of the TH1 response. Recently, IL-27, a newly identified IL-12-related heterodimeric cytokine, was shown to bind to WSX-1.9 IL-27 is composed of Epstein-Barr virus-induced gene 3 (EBI3), an IL-12 p40-related protein, and p28, an IL-12 p35-related protein. Because EBI3 and p28 are coexpressed in antigen-presenting cells (APCs), the source of IL-27, like IL-12, is thought to be APCs. We demonstrated that IL-27/WSX-1 signaling induces the phosphorylation of STAT1 and subsequent T-bet expression, followed by IL-12Rβ2 expression in naïve CD4+ T cells.10 These results indicate that IL-27/WSX-1 signaling plays a critical role in the initial TH1 commitment and such signaling acts before IL-12/IL-12R signaling to provide IL-12 responsiveness in naïve CD4+ T cells. Recent studies, however, have clarified that IL-27/WSX-1 signaling also negatively regulates the inflammatory processes. As a result, studies on Toxoplasma gondii infection,11Trypanosoma cruzi infection,12 and concanavalin A-induced hepatitis13 have demonstrated that WSX-1 plays a role in limiting the intensity and duration of T cell activation because WSX-1 KO mice developed lethal inflammatory diseases because of an overproduction of a group of proinflammatory cytokines. Because the role of IL-27/WSX-1 in intestinal inflammation has not yet been addressed, such pleiotropic characters of the IL-27/WSX-1 pathway prompted us to investigate whether IL-27/WSX-1 signaling plays an inflammatory or anti-inflammatory role in intestinal inflammation.

In the present study, we used an acute colitis model, dextran sulfate sodium (DSS) -induced colitis,14 to examine the role of WSX-1 in the development of intestinal inflammation by taking advantage of WSX-1 KO mice. WSX-1 KO mice developed a milder degree of colitis than WT mice and lamina propria mononuclear cells (LPMCs) from WSX-1 KO mice produced significantly lower amounts of IFN-γ, IL-6, and tumor necrosis factor-α (TNF-α) than those from WT mice. Moreover, the T-bet expression was absent in the colon of WSX-1 KO mice. These results suggest that IL-27/WSX-1 signaling is associated with an exacerbation of acute colonic inflammation.

Materials and Methods

  1. Top of page
  2. Abstract
  3. Materials and Methods
  4. Results
  5. Discussion
  6. Acknowledgments
  7. References

Animals

The generation of WSX-1 KO mice has been previously reported.8 Mice were maintained in a specific pathogen-free condition in our facility. Mice were backcrossed onto C57BL/6 background >12 times. Female WSX-1 KO mice, 8 to 10 weeks old, and their negative littermates (WT) were used for the experiments. All animal use adhered to the institutional regulations of Kyushu University.

Induction of Colitis

Colitis was induced by the oral administration of 0.5% (w/v) DSS (36-50 kDa, ICN Biochemicals, Aurora, Ohio) in drinking water for 14 days. In some experiments, mice were administered water without DSS for 14 days as a control. Body weight was determined every other day during the experimental period. Mice were killed on day 14. After mice were killed, blood was drawn from the heart and then the colon was removed from the abdomen.

Colonic Sample Preparation

We used the colonic length as a parameter for colonic inflammation because a significant reduction in the colonic length has been reported to be found in DSS colitis.15 After removal, the colon was mechanically cleaned and then the longitudinal length of colon was measured. Thereafter, a part of the distal and proximal colon was removed for histological analyses; the remaining part was used for the isolation of LPMCs.

Histology

Distal and proximal colon specimens were fixed in 10% formalin, embedded in paraffin, cut into sections, and stained with hematoxylin and eosin. We used a previously reported histological scoring system with a minor modification.16 Briefly, the histological score of each distal and proximal colon, with a range of 0 to 14, was assessed as the sum of 4 parameters as follows: the amount of inflammation, 0 to 3 (0, none; 1, slight; 2, moderate; 3, severe); extent of inflammation, 0 to 3 (0, none; 1, mucosa; 2, mucosa and submucosa; 3, transmural); regeneration, 0 to 4 (0, complete regeneration or normal tissue; 1, almost complete regeneration; 2, regeneration with crypt depletion; 3, surface epithelium not intact; 4, no tissue repair); crypt damage, 0 to 4 (0, none; 1, basal 1/3 damaged; 2, basal 2/3 damaged; 3, only surface epithelium intact; 4, entire crypt and epithelium lost). The total histological score represents the sum of the distal and proximal colon with a range of from 0 to 28.

