SEARCH

SEARCH BY CITATION

Keywords:

  • coreceptor;
  • C-X-C chemokine receptor type 4;
  • deletion mutant;
  • X4/R5X4-tropic HIV

ABSTRACT

  1. Top of page
  2. ABSTRACT
  3. 1 MATERIALS AND METHODS
  4. 2 RESULTS
  5. 3 DISCUSSION
  6. ACKNOWLEDGMENTS
  7. 4 DISCLOSURE
  8. REFERENCES
  9. Supporting Information

Human immunodeficiency viruses initiate infections via CCR5 coreceptors and then change their tropism to C-X-C chemokine receptor type 4 (CXCR4), this change being associated with rapid disease progression. HIV-1IIIB, a widely described pure X4-tropic strain, is distinct from R5X4-tropic viruses. In this study, the requirement for amino terminal regions (NTRs) of CXCR4 for entry of HIV-1IIIB virus into host cells was examined and compared to that of R5X4-tropic viruses. CXCR4 and its deletion mutant (CXCR4ΔNTR23; first 23 amino acids removed from NTR) were amplified to examine their coreceptor activities. NP-2/CD4/CXCR4 and NP-2/CD4/CXCR4ΔNTR23 cell lines were prepared accordingly. Indirect immune fluorescence assay (IFA), PCR, and reverse transcriptase (RT) activity were used to compare the process of infection of host cells by HIV-1IIIB virus, one R5-tropic and five other R5X4-tropic viruses. All the R5X4-tropic HIVs were found to utilize both CCR5 and CXCR4 but unable to use CXCR4ΔNTR23 as coreceptors. In contrast, X4-tropic HIV-1IIIB was found to preferentially infect through CXCR4ΔNTR23. Viral antigens in infected NP-2/CD4/CXCR4ΔNTR23 cells were detected by IFA and confirmed by detection of proviral DNA and by performing RT assays on the spent cell-supernatants. In dual tropic viruses, deletion of 23 amino acids from NTR abrogates the coreceptor activity of CXCR4. This observation demonstrates that NTR of CXCR4 have an obligatory coreceptor role for dual tropic viruses. However, HIV-1IIIB may have different requirements for NTR than R5X4 viruses or may infect host cells independent of NTR of CXCR4.

List of Abbreviations
7TM

seven-transmembrane receptor

CCR5

C-C chemokine receptor type 5

CD

cluster of differentiation

CKR

chemokine receptor

CXCR4

C-X-C chemokine receptor type 4

CXCR4ΔNTR23

mutant of CXCR4 made by removal of first 23 amino acids from NTR

DMEM

Dulbecco's modified EMEM

EMEM

Eagle's minimum essential medium

GAPDH

glyceraldehyde-3-phosphate dehydrogenase

GPCR

G protein-coupled receptor

IFA

immune fluorescence assay

NCBI

National Center for Biotechnology Information

NIBSC

National Institute for Biological Standard and Control

NTR

amino terminal region

ORF

open reading frame

RT

reverse transcriptase

SIV

simian immunodeficiency virus

Human immunodeficiency viruses infect and enter into host cells by binding their mature envelop (env) glycoprotein, gp120, to CD4 as primary receptor [1, 2] and to chemokine receptors, CCR5, and CXCR4, exclusively or mutually, as major coreceptors [3, 4]. Combined receptor–coreceptor-bindings trigger gp41 activation and membrane fusion of the infected cells, thus facilitating viral entry [5, 6]. Moreover, several other GPCRs reportedly have coreceptors functions for HIV-1, HIV-2, and SIV [7, 8]. Several GPCRs of primate origin have also been reported to be functional coreceptors for SIV. The phenotypic variability of viruses is based on which coreceptors they utilize when infecting susceptible cells. Their use of the major coreceptors determines the tropism of infectious viruses and results in classification of most HIVs into three groups: R5 viruses (which use CCR5 alone as coreceptor), R5X4 viruses (which use both CCR5 and CXCR4) and X4 viruses (which use CXCR4 alone); the last are rare. However, all primary infections are initiated via CCR5 receptors and then change their tropism to CXCR4, probably expanding subsequently to more GPCR-usage [9]. Evolution of viruses from R5-tropism to X4-tropism can lead to accelerated disease progression with rapid decline of CD4+ and CD8+ T cells [10, 11]. In addition, a recent study found that the predominant HIVs responsible for mother to child transmission are CXCR4-using viruses [12]. Therefore, studies exploring tropism shifting and alternative coreceptor-utilization are extremely important.

