SEARCH

SEARCH BY CITATION

Keywords:

  • horizontal gene transfer;
  • natural transformation

ABSTRACT

  1. Top of page
  2. ABSTRACT
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. ACKNOWLEDGMENTS
  7. DISCLOSURE
  8. REFERENCES
  9. Supporting Information

Twelve Vibrio cholerae isolates with genes for a type III secretion system (T3SS) were detected among 110 environmental and 14 clinical isolates. T3SS-related genes were distributed among the various serogroups and pulsed-field gel electrophoresis of NotI-digested genomes showed genetic diversity in these strains. However, the restriction fragment length polymorphism profiles of the T3SS-related genes had similar patterns. Additionally, naturally competent T3SS-negative V. cholerae incorporated the ca. 47 kb gene cluster of T3SS, which had been integrated into a site on the chromosome by recombination. Therefore, it is suggested that horizontal gene transfer of T3SS-related genes occurs among V. cholerae in natural ecosystems.

List of Abbreviations
Cm

chloramphenicol

CT

cholera toxin

DASW

defined artificial seawater media

PFGE

pulsed-field gel electrophoresis

LB

Luria–Bertani

RFLP

restriction fragment length polymorphism

T3SS

type III secretion system

TBE, 45 mM Tris–HCl

45 mM boric acid and 1.0 mM EDTA

V. cholerae

Vibrio cholerae

V. parahaemolyticus

Vibrio parahaemolyticus

VPI-2

Vibrio pathogenicity island-2

Vibrio cholerae live ubiquitously in natural aquatic environments, such as rivers, estuaries and coastal waters. There more than 200 recognized serogroups, among which serogroup O1 and O139 strains are known to produce CT and cause epidemic cholera [1]. Many serogroups of non-O1, non-O139 V. cholerae can also cause mild or severe diarrhea; certain of these strains possess the ctxAB gene encoding CT [2-5], whereas others do not produce CT. The virulence determinants of non-O1, non-O139 V. cholerae without ctxAB have not been well characterized.

Gram-negative pathogenic bacteria have a T3SS that plays an important role in their pathogenesis [6]. Among Vibrio species, the genes for T3SS were first identified in V. parahaemolyticus, which encodes two sets of T3SS (T3SS1 and T3SS2) [7]. Thereafter, genomic sequencing of the non-O1, non-O139 V. cholerae strain AM-19226 revealed that V. cholerae carry T3SS genes related to V. parahaemolyticus T3SS2 in VPI-2 [8]. Additionally, in the infant mouse model T3SS in V. cholerae is needed for efficient intestinal colonization; the effector proteins have already been characterized [9-11]. Therefore, in addition to CT, T3SS in V. cholerae is another possible virulence determinant. The T3SS gene cluster is distributed among various non-O1, non-O139 strains [8, 12] and a phylogenetic analysis of T3SS-related genes implied horizontal gene transfer of a T3SS gene cluster among Vibrio species [13, 14]. Up to now, however, there has been no experimental evidence of horizontal transfer of the T3SS-related genes.

We herein examined the distribution of T3SS-related genes among various serogroups of V. cholerae isolates and found that the cassette of T3SS-related genes was transferrable among V. cholerae isolates by transformation, and that these subsequently integrated into a VPI-2.

MATERIALS AND METHODS

  1. Top of page
  2. ABSTRACT
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. ACKNOWLEDGMENTS
  7. DISCLOSURE
  8. REFERENCES
  9. Supporting Information

Screening of strains positive for type III secretion system-related genes and their serogrouping