Isolation and Culture of Mesenteric Lymph Node Cells and LPMCs

Mesenteric lymph nodes (MLNs) were removed from mice and the cells were isolated by grinding MLNs in a petri dish and then filtering the cell suspension through 40-μm mesh. LPMCs were isolated from the colon using a modified technique of Van der Heijden and Stok17 as described previously. The obtained MLN cells and LPMCs were suspended in complete medium consisting of RPMI 1640 (Sigma-Aldrich, Irvine, UK) supplemented with 10 mM Hepes buffer (Sigma-Aldrich), 10 μg/mL gentamycin, 100 U/mL penicillin, 100 μg/mL streptomycin, 0.05 mM 2-mercaptoethanol (Gibco BRL, Grand Island, NY), and 10% heat-inactivated fetal bovine serum (Cansera, Etobicoke, Canada) and then were cultured at a concentration of 5 × 105 cells/mL in 24-well culture plates (Corning Incorporated, Corning, NY) with stimulation by plate-bound anti-CD3ε antibody (145-2C11, eBioscience, San Diego, Calif), precoated at 10 μg/mL in carbonate buffer (pH 9.5) overnight at 4°C and 1 μg/mL of soluble anti-CD28 antibody (37.51, BD PharMingen, San Diego, Calif) for 48 hours.

Cytokine Assays

The supernatants of cell cultures described above were collected and assayed to determine their cytokine content (IFN-γ, IL-4, IL-6, and TNF-α) by enzyme-linked immunosorbent assay (ELISA) kits (eBioscience) according to the manufacturer's instructions. In addition, serum was assayed for IL-6 and TNF-α concentration by ELISA.

Reverse Transcription-Polymerase Chain Reaction (RT-PCR)

Colonic samples were removed from both WSX-1 KO and WT mice at various time points during the administration of DSS. Total RNA was extracted from colonic samples using a RNA purification kit (Qiagen, Valencia, Calif) and then was reverse transcribed using first-strand cDNA synthesis kit (Amersham Biosciences, Little Chalfont Buckinghamshire, UK). cDNA was used for PCR for IL-27 p28, EBI3, IFN-γ, TNF-α, T-bet, and glycerol aldehyde phosphate dehydrogenase (GAPDH). GAPDH expression was used as an internal control to ensure the equal loading of every reaction. The primers used were IL-27 p28 forward: CTGGTACAAGCTGGTTCCTG11; IL-27 p28 reverse: CTCCAGGGAGTGAAGGAGCT11; EBI3 forward: ACCCTCTCTCTGATGGGTCACTAA18; EBI3 reverse: AGAAAGATCATCCCACAGGGTTGG18; IFN-γ forward: TACTGCCACGGCACAGTCATTGAA19; IFN-γ reverse: GCAGCGACTCCTTTTCCGCTTCCT19; TNF-α forward: ATGAGCACAGAAAGCATGATC19; TNF-α reverse: TACAGGCTTGTCACTCGAATT19; T-bet forward: TGCCTGCAGTGCTTCTAACA20; T-bet reverse: TGCCCCGCTTCCTCTCCAACCAA20; GAPDH forward: CGGAGTCAACGGATTTGGTCGTAT19; GAPDH reverse: AGCCTTCTCCATGGTGGTGAAGAC.19

Statistics

Results are expressed as the mean ± SEM. Student's t test was used for statistical analyses. Differences were considered to be statistically significant when P < 0.05.

Results

  1. Top of page
  2. Abstract
  3. Materials and Methods
  4. Results
  5. Discussion
  6. Acknowledgments
  7. References

WSX-1 KO Mice Did Not Develop Spontaneous Colitis

Although IL-27/WSX-1 signaling has been reported to play a critical role in the initial TH1 commitment,8 recent studies have revealed the possibility that IL-27/WSX-1 signaling plays an anti-inflammatory role in the immune system.11–13 The disregulation of pro-and anti-inflammatory cytokine production may result in the development of chronic spontaneous enterocolitis. As a result, we investigated whether WSX-1 KO mice develop spontaneous colitis. WSX-1 KO mice and WT mice were maintained in our facility for 14 months. WSX-1 KO mice were raised normally, as were WT mice. Mice of both groups were then killed and the colons were examined. There was no difference between WSX-1 KO and WT mice regarding macroscopic appearance of the colons (Fig. 1, A). In histological analyses of colons, WSX-1 KO mice did not develop colitis spontaneously in the same manner as WT mice (Fig. 1, B). We next analyzed the cytokine profile of both WSX-1 KO and WT mice by measuring the production of IFN-γ and IL-4 by MLN cells as representative cytokines of TH1 and TH2, respectively, using the specific ELISA. As a result, no significant difference in TH1 and TH2 cytokine balance was observed between the 2 groups (Fig. 1, C).

thumbnail image

Figure 1. WSX-1 KO mice did not develop colitis spontaneously. A, Macroscopic appearance of the colons from WT and WSX-1 KO mice. B, Representative microscopic appearance of colons from WT and WSX-1 KO mice. C, IFN-γ and IL-4 production by MLN cells. MLN cells from WT and WSX-1 KO mice were stimulated with plate-bound anti-CD3 plus soluble anti-CD28 antibody for 48 hours. Culture supernatants were collected and the production of IFN-γ and IL-4 were determined by ELISA. N.S., not significant. Data shown are mean ± SEM of 5 mice and representative of 2 independent experiments.