HIV-1IIIB is a widely described laboratory-adapted strain that uses CXCR4 exclusively as its coreceptor and induces syncytia in T-cell lineages [13, 14]. This virus is distinct from R5X4 tropic viruses in that it loses its capacity to utilize CCR5 after adapting to CXCR4. Therefore, the role of CXCR4 in infection by HIV-1IIIB and other dual tropic viruses demands further investigation. Earlier studies demonstrated the critical roles of extracellular amino terminal regions (NTRs) for the coreceptor functions of GPCRs [15]. In this study, we prepared a mutant of CXCR4 designated as CXCR4ΔNTR23by deleting 23 amino acids from NTR. To discriminate the coreceptor requirements of X4-tropic and dual-tropic viruses, we compared the coreceptor function of CXCR4ΔNTR23 for HIV-1IIIB with R5X4 tropic HIV strains/isolates. We observed that all dual tropic viruses became incapable of utilizing CXCR4ΔNTR23 as coreceptor whereas, interestingly, HIV-1IIIB used the deletion mutant with ease to infect cells.

1 MATERIALS AND METHODS

  1. Top of page
  2. ABSTRACT
  3. 1 MATERIALS AND METHODS
  4. 2 RESULTS
  5. 3 DISCUSSION
  6. ACKNOWLEDGMENTS
  7. 4 DISCLOSURE
  8. REFERENCES
  9. Supporting Information

1.1 Preparation of C-X-C chemokine receptor type 4-deletion mutant

To examine their coreceptor activities, CXCR4 was amplified and a deletion mutant of it (CXCR4ΔNTR23) prepared by removing the first 23 amino acids from the NTR. Because it is reportedly a dependable cell-system tool for coreceptor examination study [16], the human glioma cell line, NP-2 was used to prepare NP-2/CD4/CXCR4 and NP-2/CD4/CXCR4ΔNTR23 cell lines. The amino acid sequence for the coding region of CXCR4 was obtained from the UniProtKB/Swiss-Prot protein database (accession number: P61073) and the corresponding DNA sequence obtained from GenBank database (accession number: AY242129.1). Oligonucleotide primers for detecting reverse-transcribed mRNA by PCR were designed and synthesized to cover the CXCR4-ORF (Proligo K.K., Tokyo, Japan). The nucleotide sequences of PCR primers, their orientations and the positions of primers in the respective ORFs of the genes were as follows: X4-F, 5′ATGGAGGGGATCAGTATATACACTTC3′ (sense: 1–26) and X4-R, 5′TTAGCTGGAGTGAAAACTTGAAGACTC3′ (antisense: 1033–1059). For the deletion mutant, a forward primer was designed from the corresponding position of the third methionine from NTR (5′ATGAAGGAACCCTGTTTCCGTGAAGA3′, sense: 70–95), keeping the same reverse primer as described above. Therefore, the expected PCR products for CXCR4 ORF and the deletion mutant were 1059 bp and 990 bp, respectively. As a control, mRNA expression of GAPDH was examined.

Total RNA was isolated from human cell lines using ISOGEN (Nippon Gene, Tokyo, Japan) according to the manufacturer's protocol. Contaminated DNA in RNA preparations was removed by digestion with 1 U/µL RNA qualified 1 RNase-free DNase (Promega, Madison, WI, USA) at 37°C for 1 hr. cDNA was prepared by RT reaction using Superscript II Reverse Transcriptase (Invitrogen, Carlsbad, CA, USA). The expressions of mRNA for CXCR4 and CXCR4ΔNTR23 were detected by PCR from cDNA preparations using the sense and antisense primer pairs. Amplified cDNA was examined by electrophoresis through 1% (w/v) agarose gel.

1.2 Cloning of C-X-C chemokine receptor type 4 and its deletion mutant as coreceptors

DNA fragments for the full-length CXCR4 ORF and the mutant were cloned into a TA-cloning plasmid, pGEM-T Easy (Promega), and the derivative plasmids designated as pGEM-T-Easy/CXCR4 and pGEM-T Easy/CXCR4ΔNTR23. DNA sequencing of TA cloned derivatives was performed by a 5500 DNA-sequencer (Hitachi, Tokyo, Japan). The ligated DNA fragments were separated from TA plasmids by digestion with suitable restriction enzymes and recloned into an expression plasmid, pMX-puro [17]. Transfection to NP-2/CD4 cells was performed with expression plasmids using FuGENE 6 (Roche, Basel, Switzerland) according to the manufacturer's protocol. Transfected cells were selected by maintaining them in culture medium containing 1 µg/mL puromycin for 2–3 weeks, as described elsewhere [18].