V. cholerae strains used in this study were isolated from natural surface water (environmental; 110 isolates) and diarrhea patients (clinical; 14 isolates) in Bangladesh. These V. cholerae isolates were obtained from the culture collection of the International Center for Diarrhoeal Disease Research, Bangladesh. All 124 isolates, which were primarily confirmed as cholera toxin gene (ctxAB) negative V. cholerae serogroups non-O1/non-O139, were screened by PCR assays with three sets of primer pairs (T3SS-1, T3SS-2 and T3SS-3; Table 1) to detect T3SS-related genes. The primer pair of T3SS-1 amplified a target gene of A33_1670, which encodes structural protein. The primer pairs of T3SS-2 and T3SS-3 targeted genes for translocated effector proteins of A33_1684 and A33_1697, respectively. All primers were designed in the conserved sequence of each gene. The PCR conditions were as follows: after initial denaturation at 95°C for 2 mins, 25 cycles of denaturation at 95°C for 10 s, annealing at 55°C for 20 s and extension at 72°C for 1 mins; and final extension at 72°C for 3 mins with TaKaRa Ex Taq (Takara Bio, Shiga, Japan). The amplified fragments were detected by agarose gel electrophoresis after staining with ethidium bromide. Strains producing the three amplicons from the three primer pairs were defined as positive for T3SS-related genes. Subsequently, strains positive for T3SS-related genes were serogrouped by slide agglutination using a panel of specific antisera for each serogroup of V. cholerae.

Table 1. Primers used in this study
Primer nameSequence (5′–3′)
T3SS-1fAACAACAATATCGTAAATTCCTCGGCTA
T3SS-1rATGCTATGGGTTATGCCGCTAT
T3SS-2fGTGAAGTTTCCGCTTCCGTTT
T3SS-2rTTACAAGGTGTTGCCGCAGA
T3SS-3fGACAGTGGTATTTGATCCCATCTA
T3SS-3rTATCATTGTTGGAAGAGGGCGT
RFLP-1fCTAAACTTCAGCACCAACAAGGTG
RFLP-1rCGTTATCCTGCGATTGATGTACTT
RFLP-2fCATATTCAACACCTTCAAAGCCTTG
RFLP-2rTAAAAATTTGTACTGAATCGTTGGCC
RFLP-3fGCCAGAAAGCAACATCATTCCAC
RFLP-3rCCACAACGGGTTATCACTAGTGC
RFLP-4fGTTTGAGTGCCATTCTCGACAAAT
RFLP-4rGTGGAAAGTTAATCGTTCTGCCCA
RFLP-5fTCAAAACTTTCACCAACACTGTTGT
RFLP-5rATCTGCAGGGCCTGTATTGCAGC
RFLP-6fGAACGGTAAGCTATTAGCTCTTAG
RFLP-6rGGAGCTAATAAATTCAAAACTAAGGC
RFLP-7fGATTATTTTGTTACAACTGAATCCTAT
RFLP-7rTGTTGAGATGTTGATGTGTATATTAAAT
avc1758-1fTGGCGCTCTCCGCTCCTTAT
avc1758-1rAAGCAGCTCCAGCCTACACACATTTCAATCCCTCAAGTAA
avc1758-2fCTAAGGAGGATATTCATATGTAGCTGGTAATCGTGCTGCT
avc1758-2rGGGATGCAAGAGTAAATGCG
FRT-1fTGTGTAGGCTGGAGCTGCTT
FRT-1rCATATGAATATCCTCCTTAG
ctxAB-1fATGGTAAAGATAATATTTGTGTTTTTTAT
ctxAB-1rTTAATTTGCCATACTAATTGCGGCA
Ljct-1fCCGTGCTGTTTAGAGTGAAAGTCG
Ljct-1rGCACTTCACCTTGTTGGTGCTG
Rjct-1fCACACTATGGTAAATAAAAAATACACA
Rjct-1rAAAACTCTAATGGTGATGCAATGAC

Restriction fragment length polymorphism analysis of type III secretion system-related genes