Download figure to PowerPoint

WSX-1 Is Required for the Development of DSS Colitis

To further assess the role of IL-27/WSX-1 in the development and regulation of intestinal inflammation, we used an experimental murine colitis model, DSS colitis. First, we carried out experiments to determine whether the intestinal inflammation induced by DSS results in an increased expression of IL-27. DSS colitis was induced in WT mice, and RT-PCR was used to measure the levels of mRNA for IL-27 p28 and EBI3 in the colon. The levels of mRNA for both IL-27 p28 and EBI3 as well as those of IFN-γ and TNF-α were upregulated on days 7 and 14 (Fig. 2).

thumbnail image

Figure 2. IL-27 mRNA expression in DSS colitis. WT mice were induced for DSS colitis. RT-PCR was used to assess expression levels of mRNA for IL-27 p28, EBI3, TNF-α, IFN-γ, and GAPDH. Samples were taken on days 0, 7, and 14 (n = 3 mice/group). All experiments were performed 2 times with similar results.

Download figure to PowerPoint

To determine the significance of this increase of IL-27 in the murine colon induced by DSS, either DSS or water without DSS was thus orally administered to WSX-1 KO and WT mice. WT and WSX-1 KO mice that received water without DSS had no weight loss, diarrhea, or hematochezia (data not shown). DSS-treated WT mice showed a body weight loss from day 9 and bloody diarrhea, whereas DSS-treated WSX-1 KO mice had a significantly milder body weight loss and less hematochezia (Fig. 3, A; data not shown). We killed mice from all groups on day 14 and assessed the colonic length as a parameter of colitis. The colonic length of DSS-treated WSX-1 KO mice was significantly longer than that of DSS-treated WT mice (WT; 69.2 ± 1.2 mm versus KO; 76.6 ± 1.2 mm) and there was no difference in the colonic length between water-treated WT mice and water-treated WSX-1 KO mice (Fig. 3, B). A histological examination revealed much more severe inflammation and more crypt damage in the colons of DSS-treated WT mice than those in DSS-treated WSX-1 KO mice (Fig. 3, C). Water-treated WT or WSX-1 KO mice had no histological findings in the colons (data not shown). The histological scores of DSS-treated WSX-1 KO mice were significantly lower than DSS-treated WT mice (WT; 15.5 ± 2.3 versus KO; 7.0 ± 2.4; Fig. 3, D).

thumbnail image

Figure 3. DSS colitis was reduced in WSX-1 KO mice. A, Body weight curves after the induction of DSS colitis. Weight loss significantly decreased in DSS-treated WSX-1 KO mice in comparison with DSS-treated WT mice on days 9, 11, and 13. B, Shortening of the colon by intestinal inflammation decreased significantly in DSS-treated WSX-1 KO mice in comparison with DSS-treated WT mice. C, Microscopic appearance of the colons from WT and WSX-1 KO mice 14 days after the induction of DSS colitis. D, Histological score of colitis was significantly lower in DSS-treated WSX-1 KO mice than in DSS-treated WT mice. The total histological score represents the sum of the distal and proximal colon ranging from 0 to 28. All experiments were performed 2 times with similar results.

Download figure to PowerPoint

These data strongly suggested that IL-27/WSX-1 signal is required for the development of DSS colitis.