1.3 Cells

C-C chemokine receptor type 5-transduced human T-cell line, C8166/CCR5 was used for the preparation of HIV-1 stocks, as described previously [16]. Varieties of established human cell lines were used to prepare mRNA and to amplify cDNA for the ORF of CXCR4 and its deletion mutant. T-cell lines, ATL-1K and a B-cell line, Daudi were cultured in RPMI 1640 medium (Nissui, Tokyo, Japan) containing 10% FBS. EMEM (Nissui) with 10% FBS was used to maintain NP-2 and its derivative cell lines. The amphotropic packaging cell line, Phoenix-Ampho [19] was maintained in DMEM containing 10% FBS.

1.4 Viruses

Three laboratory-adapted strains, GUN4wt [20], IIIB [21] and BaL [22], and four primary isolates of HIV-1 were examined for their ability to utilize both CXCR4 and CXCR4ΔNTR23 as coreceptors in collaboration with CD4. Laboratory adapted HIV-2CBL was also used to a limited degree in this study. Primary isolates of HIV were obtained from the NIBSC (London, UK). Their origins, subtypes and NIBSC-reference codes are as follows: HIV-1 strains, MVP-5180 (Cameroon, subtype O, EVA167), 93BR020 (Brazil, subtype F, ARP179.25) and HAN2 (Germany, subtype B, EVA158). The primary isolate, GUN11, was isolated in Gunma University Hospital and included in this study.

1.5 HIV infection assay

NP-2/CD4/CXCR4 and NP-2/CD4/CXCR4ΔNTR23 cells were seeded separately into wells of 24-well plates at 25,000 cells/well in 500 µL of culture medium. On the following day, 400 µL of culture medium was drained off and subsequently replaced by respective HIV-1 inoculums. After overnight incubation, the cells were washed three times with EMEM containing 10% FBS to remove free virus, after which they were cultured in 500 µL fresh medium at 37°C. The cells were passaged every 3–5 days and maintained for up to 4 weeks. Expression of HIV antigen in the infected cells was detected by IFA after each passage, as described previously [23]. RT activities in culture supernatants of cells harvested at the final time points of infection was also detected by a method described elsewhere [24].

1.6 Viral DNA amplification and sequencing

Polymerase chain reaction to detect viral DNA for the Gag-coding regions was also performed using the genomic DNA of infected cells as templates. The selected primer pair was HIV1-gagF (forward 5′-TCTATAAAAGATGGATAATCATGGG-3′) and HIV1-gagR (reverse 5′-AAGCACTTAACAGTCTTTCTTTGG-3′), which are located between positions 1571–1595 and 1944–1967, respectively (nucleotide positions were derived according to HIV-1-US88WR27, accession number, AF286365). DNA sequences obtained were blasted in the NCBI nucleotide database (http://blast.ncbi.nlm.nih.gov).

2 RESULTS

  1. Top of page
  2. ABSTRACT
  3. 1 MATERIALS AND METHODS
  4. 2 RESULTS
  5. 3 DISCUSSION
  6. ACKNOWLEDGMENTS
  7. 4 DISCLOSURE
  8. REFERENCES
  9. Supporting Information

2.1 Amplification and cloning of C-X-C chemokine receptor type 4 and its deletion mutant as coreceptors

Human CXCR4 is a seven-transmembrane (7TM) receptor consisting of 352 amino acids, the extracellular amino terminal containing 39 amino acids as shown in a schematic diagram (Fig. 1a). The cDNA for CXCR4 was amplified in ATL-1K, C8166, Daudi and HeLa-cell lines. The NP-2 cell line did not express CXCR4 naturally (Fig. 1b), making it a prudent host for CXCR4 cloning and relevant coreceptor studies. The mutant-CXCR4 was amplified from the third methionine (M) position by PCR from ATL-1K cell lines and used for cloning. cDNAs of wild type and mutant-CXCR4 were transduced into NP-2/CD4 cells to produce NP-2/CD4/CXCR4 and NP-2/CD4/CXCR4ΔNTR23 cell lines. NP-2/CD4/CCR5 cells were prepared as positive controls for examining CCR5 functions. mRNA expressions of coreceptor candidates in cloned cells were detected accordingly.