To evaluate the genetic similarity between T3SS-related gene regions, a PCR-RFLP analysis was performed with the positive strains identified as described above. Because the long length of the whole locus precluded its amplification with one primer pair, it was divided it into seven regions (ca. 5–10 kb) to ensure successful amplification with seven sets of primer pairs (RFLP-1 to RFLP-7; Table 1). The PCR was carried out with TaKaRa LA Taq (Takara Bio). The PCR conditions comprised initial denaturation at 95°C for 2 mins, 30 cycles of denaturation at 98°C for 10 s, and annealing and extension at 68°C for 10 mins, with a final extension at 72°C for 12 mins. The PCR products were digested for 4 hrs by HindIII (for RFLP-1, 2, 4, and 7 amplicons by their respective primers) or ClaI (for RFLP-3, 5, and 6 amplicons by their respective primers) (Takara Bio) with the buffer supplied by the manufacturer. They were then analyzed by 1.5% agarose gel electrophoresis in 0.5 × TBE (pH 8.0) buffer, followed by ethidium bromide staining.

Pulsed-field gel electrophoresis

PFGE was performed as previously described using Salmonella enterica serovar Braenderup H9812 as a standard strain [15]. The DNA in the agarose plugs was digested with NotI (Promega, Madison, WI, USA). The digested DNA was separated through a 1% SeaKem Gold agarose gel (Cambrex Bio Science Rockland, Rockland, ME, USA) in 0.5 × TBE buffer at 14°C in a CHEF DR-III instrument (Bio-Rad Laboratories, Hercules, CA, USA) under the following electrophoresis conditions: switch time of 2–10 s for 13 hrs and 20–25 s for 6 hrs, 6 V/cm, at an angle of 120°. The resulting profiles were scanned and saved in TIFF format to be analyzed using the BioNumerics software program (Applied Math, Sint-Martens, Belgium). Similarity was determined using the Dice coefficient, and clustering was based on the unweighted pair group method with arithmetic averages with a band position tolerance of 1.2%.

Natural transformation on shrimp-shell surfaces

Natural transformation of V. cholerae cells was performed as previously described with modifications [16]. Briefly, 1 mL of recipient V. cholerae serogroup O1 strain with ctxAB (V060002) grown in DASW (pH 7.4) was dispensed into Falcon tubes with or without sterile pieces of shrimp shell. After static overnight incubation at 37°C, the culture liquid was removed and fresh DASW added. Then, 10 μg donor DNA from the genetically modified ATCC14033 strain (14033VC1758::cat, see below) was added to the broth. Twenty-four hrs later, the culture was vortexed to release the attached bacteria. The released bacteria were spread onto LB agar with or without 1 μg/mL Cm. Correct insertion of the Cm acetyltransferase gene (cat) and whole T3SS-related gene cluster was verified by PCR using the primer pairs (Ljct-1f/Ljct-1r and Rjct-1f/Rjct-1r; Table 1).

The donor strain, 14033VC1758::cat, was constructed using the λ Red recombination system optimized for V. cholerae [17]. Chromosomal DNA from strain ATCC14033 was used as the template to amplify both the upstream and downstream regions flanking the target gene with the following specific primer sets: avc1758-1f/avc1758-1r for the upstream and avc1758-2f/avc1758-2r for the downstream (Table 1). VC1758, which encodes a phage family integrase, has a flanking locus of T3SS-related genes. Identical genes were designated as A33_1660 in strain AM-19226, which was positive for T3SS-related genes. Alternatively, pKD3 was used as the template to amplify the cat gene with the primers FRTf1 and FRTr1. Next, 0.3 pmol of each of the three PCR fragments was mixed with the primers (avc1758-1f and avc1758-2r; Table 1). The PCR conditions were as follows: after initial denaturation at 95°C for 2 mins, 30 cycles of denaturation at 95°C for 30 s, annealing at 40°C for 30 s, and extension at 72°C for 2 mins, followed by a final extension at 72°C for 3 mins. Next, the PCR fragments (avc1758-1::cat::avc1758-2 cassette) were precipitated with ethanol and dissolved in distilled water. 2 µg of PCR fragments was electroporated into V. cholerae ATCC14033, which expresses λ Red recombinase from a temperature-sensitive plasmid, pKD46, to be integrated into the chromosome. The resultant 14033VC1758::cat was screened by spreading it onto LB agar containing Cm and 1 mg/mL L-arabinose at 37°C.