Decreased Inflammatory Cytokine Production of WSX-1 KO Mice in DSS Colitis

To confirm the possible contribution of the cytokine production to the difference in colitis severity between WT and WSX-1 KO mice, we examined the cytokine production in vitro by colonic LPMCs and MLN cells. LPMCs from WT and WSX-1 KO mice were stimulated in vitro with anti-CD3ε antibody and anti-CD28 antibody for 48 hours, and the amounts of IFN-γ, IL-4, IL-6, and TNF-α produced in the culture supernatants were assessed by ELISA. As shown in, Figure 4A, LPMCs from DSS-treated WSX-1 KO mice produced significantly lower amounts of IFN-γ than those from DSS-treated WT mice (WT; 1510.2 ± 140.7 pg/mL versus KO; 114.1 ± 12.1 pg/mL). IFN-γ produced by colonic LPMCs from water-treated WT and WSX-1 KO mice was not detected. Similarly, MLN cells from DSS-treated WSX-1 KO mice produced significantly lower amounts of IFN-γ than those from DSS-treated WT mice (WT; 18.8 ± 2.4 ng/mL versus KO; 10.7 ± 1.4 ng/mL, Fig. 4, B). No significant difference was observed between the IFN-γ production by MLN cells from water-treated WT and water-treated WSX-1 KO mice (Fig. 4, B). LPMCs from DSS-treated WSX-1 KO mice also produced significantly lower amounts of IL-6 (WT; 1164.1 ± 49.8 pg/mL versus KO; 150.2 ± 6.4 pg/mL, Fig. 5, A) and TNF-α (WT; 272.2 ± 5.7 pg/mL versus KO; 33.0 ± 1.5 pg/mL, Fig. 5, B) compared with those from DSS-treated WT mice. In addition, no IL-6 and TNF-α produced by colonic LPMCs from water-treated WT and WSX-1 KO mice was detected (data not shown), and no IL-4 produced from LPMCs was detected in any group (data not shown).

thumbnail image

Figure 4. The reduced IFN-γ production by LPMCs and MLN cells of WSX-1 KO mice in DSS colitis. The IFN-γ production by LPMCs and MLN cells from WSX-1 KO mice significantly decreased in comparison with WT mice after the induction of DSS colitis. Colonic LPMCs and MLN cells from DSS-or water-treated WT and WSX-1 KO mice were stimulated with plate-bound anti-CD3 plus soluble anti-CD28 antibody for 48 hours. Culture supernatants were collected and the production of IFN-γ by LPMCs (A) and MLN cells (B) were determined by ELISA. Data shown are the mean ± SEM of 5 mice and they are representative of 2 independent experiments. N.D., not detected.

Download figure to PowerPoint

thumbnail image

Figure 5. Reduced IL-6 and TNF-α production by LPMCs of WSX-1 KO mice in DSS colitis. IL-6 and TNF-α production by LPMCs from DSS-treated WSX-1 KO mice significantly decreased in comparison with DSS-treated WT mice. Colonic LPMCs from WT and WSX-1 KO mice were stimulated with plate-bound anti-CD3 plus soluble anti-CD28 antibody for 48 hours. Culture supernatants were collected and the production of IL-6 (A) and TNF-α (B) were determined by ELISA. Data shown are the mean ± SEM of 5 mice and they are representative of 2 independent experiments.

Download figure to PowerPoint

The serum IL-6 and TNF-α levels were also measured by ELISA. As shown in Figure 6, the serum levels of both cytokines in DSS-treated WSX-1 KO mice were significantly lower than those of DSS-treated WT mice. Serum IL-6 and TNF-α of water-treated WT and WSX-1 KO mice were not detected (data not shown).

thumbnail image

Figure 6. Reduced serum cytokine levels of WSX-1 KO mice in DSS colitis. The serum IL-6 and TNF-α levels were measured by ELISA 14 days after the induction of DSS colitis. Significant decreases of the serum IL-6 and TNF-α levels were observed in DSS-treated WSX-1 KO in comparison with DSS-treated WT mice. Data shown are the mean ± SEM of 5 mice and they are representative of 2 independent experiments.

Download figure to PowerPoint

These data indicated that WSX-1 signaling contributes to intestinal inflammation through the cytokine production of IFN-γ, IL-6, and TNF-α in DSS colitis.

Decreased T-bet Expression of WSX-1 KO Mice in DSS Colitis

We next examined the T-bet mRNA expression in the colon of WT and WSX-1 KO mice by RT-PCR analysis to clarify whether the reduction of the IFN-γ expression in DSS-treated WSX-1 KO mice was caused by the failure of the induction of T-bet by the lack of WSX-1-mediated STAT1 activation. As shown in Figure 7, the expression of T-bet was reduced in the colon of DSS-treated WSX-1 KO mice compared with DSS-treated WT mice. IL-27/WSX-1 signaling, which induces T-bet expression and then IFN-γ production of T cells, is considered to contribute to an exacerbation of DSS colitis.

thumbnail image

Figure 7. The decreased T-bet mRNA expression of WSX-1 KO mice in DSS colitis. Total RNAs extracted from the colons of WT and WSX-1 KO mice administered either DSS or water (on day 14) were examined to determine the expression levels of T-bet and GAPDH by RT-PCR analysis (n = 3 mice/group). Data are representative of 2 independent experiments.