image

Figure 1. Schematic representation of the structure of CXCR4, its deletion point and its expression in various human cell lines. (a) The amino acid sequence of NTR of CXCR4 is shown, shaded residues indicating region deleted in the mutant. The arrow indicates the junction within the NTR where the truncated mutant ends. (b) Expression of CXCR4 in various human cells as detected by reverse transcriptase-PCR. The products shown in column 1–4 indicate the mature full-length form of CXCR4. Numbers on the left are molecular weights of markers. The expression cells are specified separately in the right hand column.

Download figure to PowerPoint

2.2 Examination of the coreceptor activities of C-X-C chemokine receptor type 4 and its deletion mutant

NP-2/CD4/CCR5, NP-2/CD4/CXCR4, NP-2/CD4/CXCR4ΔNTR23 and NP-2/CD4 cells were seeded and inoculated with the virus strains and isolates, cultured for up to 4 weeks and examined upon cell passage for whether IFA could detect HIV antigen-positive cells. Except for HIV-1IIIB, all HIV strains and isolates replicated well in NP-2/CD4/CCR5 cells: most cells becoming HIV-antigen positive 3–7 days after inoculation (Table 1), upon which a large number of fused cells were detectable by light microscopy (data not shown). Similarly, NP-2/CD4/CXCR4 cells were found to support all viral propagations except for HIV-1BaL (exclusively R5-tropic). Thus, all R5X4-tropic HIV-1 were found to utilize both CCR5 and CXCR4 coreceptors. However, no R5X4-tropic viral antigen was detected in virus-exposed NP-2/CD4/CXCR4ΔNTR23 cells, indicating that CXCR4ΔNTR23 does not function as a coreceptor for any dual tropic strains or isolates (Table 1 and Fig. 2). Thus, in dual tropic viruses, deletion of 23 amino acids from NTR abrogates the coreceptor activity of CXCR4. In contrast, pure X4-tropic HIV-1IIIB was found to infect NP-2/CD4/CXCR4ΔNTR23 cells readily (Fig. 2). Of note, HIV-1IIIB showed a slower infection course through 23 amino acids-deleted CXCR4 than through native CXCR4. Whereas about 90% of NP-2/CD4/CXCR4 cells became HIV-1IIIB viral antigen positive with 1 week of inoculation, the virus took more than 3 weeks to reach a similar level of infection in NP-2/CD4/CXCR4ΔNTR23 cells (Fig. 3a,b). According to IFA, HIV-2CBL23 was more strongly infective via CXCR4 than via CCR5 but was unable to infect NP-2/CD4/CXCR4ΔNTR23 cells (Table 1). NP-2/CD4 cells were found to be completely resistant to infection by all HIV strains/isolates tested here. Concurrent with IFA, RT activities were assayed in spent culture media of NP-2/CD4/CXCR4 on day 7, when 70–90% cells were viral antigen-positive, and in those of NP-2/CD4/CXCR4ΔNTR23 cells on day 24, when 60% of cells were found to be antigen-positive for HIV-1IIIB but < 0.1% antigen-positive for other R5X4 viruses. All viruses except HIV-1BaL produced infection via CXCR4, thereby generating high RT activities. The RT values ranged from 1.4 × 105 to 2.9 × 105 H-cpm/mL (Fig. 3c). On the other hand, CXCR4ΔNTR23 allowed only HIV-1IIIB to produce infection with RT activity of 1.2 × 105 H-cpm/mL. Other dual tropic viruses produced negligible to background level RT activities (2.0 × 103 H-cpm/mL) via CXCR4ΔNTR23 (Fig. 3c). Therefore, the results of RT activities were concordant with the corresponding percentages of viral antigen positive cells as detected by IFA.

Table 1. Propagation of laboratory-adapted strains and isolates of HIV-1 using CCR5, CXCR4 and CXCR4ΔNTR23 as coreceptors
VirusInfection to NP-2/CD4 cells using coreceptor of:
CCR5CXCR4CXCR4ΔNTR23
  • ++ + +, 70–90% of cells became antigen-positive at 3–7 days after infection; ++ + , 70–90% of cells became antigen-positive within 2–3 weeks of infection; ++, 10–20% of cells became antigen-positive within 4 weeks of infection; and −, <0.1% of cells became antigen-positive within 4 weeks of infection.