Immunoblot analysis

Proteins in the culture supernatants were analyzed by SDS–PAGE and western blotting as described previously [18]. Anti-VopD2 antibodies were used to detect effector protein secretion.

RESULTS

  1. Top of page
  2. ABSTRACT
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. ACKNOWLEDGMENTS
  7. DISCLOSURE
  8. REFERENCES
  9. Supporting Information

Distribution of type III secretion system-related genes among the Vibrio cholerae isolates

In all, 110 environmental and 14 clinical isolates were tested for the presence of T3SS-related genes using specific PCR primers and 12 T3SS-positive strains were detected, including 10 environmental strains and 2 clinical isolates. No PCR fragments were amplified from the remaining 112 strains. The serogroups of the T3SS-positive isolates were determined and are listed in Table 2. Six serogroups were identified among nine of the strains, the details of which are as follows: O6 (three isolates), O12 (two isolates) and O39, O54, O84 and O103 (one isolate each). The other three strains formed rough colonies that could not be serogrouped (Table 2).

Table 2. Serogroups of V. cholerae strains positive for T3SS-related genes
StrainYearSourceSerogroupctxABRemarks or reference
  1. ATCC, American Type Culture Collection; C, clinical isolates; E, environmental isolates.

EM-0921A2006EO6This study
EB-01942004EO84This study
EM-01952004EO12This study
EB-04382005EO12This study
EM-03932005EO6This study
EM-05422005EO103This study
EM-08782006EO39This study
EM-09282006EO6This study
EDL-0702004ERThis study
DC-980221998CRThis study
DC-980231998CRThis study
EM-07722006EO54This study
ATCC14033  O1ATCC (T3SS+)
V0600021997CO1+22 (T3SS)

PFGE genotyping showed that the 12 isolates had 10 different PFGE patterns (Fig. 1). There was one clonal cluster, which consisted of three isolates (EDL-070, DC-98022 and DC-98023). DC-98022 was selected for further analysis. The minimal similarity of the T3SS-related positive isolates was approximately 65%. No correlation was found between the PFGE cluster and serogroups. The T3SS-related genes were distributed among V. cholerae strains that were diverse in serogroups and genotypes.

image

Figure 1. A dendrogram of the NotI-digested PFGE profiles of the T3SS-positive strains Corresponding serogroups are shown on the right.

Download figure to PowerPoint

To assess the similarity of T3SS-related gene clusters, PCR–RFLP analyses were performed. All PCR fragments from the 10 isolates with different PFGE profiles were amplified by RFLP-1 to -7 primer sets, except for RFLP-6 and -7 primer sets in the EB-0438 and EM-0772 strains. All PCR fragments with RFLP-1 and -5 primer sets had identical RFLP patterns. The other PCR fragments had similar RFLP patterns that differed by only a few bands (see Fig. S1(b) in the supporting information). Despite the diversity observed in PFGE profiles, the PCR-RFLP analyses of the T3SS-related gene region revealed comparatively similar patterns.

Horizontal transfer of type III secretion system-related gene clusters by natural transformation

The relatively conserved T3SS-related genes were distributed among diverse V. cholerae, which suggests horizontal transfer of T3SS-related genes. Because V. cholerae is naturally competent, it was theorized that transformation is the mechanism responsible for the horizontal gene transfer of T3SS-related genes [16].