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Abstract
  3. Materials and Methods
  4. Results
  5. Discussion
  6. Acknowledgments
  7. References

This is the first study to clarify the role of IL-27/WSX-1 signaling in intestinal inflammation. We showed that IL-27/WSX-1 signaling is associated with an exacerbation of acute intestinal inflammation. We demonstrated that IL-27 (IL-27 p28 and EBI3) mRNA increased in the colon of DSS-treated WT mice and that DSS-treated WSX-1 KO mice developed milder colitis than did DSS-treated WT mice. These data indicate that IL-27/WSX-1 signaling contributes to an exacerbation of intestinal inflammation in murine DSS colitis. Such an exacerbation seems to be dependent on inducing the T-bet expression and the subsequent IFN-γ production, followed by TNF-α and IL-6 production, as our study showed that LPMCs from DSS-treated WSX-1 KO mice produced significantly lower amounts of IFN-γ, IL-6, and TNF-α than those from DSS-treated WT mice and T-bet expression was reduced in the colon of DSS-treated WSX-1 KO mice. The immunological property of IL-27/WSX-1 signaling is known to be pleiotropic as it can be both inflammatory and anti-inflammatory. That is, IL-27/WSX-1 plays an essential role in the early phase of TH1 differentiation under some conditions,8 whereas it acts as a regulator of the excessive immune reactions under other conditions.11,12 In this study, we, for the first time, clarified that IL-27/WSX-1 signal has some inflammatory property and therefore plays a role in the development of intestinal inflammation, at least in the DSS-induced colitis model. The reason why IL-27/WSX-1 plays such different roles depending on the conditions is still not fully understood, although the differential usage of signal-transducing molecules has been implied.21 In the DSS colitis model, reduced inflammation is associated with less IFN-γ production as seen in an L major infection model.8 We assume that the production of IL-6 and TNF-α and inflammation/tissue damage is secondary to IFN-γ production.

In the present study, MLN cells from both WT and WSX-1 KO mice, which were administered water without DSS, produced high levels of IFN-γ. This seems to conflict with the findings of our previous study,8 but it can be explained as follows. In a previous study, Yoshida et al showed that popliteal lymph node cells of WSX-1 KO mice failed to produce INF-γ in the early phase of L major infection, whereas they produced the same levels of IFN-γ as WT lymph node cells in the late phase.8 In these experiments, CD4+ T cells were stimulated with L major antigen and APCs. In the present study, whole MLN cells were stimulated with anti-CD3 and anti-CD28. It is, therefore, considered that MLN lymphocytes from water-treated WSX-1 KO mice, which have been persistently exposed to luminal antigens, are able to produce IFN-γ just like WT cells at least in the presence of IL-12 produced by the surrounding APC populations. In contrast to MLN cells, LPMCs from water-treated WT and WSX-1 KO mice did not produce any detectable levels of IFN-γ. We consider this difference in IFN-γ production to be the result of the difference in cell types, because MLNs contain effector cells induced by the continuous stimulation with luminal antigens and LPMCs are known to be hyporesponsive to stimulation through T cell receptors. It seems that MLN cells from older water-treated mice (Fig. 1, C; 14 months old) produced much larger amounts of IFN-γ than those from younger water-treated mice (Fig. 4, B; 8 weeks old), probably because MLN cells in the older mice were exposed to luminal antigens for long periods of time. After the administration of DSS, MLN cells from WSX-1 KO mice failed to produce a larger amount of IFN-γ than those from the water-treated mice, whereas MLN cells from DSS-treated WT mice produced significantly higher levels of this cytokine. Similarly, although LPMCs from water-treated mice of both genotypes did not produce detectable levels of IFN-γ, in contrast to MLN cells, LPMCs from DSS-treated WT mice produced significantly higher amounts of IFN-γ than the cells from DSS-treated WSX-1 KO mice. These results indicate generation of colitogenic TH1 cells by the administration of DSS to be attenuated in the absence of IL-27/WSX-1 signaling.

DSS colitis is an established, well-characterized experimental murine colitis model. The administration of DSS dissolved in water to mice has been shown to cause hematochezia, body weight loss, a shortening of the large intestine, mucosal ulcers, and an infiltration of neutrophils.14 The oral administration of DSS activates nonlymphoid cells such as macrophages to release proinflammatory cytokines. Because DSS colitis occurs in mice lacking T cells, B cells, and NK cells,22,23 T cell-mediated immunity is not essential for the induction of DSS colitis. T cell-mediated immunity, more specifically TH1 response, is activated in this model, however, because TH1 cytokines such as IL-12 and IFN-γ are upregulated in DSS colitis.24 IL-12 p35-deficient mice fed DSS have been reported to develop milder colitis associated with reduced IFN-γ and TNF-α production by LPMCs.25 Therefore, TH1-biased T cell-mediated immunity is considered to significantly influence an exacerbation of inflammation in this model. Our results clearly demonstrated that IL-27/WSX-1 signaling played an important role in the exacerbation of DSS colitis by the augmentation of TH1 responses and the subsequent proinflammatory cytokine production.