  • , viral antigen positive cells were examined by IFA.

Laboratory strains
HIV-1
IIIB++ + ++++
BaL++ + +
GUN4wt++ + ++++
HIV-2   
CBL23+++++ + +
Primary isolates
HIV-1
93BR020++ + ++++
GUN11++ + ++++
HAN2++ + +++ + +
MVP5180++ + +++ + +
image

Figure 2. The susceptibilities of NP-2/CD4/CXCR4 and NP-2/CD4/CXCR4△NTR23 cells to X4-IIIB strain and a R5X4-tropic isolate. NP-2/CD4/CXCR4 and NP-2/CD4/CXCR4△NTR23 cells were seeded and inoculated the following day with the virus strains. Infected cells expressing viral antigens were identified by IFA. For IFA, the inoculated cells were smeared onto glass slides in duplicate, dried and fixed with acetone. Viral infected human serum was used as primary antibody and FITC conjugated anti-human antibody as secondary antibody.

Download figure to PowerPoint

image

Figure 3. Time-course of infection, RT assay and proviral DNA detection for X4, R5, and R5X4-tropic viruses. (a) For the infection assay NP-2/CD4/CXCR4 cells were seeded and exposed with X4, R5 and R5X4 tropic viruses. All cells were passaged every 3–4 days for up to 4 weeks. Viral antigens in host cells were determined by IFA. (b) Virus infection assay through NP-2/CD4/CXCR4△NTR23 cells was continued for up to 4 weeks and viral antigen detected by IFA. (c) RT assay for detecting efficiency of viral replication using wild type and truncated-CXCR4 as coreceptors. Culture supernatants of infected cells were harvested for RT activities. (d) Proviral DNA was detected by PCR using the genomic DNA of infected cells as templates.

Download figure to PowerPoint

2.3 Proviral DNA and sequence analyses

Providing additional evidence of infection of NP-2/CD4/CXCR4ΔNTR23 cells, proviral DNA was detected for only HIV-1IIIB by PCR (Fig. 3d), whereas no dual-tropic viral DNA was detected. The proviral DNAs of HIV-1IIIB propagated in NP-2/CD4/CXCR4 and NP-2/CD4/CXCR4ΔNTR23 cells were sequenced and blasted in the NCBI nucleotide database. Both DNAs showed homogeneity to the gag region of reference strains. The IIIB-sequences obtained through CXCR4 and CXCR4ΔNTR23 were aligned to each other and had two common nucleotide substitutions (Supplementary Data 1). However, because both nucleotide substitutions were synonymous, no amino acid substitutions were detected in the amplified gag domain, (Supplementary Data 2).

3 DISCUSSION

  1. Top of page
  2. ABSTRACT
  3. 1 MATERIALS AND METHODS
  4. 2 RESULTS
  5. 3 DISCUSSION
  6. ACKNOWLEDGMENTS
  7. 4 DISCLOSURE
  8. REFERENCES
  9. Supporting Information

All primary HIV infections were thought to be initiated through CCR5 coreceptors [9]; CXCR4-using viruses not usually being found during early phases of infection [25]. However, in a recent study CXCR4-tropic viruses were detected during a recently-diagnosed infection, indicating that CXCR4 can play a role in initiating viral transmission [26]. Thus, the coreceptor role of CXCR4 is quite complex and demands further detailed investigation. Tyrosines in the amino terminal domain of CCR5 play a critical role in viral entry [27]. However, the role of tyrosine residues in the N-terminal tail of CXCR4 as HIV-coreceptor has not been clarified [25]. In this study, we investigated the contribution of the first 23 amino acids of NTR of CXCR4, which contains tyrosine in the seventh, 12th, and 21st position, to CXCR4 performing as a coreceptor for several R5X4 tropic HIV-1 strains and compared them with an X4 tropic HIV-1IIIB strain. During examination of the ability of dual tropic HIV strains and isolates to infect through CXCR4ΔNTR23 as coreceptor, we found NP-2/CD4/CXCR4ΔNTR23 cells to be completely uninfected 4 weeks after inoculation (Fig. 3b). This observation demonstrates that the NTR of CXCR4 has an obligatory role as coreceptor for dual tropic viruses. In this study, in addition to HIV-1 strains and isolates, we examined laboratory-adapted HIV-2CBL23, which is also a dual tropic virus with strong replication capacity through CXCR4, and found it to be incapable of replicating through CXCR4ΔNTR23 (Table 1). We predicted that the deleted region plays critical roles in the formation of the structure necessary for the coreceptor activity of CXCR4 for those R5X4 viruses.