To examine the contribution of transformation, natural transformation of V. cholerae cells in the presence of chitin was performed. A cat was introduced into the T3SS-related gene region of V. cholerae O1 strain ATCC14033 as a selection marker, resulting in 14033VC1758::cat. After overnight incubation of recipient strain V060002 with the chromosomal DNA of 14033VC1758::cat, the culture was plated onto LB agar with or without Cm. Cm-resistant transformants were observed only from the cultures in which shrimp shell was present at frequencies of ∼10−7 (defined as the number of Cm-resistant colonies divided by the number of total viable colonies). Correct insertion of cat and the whole T3SS-related gene region in Cm-resistant transformants was verified by using the respective primer sets as shown in Figure 2. The original recipient strain V060002 with ctxAB did not possess the T3SS-related genes, however, the resultant transformants (V060002ΔVC1760-1772::T3SS) possessed both T3SS-related genes and ctxAB. The DNA fragments of the estimated size were successfully amplified with two sets of primer pairs for detection of both junctions of the inserted T3SS-related gene cluster, as shown in Figure 2. Additionally, PFGE analysis of NotI-digested profiles obtained from the recipient V060002 and the transformant V060002ΔVC1760-1772::T3SS showed their patterns were similar, differing by only a few bands, which were probably caused by an additional NotI site on the T3SS-related genes (data not shown). These results indicate that uptake of exogenous T3SS-related genes, followed by homologous recombination, occurred exclusively in the VPI-2 region.

image

Figure 2. Schematic diagrams of recombination and PCR verification. (a) The VIP-2 region of the recipient strain was exchanged with T3SS-related genes from the donor strain. The presence of the whole region of the T3SS-related genes in the transformant was verified by PCR amplification (b) of the left and (c) right junctions of the inserted T3SS-related gene cluster. (d) The transformants possess T3SS-related genes and ctxAB. Lanes: M, marker (the StyI digest of λ DNA); 1, donor strain (14033VC1758::cat); 2, recipient strain (V060002); 3–5, transformants (V060002ΔVC1760-1772::T3SS).

Download figure to PowerPoint

Furthermore, expression and secretion of transferred T3SS-related genes was confirmed. Translocon protein VopD2 was detected in the transformant by immunoblotting and samples from the culture supernatant also contained the VopD2 protein (data not shown).

DISCUSSION

  1. Top of page
  2. ABSTRACT
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. ACKNOWLEDGMENTS
  7. DISCLOSURE
  8. REFERENCES
  9. Supporting Information

The acquisition of foreign DNA via horizontal gene transfer contributes to bacterial evolution, including acquisition of virulence factors. The mechanisms responsible for horizontal gene transfer, which can introduce large fragments of DNA into the recipient bacterium, are as follows: conjugation, transduction and transformation,. For example, the ctxAB genes, fundamental virulence factors of V. cholerae, are located on the lysogenic filamentous phage, CTXΦ, which mediates horizontal transfer of genes by transduction [19]. In this study, we found that the T3SS-related genes were similar in diverse V. cholerae strains, which suggests their horizontal transfer and demonstrates that natural transformation could be the mechanism responsible for horizontal gene transfer in the distribution of T3SS-related genes among V. cholerae strains.

The VPI-2 region, where T3SS-related genes are localized, can be excised from chromosomal DNA and forms a circular intermediate at a low level [20]. Some environmental stress conditions result in significant increases in the level of excision of VPI-2 [21]. Possibly, environmental signals can trigger induction of excision and circularization of the VPI-2 region encoding T3SS, after which lysis of V. cholerae cells occurs. As a result, a certain amount of circular intermediates would be released. The natural competence observed in V. cholerae is induced in response to the presence of chitin, a polymer of β-1,4-linked N-acetylglucosamine [16]. Because chitin is abundant in the aquatic environment, V. cholerae can become competent in natural environments. In such situations, there is a strong possibility of horizontal transfer of T3SS-related genes among V. cholerae strains, through either circular intermediates or DNA linear fragments. In this study, we showed that the T3SS gene region of 14033VC1758::cat DNA can transform recipient V. cholerae strains with their expression under experimental competence conditions. This provides evidence for the evolutionary mechanism underlying the development of pathogenic V. cholerae in natural reservoirs.

ACKNOWLEDGMENTS

  1. Top of page
  2. ABSTRACT
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. ACKNOWLEDGMENTS
  7. DISCLOSURE
  8. REFERENCES
  9. Supporting Information

This work was supported in part by a Grant-in-aid from the Ministry of Health, Labour, and Welfare (H20-Shinko-Ippan-013, and H20-Shinko-Ippan-015). The International Center for Diarrhoeal Disease Research, Bangladesh, acknowledges its major donor countries and agencies for their continued financial support in its activities.