Sensitivity to DSS varies among mouse strains.26 C57BL/6 mice are one of the sensitive strains to DSS and severe colonic inflammation can be induced using doses of DSS as low as 1% to 3% (w/v). In a pilot study, we administered 3%, 2%, and 1% (w/v) DSS to WT mice and WSX-1 KO mice for 7 days to set a suitable concentration. Severe colitis was induced under each condition. Although we found a lower IFN-γ production of LPMCs from DSS-treated WSX-1 KO mice in comparison with DSS-treated WT mice, the clinical and histological differences between WT and WSX-1 KO mice were less evident (data not shown). We also tried 0.5% (w/v) DSS administration, and observed more obvious differences both clinically and histologically. At this dose of DSS, the development of colitis seemed to be slower than with usual doses, and WT mice began to show clinical manifestations after day 7. As a result, in the present study, we administered a lower dose (0.5%) of DSS for a longer period of time (14 days) than the conventional protocols of DSS-induced colitis. In the high-dose DSS protocol, macrophages may be highly activated and thus produce large amounts of proinflammatory cytokines such as TNF-α and IL-6, and severe intestinal inflammation is induced. The influence of TH1 response may be masked by the severe storm of proinflammatory cytokines. In contrast, in the low-dose DSS protocol, the first activation of macrophages may be weak and intestinal inflammation may be influenced by subsequent TH1 activation more clearly and directly. Some investigators analyze DSS-induced colitic animals in the recovery period. In such experiments, the induction with DSS is followed by an analysis of the recovery period after returning to regular drinking water. We tried this protocol (2% DSS in drinking water for 5 days, followed by drinking water without DSS for 7 days) and did not find any obvious clinical and histological differences between WT and WSX-1 KO mice during the recovery period (data not shown).

In CD, the local immune response is predominantly TH1 and it is reflected by the local release of cytokines such as TNF-α, IFN-γ, IL-12, and IL-18.1–5 Recently, Matsuoka et al reported that the T-bet expression of CD4+ LPMCs in CD increased and the T-bet induction correlated with the IFN-γ production and augmentation of the surface expression of IL-12Rβ2 before IL-12 signaling for enhanced IFN-γ production,27 thus suggesting that T-bet may not only initiate IFN-γ production but also control the responsiveness to IL-12. As we reported previously, IL-27/WSX-1 signaling induces the phosphorylation of STAT1 and leads to T-bet induction, followed by IL-12Rβ2 expression in naïve CD4+ T cells.10 In this regard, it is possible that IL-27/WSX-1 signaling plays an important role in the T-bet induction in CD. As a result, IL-27/WSX-1 presumably plays an important role in a vicious cycle, in which IL-27/WSX-1-mediated TH1 polarization of T cells leads to a greater IFN-γ production followed by more inflammation/tissue damage and the subsequent greater macrophage activation results in an increased IL-27 and IL-12 production in the intestines of CD patients. Larousserie et al demonstrated that EBI3 and p28 were coexpressed in the granulomas infiltrating the intestinal wall or the MLNs of CD patients.28 The local production of IL-27 in the inflamed tissues in CD may thus be a critical mechanism in the initiation of CD. Clinically, anti-human TNF-α monoclonal antibody (infliximab) is effective for many patients with CD refractory to conventional therapy.29 The effectiveness of other cytokine-targeted treatments, for example, a humanized anti-IL-12 monoclonal antibody,30 has been examined in CD. Likewise, IL-27/WSX-1 signaling-targeted treatment may also be a new approach for the treatment of CD.

In UC, another IBD in which the upregulation of TH2 cytokine expression such as IL-4 and IL-5 has been reported,31,32 the T cell response pattern has been less well defined than in CD. In addition, the role of IL-27/WSX-1 signaling is unclear in UC. Mice deficient for EBI3, one of the IL-27 components, showed an impaired ability to mount a TH2 response and such mice were resistant to oxazolone colitis, which resembles human UC.33 Clinically, there have been some reports on EBI3 expression in UC patients. An elevated level of EBI3 expression was reported in mucosal samples of UC compared with CD.34,35 From the results of oxazolone colitis in EBI3-deficient mice, it is possible that the upregulation of EBI3 in UC is related to an exacerbation of intestinal inflammation. As a result, IL-27/WSX-1 signaling may also be important for establishing the immunopathology of UC. Further studies will be necessary to clarify the relevance of IL-27/WSX-1 signaling in UC.