The deleted 23 amino acids include three tyrosines and three aspartic acids; these may be responsible for the coreceptor activities of CXCR4 for infection-incapable R5X4 viruses. The 16 amino acids remaining attached to the NTR of CXCR4ΔNTR23 do not include any tyrosine or aspartic acid (Fig. 1), supporting a previous conjecture that absence of tyrosine/aspartic acid precludes coreceptor activity [15, 27]. Thus, we predicted possible functional roles for tyrosine/aspartic acids in the NTR of CXCR4. Wild type CXCR4 contains 39 amino acids in its NTR versus16 amino acids to the deletion mutant (Fig. 1a). Thus, CXCR4ΔNTR23's loss of coreceptor function indicates that the first 59% of amino acids (23/39) of the NTR are more critical than the remaining 41% (16/39) in determining coreceptor activity. Accurate identification of the number(s) and positions of specific amino acids responsible for coreceptor function requires further detailed studies. In our study, HIV-1IIIB, unlike R5X4 viruses, showed a distinct CXCR4 utilization pattern. We found that HIV-1IIIB was incapable of initiating infection of NP-2/CD/CXCR4ΔNTR23 cells; < 1% cells were found to be antigen-positive 2 weeks after inoculation. Subsequently, the virus propagated strongly through CXCR4ΔNTR23 (Fig. 3b). Both RT assay and proviral DNA detection supported the findings of IFA. Thus, we conclude that exclusive X4-tropic HIV-1IIIB may have different requirement for NTR than R5X4 viruses. The HIV-1IIIB virus may infect the host cells using the residual NTR region (from 24 to 39) of CXCR4 or independent of the NTR of the coreceptor. Our observations are in agreement with a previous study in which replacement of aspartic acid at transmembrane domain 4 and 6 of 7TM was found to hamper the coreceptor function of CXCR4 for HIV-1IIIB and other pure X4-tropic viruses [28]. Moreover, HIV-1IIIB may have a different coreceptor-binding domain in gp120 than other viruses that interact typically with the V3 region while entering target cells [7]. Therefore, identifying sequences of the variable regions of gp120 of HIV-1IIIB and comparing them to those of other viruses could be vital to understanding its coreceptor utilization.

The findings of this study may contribute to understanding the pathogenesis of X4-tropic viruses as well as the mechanism of infection via CXCR4 utilization. This investigation would be more significant and complete if more X4 viral strains and/or primary isolates were studied as well as HIV-1IIIB. Further studies are required to determine the clinical relevance of these findings.

ACKNOWLEDGMENTS

  1. Top of page
  2. ABSTRACT
  3. 1 MATERIALS AND METHODS
  4. 2 RESULTS
  5. 3 DISCUSSION
  6. ACKNOWLEDGMENTS
  7. 4 DISCLOSURE
  8. REFERENCES
  9. Supporting Information

This work was supported in part by grants-in-aid from the 21st Century COE Program, “Biomedical Research using Accelerated Technology” and Gunma University Graduate School of Medicine.