REFERENCES

  1. Top of page
  2. ABSTRACT
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. ACKNOWLEDGMENTS
  7. DISCLOSURE
  8. REFERENCES
  9. Supporting Information
  • 1
    Sack D.A., Sack R.B., Nair G.B., Siddique A.K. (2004) Cholera. Lancet 363: 22333.
  • 2
    Dalsgaard A., Serichantalergs O., Forslund A., Lin W., Mekalanos J., Mintz E., Shimada T., Wells J.G. (2001) Clinical and environmental isolates of Vibrio cholerae serogroup O141 carry the CTX phage and the genes encoding the toxin-coregulated pili. J Clin Microbiol 39: 408692.
  • 3
    Li M., Shimada T., Morris J.G. Jr, Sulakvelidze A., Sozhamannan S. (2002) Evidence for the emergence of non-O1 and non-O139 Vibrio cholaere strains with pathogenic potential by exchange of O-antigen biosysthesis regions. Infect Immun 70: 244153.
  • 4
    Sarkar B., Bhattacharya T., Ramamurthy T., Shimada T., Takeda Y. Nair G.B. (2002) Preferential association of the heat-stable enterotoxin gene (stn) with environmental strains of Vibrio cholerae belonging to the O14 serogroup. Epidemiol Infect 129: 24551.
  • 5
    Tobin-D'Angelo M., Smith A.R., Bulens S.N., Thomas S., Hodel M., Izumiya H., Arakawa E., Morita M., Watanabe H. Marin C., Parsons M.B., Greene K., Cooper K., Haydel D., Bopp C., Yu P., Mintz E. (2008) Severe diarrhea caused by cholera toxin-producing Vibrio cholerae serogroup O75 infections acquired in the southeastern United States. Clin Infect Dis 47: 103540.
  • 6
    Hueck C.J. (1998) Type III protein secretion systems in bacterial pathogens of animals and plants. Microbiol Mol Biol Rev 62: 379433.
  • 7
    Makino K., Oshima K., Kurokawa K., Yokoyama K., Uda T., Tagomori K., Iijima Y., Najima M., Nakano M. Yamashita A, Kubota Y, Kimura S, Yasunaga T, Honda T, Shinagawa H, Hattori M, Iida T. (2003) Genome sequence of Vibrio parahaemolyticus: a pathogenic mechanism distinct from that of V. cholerae. Lancet 361: 74349.
  • 8
    Dziejman M., Serruto D., Tam V.C., Sturtevant D., Diraphat P., Faruque S.M., Rahman M.H., Heidelberg J.F., Decker J., Li L., Montgomery K.T., Grills G., Kucherlapati R., Mekalanos J.J. (2005) Genomic characterization of non-O1, non-O139 Vibrio cholerae reveals genes for a type III secretion system. Proc Natl Acad Sci USA 102: 346570.
  • 9
    Alam A., Miller K.A., Chaand M., Butler J.S., Dziejman M. (2011) Identification of Vibrio cholerae type III secretion system effector proteins. Infect Immun 79: 172840.
  • 10
    Tam V.C., Serruto D., Dziejman M., Brieher W., Mekalanos J.J. (2007) A type III secretion system in Vibrio cholerae translocates a formin/spire hybrid-like actin nucleator to promote intestinal colonization. Cell Host Microbe 1: 95107.
  • 11
    Tam V.C., Suzuki M., Coughlin M., Saslowsky D., Biswas K., Lencer W.I., Faruque S.M., Mekalanos J.J. (2010) Functional analysis of VopF activity required for colonization in Vibrio cholerae. mBio 1: e00289-10.
  • 12
    Rahman M.H., Biswas K., Hossain M.A., Sack R.B., Mekalanos J.J., Faruque S.M. (2008) Distribution of genes for virulence and ecological fitness among diverse Vibrio cholerae population in a cholera endemic area: tracking the evolution of pathogenic strains. DNA Cell Biol 27: 34755.
  • 13