In conclusion, the results in the present study demonstrated that IL-27/WSX-1 signaling is associated with an exacerbation of intestinal inflammation by inducing the T-bet expression followed by the local production of IFN-γ, IL-6, and TNF-α. The modulation of IL-27/WSX-1 signaling therefore appears to be an attractive target for therapeutic intervention in human IBD, such as CD and UC.

Acknowledgments

  1. Top of page
  2. Abstract
  3. Materials and Methods
  4. Results
  5. Discussion
  6. Acknowledgments
  7. References

The authors would like to thank Akiyo Kondo for technical help and the members of “Project W” for their valuable discussions.

References

  1. Top of page
  2. Abstract
  3. Materials and Methods
  4. Results
  5. Discussion
  6. Acknowledgments
  7. References
  • 1
    MacDonald TT, Hutchings P, Choy MY, et al. Tumor necrosis factor-alpha and interferon-gamma production measured at the single cell level in normal and inflamed human intestine. Clin Exp Immunol. 1990; 81: 301305.
  • 2
    Niessner M, Volk BA. Altered Th1/Th2 cytokine profiles in the intestinal mucosa of patients with inflammatory bowel disease as assessed by quantitative reversed transcribed polymerase chain reaction (RT-PCR). Clin Exp Immunol. 1995; 101: 428435.
  • 3
    Monteleone G, Biancone L, Marasco R, et al. Interleukin 12 is expressed and actively released by Crohn's disease intestinal lamina propria mononuclear cells. Gastroenterology. 1997; 112: 11691178.
  • 4
    Pizarro TT, Michie MH, Bentz M, et al. IL-18, a novel immunoregulatory cytokine, is up-regulated in Crohn's disease: expression and localization in intestinal mucosal cells. J Immunol. 1999; 162: 68296835.
  • 5
    Fais S, Capobianchi MR, Pallone F, et al. Spontaneous release of interferon gamma by intestinal lamina propria lymphocytes in Crohn's disease. Kinetics of in vitro response to interferon gamma inducers. Gut. 1991; 32: 403407.
  • 6
    Sprecher CA, Grant FJ, Baumgartner JW, et al. Cloning and characterization of a novel class I cytokine receptor. Biochem Biophys Res Commun. 1998; 246: 8290.
  • 7
    Chen Q, Ghilardi N, Wang H, et al. Development of Th1-type immune responses requires the type I cytokine receptor TCCR. Nature. 2000; 407: 916920.
  • 8
    Yoshida H, Hamano S, Senaldi G, et al. WSX-1 is required for the initiation of Th1 responses and resistance to L. major infection. Immunity. 2001; 15: 569578.
  • 9
    Pflanz S, Timans JC, Cheung J, et al. IL-27, a heterodimeric cytokine composed of EBI3 and p28 protein, induces proliferation of naive CD4+ T cells. Immunity. 2002; 16: 779790.
  • 10
    Takeda A, Hamano S, Yamanaka A, et al. Role of IL-27/WSX-1 signaling for induction of T-bet through activation of STAT1 during initial Th1 commitment. J Immunol. 2003; 170: 48864890.
  • 11
    Villarino A, Hibbert L, Lieberman L, et al. The IL-27R (WSX-1) is required to suppress T cell hyperactivity during infection. Immunity. 2003; 19: 645655.
  • 12
    Hamano S, Himeno K, Miyazaki Y, et al. WSX-1 is required for resistance to Trypanosoma cruzi infection by regulation of proinflammatory cytokine production. Immunity. 2003; 19: 657667.
  • 13
    Yamanaka A, Hamano S, Miyazaki Y, et al. Hyperproduction of proinflammatory cytokines by WSX-1-deficient NKT cells in concanavalin A-induced hepatitis. J Immunol. 2004; 172: 35903596.
  • 14
    Okayasu I, Hatakeyama S, Yamada M, et al. A novel method in the induction of reliable experimental acute and chronic ulcerative colitis in mice. Gastroenterology. 1990; 98: 694702.
  • 15
    Kojouharoff G, Hans W, Obermeier F, et al. Neutralization of tumor necrosis factor (TNF) but not of IL-1 reduces inflammation in chronic dextran sulphate sodium-induced colitis in mice. Clin Exp Immunol. 1997; 107: 353358.
  • 16
    Dieleman LA, Palmen MJHJ, Akol H, et al. Chronic experimental colitis induced by dextran sulphate sodium (DSS) is characterized by Th1 and Th2 cytokines. Clin Exp Immunol. 1998; 114: 385391.