REFERENCES

  1. Top of page
  2. ABSTRACT
  3. 1 MATERIALS AND METHODS
  4. 2 RESULTS
  5. 3 DISCUSSION
  6. ACKNOWLEDGMENTS
  7. 4 DISCLOSURE
  8. REFERENCES
  9. Supporting Information
  • 1
    Dalgleish A.G., Beverley P.C., Clapham P.R., Crawford D.H., Greaves M.F., Weiss R.A. (1984) The CD4 (T4) antigen is an essential component of the receptor for the AIDS retrovirus. Nature 312: 7637.
  • 2
    Klatzmann D., Barre-Sinoussi F., Nugeyre M.T., Danquet C., Vilmer E., Griscelli C., Brun-Veziret F., Rouzioux C., Gluckman J.C., Chermann J.C., Montagnier L. (1984) Selective tropism of lymphadenopathy associated virus (LAV) for helper-inducer T lymphocytes. Science 225: 5963.
  • 3
    Alkhatib G., Combadiere C., Broder C.C., Feng Y., Kennedy P.E., Murphy P.M., Berger E.A. (1996) CC CKR5: a RANTES, MIP-1alpha, MIP-1beta receptor as a fusion cofactor for macrophage-tropic HIV-1. Science 272: 19551958.
  • 4
    Feng Y., Broder C.C., Kennedy P.E., Berger E.A. (1996) HIV-1 entry cofactor: functional cDNA cloning of a seven-transmembrane, G protein-coupled receptor. Science 272: 8727.
  • 5
    Dimitrov D.S. (2004) Virus entry: molecular mechanisms and biomedical applications. Nat Rev Microbiol 2: 10922.
  • 6
    Smith A.E., Helenius A. (2004) How viruses enter animal cells. Science 304: 23742.
  • 7
    Shimizu N., Tanaka A., Oue A., Mori T., Ohtsuki T., Apichartpiyakul C., Uchiumi H., Nojima Y., Hoshino H. (2009) Broad usage spectrum of G protein-coupled receptors as coreceptors by primary isolates of HIV. AIDS 23: 7619.
  • 8
    Gharu L., Ringe R., Bhattacharya J. (2012) Evidence of extended alternate coreceptor usage by HIV-1 clade C envelope obtained from an Indian patient. Virus Res 163: 4104.
  • 9
    Rucker J., Edinger A.L., Sharron M., Samson M., Lee B., Berson J.F., Yi Y., Margulies B., Collman R.G., Doranz B.J., Parmentier M., Doms R.W. (1997) Utilization of chemokine receptors, orphan receptors, and herpesvirus-encoded receptors by diverse human and simian immunodeficiency viruses. J Virol 71: 89999007.
  • 10
    Rosenberg Y.J., Anderson A.O., Pabst R. (1998) HIV-induced decline in blood CD4/CD8 ratios: viral killing or altered lymphocyte trafficking? Immunol Today 19: 1017.
  • 11
    Wilkin T.J., Su Z., Kuritzkes D.R., Hughes M., Flexner C., Gross R., Coakley E., Greaves W., Godfrey C., Skolnik P.R., Timpone J., Rodriguez B., Gulick R.M. (2007) HIV type 1 chemokine coreceptor use among antiretroviral-experienced patients screened for a clinical trial of a CCR5 inhibitor: AIDS Clinical Trial Group A5211. Clin Infect Dis 44: 5915.
  • 12
    Samleerat T., Phiayura P., Hongjaisee S., Sirirungsi W., Ngo-Giang-Huong N., Barin F. (2012) High prevalence of CXCR4-using viruses in vertically HIV-1-infected infants in Thailand. J Int AIDS Soc 15: 18230.
  • 13
    Lockey T.D., Slobod K.S., Rencher S.D., Srinivas R.V., Hurwitz J.L. (1996) Fluctuating diversity in the HTLV-IIIB virus stock: implications for neutralization and challenge experiments. AIDS Res Hum Retroviruses 12: 12979.
  • 14
    Keogan S., Passic S., Krebs F.C. (2012) Infection by CXCR4-tropic human immunodeficiency virus type 1 is inhibited by the cationic cell-penetrating peptide derived from HIV-1 Tat. Int J Pept 2012: 349427.
  • 15
    Shimizu N., Tanaka A., Oue A., Mori T., Apichartpiyakul C., Hoshino H. (2008) A short amino acid sequence containing tyrosine in the N-terminal region of G protein-coupled receptors is critical for their potential use as co-receptors for human and simian immunodeficiency viruses. J Gen Virol 89: 312636.
  • 16
    Soda Y., Shimizu N., Jinno A., Liu H.Y., Kanbe K., Kitamura T., Hoshino H. (1999) Establishment of a new system for determination of coreceptor usages of HIV based on the human glioma NP-2 cell line. Biochem Biophys Res Commun 258: 31321.
  • 17
    Kawakami Y., Rosenberg S.A. (1997) Immunobiology of human melanoma antigens MART-1 and gp100 and their use for immuno-gene therapy. Int Rev Immunol 14: 17392.
  • 18