    Okada N., Iida T., Park K.S., Goto N., Yasunaga T., Hiyoshi H., Matsuda S., Kodama T., Honda T. (2009) Identification and characterization of a novel type III secretion system in trh-positive Vibrio parahaemolyticus strain TH3996 reveal genetic lineage and diversity of pathogenic machinery beyond the species level. Infect Immun 77: 90413.
  • 14
    Okada N., Matsuda S., Matsuyama J., Park K.S., de los Reyes C., Kogure K., Honda T., Iida T. (2010) Presence of genes for type III secretion system 2 in Vibrio mimicus strains. BMC Microbiol 10: 302.
  • 15
    Cooper K.L., Luey C.K., Bird M., Terajima J., Nair G.B., Kam K.M., Arakawa E., Safa A., Cheung D.T., Law C.P., Watanabe H., Kubota K., Swaminathan B., Ribot E.M. (2006) Development and validation of a PulseNet standardized pulsed-field gel electrophoresis protocol for subtyping of Vibrio cholerae. Foodborne Pathog Dis 3: 518.
  • 16
    Meibom K.L., Blokesch M., Dolganov N.A., Wu C., Schoolnik G.K. (2005) Chitin induces natural competence in Vibrio cholerae. Science 310: 18247.
  • 17
    Yamamoto S., Izumiya H., Morita M., Arakawa E., Watanabe H. (2009) Application of λ Red recombination system to Vibrio cholerae genetics: simple methods for inactivation and modification of chromosomal genes. Gene 438: 5764.
  • 18
    Hiyoshi H., Kodama T., Saito K., Gotoh K., Matsuda S., Akeda Y., Honda T., Iida T. (2011) VopV, an F-actin-binding type III secretion effector, is required for Vibrio parahaemolyticus-induced enterotoxicity. Cell Host Microbe 10: 4019.
  • 19
    Walder M.K., Mekalanos J.J. (1996) Lysogenic conversion by filamentous phage encoding cholera toxin. Science 272: 19104.
  • 20
    Murphy R.A., Boyd E.F. (2008) Three pathogenicity islands of Vibrio cholerae can excise from the chromosome and form circular intermediates. J Bacteriol 190: 63647.
  • 21
    Almagro-Moreno S., Napolitano M.G., Boyd E.F. (2010) Excision dynamics of Vibrio pathogenicity island-2 from Vibrio cholerae: role of a recombination directionality factor VefA. BMC Microbiol 10: 306.
  • 22
    Yamamoto S., Morita M., Izumiya H., Watanabe H. (2010) Chitin disaccharide (GlcNAc)2 induces natural competence in Vibrio cholerae through transcriptional and translational activation of a positive regulatory gene tfoXVC. Gene 457: 429.

Supporting Information

  1. Top of page
  2. ABSTRACT
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. ACKNOWLEDGMENTS
  7. DISCLOSURE
  8. REFERENCES
  9. Supporting Information

Additional supporting information may be found in the online version of this article at the publisher's web site:

FilenameFormatSizeDescription
mim12039-sm-0001-SupFig-S1.jpg1512KFig. S1. (a) The genetic organization of the T3SS island and locations of PCR fragments. The arrows represent the open reading frames according to the NCBI annotation of V. cholerae AM-19226. T3SS-related genes are indicated by light gray arrows. The black boxes above the open reading frames indicate amplicons used to screen for T3SS-related genes (T3SS-1 on A33_1670, T3SS-2 on A33_1684 and T3SS-3 on A33_1697). (b) The PCR-RFLP profiles of the T3SS-related gene regions. Lanes: M, marker (the StyI digest of λ DNA); 1, EM-0921A; 2, EB-0194; 3, EM-0195; 4, EB-0438; 5, EM-0393; 6, EM-0542; 7, EM-0878; 8, EM-0928, 9, DC-98022; 10, EM-077.

Please note: Wiley Blackwell is not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing content) should be directed to the corresponding author for the article.