  • 17
    Van der Heijden PJ, Stok W. Improved procedure for the isolation of functionally active lymphoid cells from the murine intestine. J Immunol Methods. 1987; 103: 161167.
  • 18
    Bancroft AJ, Humphreys NE, Worthington JJ, et al. WSX-1: A key role in induction of chronic intestinal nematode infection. J Immunol. 2004; 172: 76357641.
  • 19
    Andres PG, Beck PL, Mizoguchi E, et al. Mice with a selective deletion of the CC chemokine receptors 5 or 2 are protected from dextran sodium sulfate-mediated colitis: Lack of CC chemokine receptor 5 expression results in a NK1.1+ lymphocyte-associated Th2-type immune response in the intestine. J Immunol. 2000; 164: 63036312.
  • 20
    Mullen AC, High FA, Hutchins AS, et al. Role of T-bet in commitment of TH1 cells before IL-12-dependent selection. Science. 2001; 292: 19071910.
  • 21
    Yoshida H, Hamano S, Miyazaki Y. The double identity of WSX-1 (IL-27R) as an initiator and an attenuator of immune responses. Current Immunol Rev. 2005; 1: 5560.
  • 22
    Dieleman LA, Ridwan BU, Tennyson GS, et al. Dextran sulfate sodium-induced colitis occurs in severe combined immunodeficient mice. Gastroenterology. 1994; 107: 16431652.
  • 23
    Axelsson LG, Landstrom E, Goldschmidt TJ, et al. Dextran sulfate sodium (DSS) induced experimental colitis in immunodeficient mice: effects in CD4(+)-T cell depleted, athymic and NK-cell depleted SCID mice. Inflamm Res. 1996; 45: 181191.
  • 24
    Egger B, Bajaj-Elliott M, MacDonald TT, et al. Characterisation of acute murine dextran sodium sulphate colitis: cytokine profile and dose dependency. Digestion. 2000; 62: 240248.
  • 25
    Takagi H, Kanai T, Okazawa A, et al. Contrasting action of IL-12 and IL-18 in the development of dextran sodium sulphate colitis in mice. Scand J Gastroenterol. 2003; 38: 837844.
  • 26
    Mahler M, Bristol IJ, Sundberg JP, et al. Genetic analysis of susceptibility to dextran sulfate sodium-induced colitis in mice. Genomics. 1999; 55: 147156.
  • 27
    Matsuoka K, Inoue N, Sato T, et al. T-bet upregulation and subsequent interleukin 12 stimulation are essential for induction of Th1 mediated immunopathology in Crohn's disease. Gut. 2004; 53: 13031308.
  • 28
    Larousserie F, Pflanz S, Coulomb-L'Herminé A, et al. Expression of IL-27 in human Th1-associated granulomatous diseases. J Pathol. 2004; 202: 164171.
  • 29
    Targan SR, Hanauer SB, van Deventer SJ, et al. A short-term study of chimeric monoclonal antibody cA2 to tumor necrosis factor α for Crohn's disease. N Engl J Med. 1997; 337: 10291035.
  • 30
    Mannon PJ, Fuss IJ, Mayer L, et al. Anti-interleukin-12 antibody for active Crohn's disease. N Engl J Med. 2004; 351: 20692079.
  • 31
    Fuss IJ, Neurath M, Boirivant M, et al. Disparate CD4+ lamina propria (LP) lymphokine secretion profiles in inflammatory bowel disease. Crohn's disease LP cells manifest increased secretion of IFN-γ, whereas ulcerative colitis LP cells manifest increased secretion of IL-5. J Immunol. 1996; 157: 12611270.
  • 32
    Inoue S, Matsumoto T, Iida M, et al. Characterization of cytokine expression in the rectal mucosa of ulcerative colitis: correlation with disease activity. Am J Gastroenterol. 1999; 94: 24412446.
    Direct Link:
  • 33
    Nieuwenhuis EES, Neurath MF, Corazza N, et al. Disruption of T helper 2-immune responses in Epstein-Barr virus-induced gene 3-deficient mice. Proc Natl Acad Sci USA. 2002; 99: 1695116956.
  • 34
    Christ AD, Stevens AC, Koeppen H, et al. An interleukin 12-related cytokine is up-regulated in ulcerative colitis but not in Crohn's disease. Gastroenterology. 1998; 115: 307313.
  • 35
    Omata F, Birkenbach M, Matsuzaki S, et al. The expression of IL-12 p40 and its homologue, Epstein-Barr virus-induced gene 3, in inflammatory bowel disease. Inflamm Bowel Dis. 2001; 7: 215220.