    Nishiyama C., Nishiyama M., Ito T., Masaki S., Maeda K., Masuoka N., Yamane H., Kitamura T., Ogawa H., Okumura K. (2004) Overproduction of PU.1 in mast cell progenitors: its effect on monocyte- and mast cell-specific gene expression. Biochem Biophys Res Commun 313: 51621.
  • 19
    Nolan G.P., Shatzman A.R. (1998) Expression vectors and delivery systems. Curr Opin Biotechnol 9: 44750.
  • 20
    Shimizu N.S., Shimizu N.G., Takeuchi Y., Hoshino H. (1994) Isolation and characterization of human immunodeficiency virus type 1 variants infectious to brain-derived cells: detection of common point mutations in the V3 region of the env gene of the variants. J Virol 68: 61305.
  • 21
    Ratner L., Fisher A., Jagodzinski L.L., Liou R.S., Mitsuya H., Gallo R.C., Wong-Staal F. (1987) Complete nucleotide sequences of functional clones of the virus associated with the acquired immunodeficiency syndrome, HTLV-III/LAV. Haematol Blood Transfus 31: 4046.
  • 22
    Yamaguchi K., Byrn R.A. (1995) Clinical isolates of HIV-1 contain few pre-existing proteinase inhibitor resistance-conferring mutations. Biochim Biophys Acta 1253: 13640.
  • 23
    Jinno A., Shimizu N., Soda Y., Haraguchi Y., Kitamura T., Hoshino H. (1998) Identification of the chemokine receptor TER1/CCR8 expressed in brain-derived cells and T cells as a new coreceptor for HIV-1 infection. Biochem Biophys Res Commun 243: 497502.
  • 24
    Hoshino H., Esumi H., Miwa M., Shimoyama M., Minato K., Tobinai K., Hirose M., Watanabe S., Inada N., Kinoshita K., Kamihira S., Ichimaru M., Sugimura T. (1983) Establishment and characterization of 10 cell lines derived from patients with adult T-cell leukemia. Proc Natl Acad Sci USA 80: 60615.
  • 25
    Seibert C., Veldkamp C.T., Peterson F.C., Chait B.T., Volkman B.F., Sakmar T.P. (2008) Sequential tyrosine sulfation of CXCR4 by tyrosylprotein sulfotransferases. Biochemistry 47(11): 25162.
  • 26
    Chalmet K., Dauwe K., Foquet L., Baatz F., Seguin-Devaux C., Van Der Gucht B., Vogelaers D., Vandekerckhove L., Plum J., Verhofstede C. (2012) Presence of CXCR4-using HIV-1 in patients with recently diagnosed infection: correlates and evidence for transmission. J Infect Dis 205: 17484.
  • 27
    Farzan M., Choe H., Vaca L., Martin K., Sun Y., Desjardins E., Ruffing N., Wu L., Wyatt R., Gerard N., Gerard C., Sodroski J. (1998) A tyrosine-rich region in the N terminus of CCR5 is important for human immunodeficiency virus type 1 entry and mediates an association between gp120 and CCR5. J Virol 72: 11604.
  • 28
    Hatse S., Princen K., Gerlach L.O., Bridger G., Henson G., De Clercq E., Schwartz T.W., Schols D. (2001) Mutation of Asp(171) and Asp(262) of the chemokine receptor CXCR4 impairs its coreceptor function for human immunodeficiency virus-1 entry and abrogates the antagonistic activity of AMD3100. Mol Pharmacol 60: 16473.

Supporting Information

  1. Top of page
  2. ABSTRACT
  3. 1 MATERIALS AND METHODS
  4. 2 RESULTS
  5. 3 DISCUSSION
  6. ACKNOWLEDGMENTS
  7. 4 DISCLOSURE
  8. REFERENCES
  9. Supporting Information

Additional supporting information may be found in the online version of this article at the publisher's web site:

FilenameFormatSizeDescription
mim12051-0001-sm-SuppData-S1.tif846K

Data S1 Nucleotide sequence analysis of recovered HIV-1II\IB strain utilizing CXCR4 and its deletion mutant as its coreceptors.

The alignment of the gag nucleotide sequences of the HIV-1IIIB strain. Dots indicate the identity with the parental isolate; letters represent differences in the adapted variants. The positions of the common nucleotide changes are marked by ▾.

mim12051-0002-sm-SuppData-S2.tif424K

Data S2 Amino acid sequence analysis of recovered HIV-1IIIB strain utilizing CXCR4 and its deletion mutant.

The alignment of the gag amino acid sequences of the HIV-1IIIB strain. Dots indicate homology of CXCR4-user to that of CXCR4△NTR23-user.

Please note: Wiley Blackwell is not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing content) should be directed to the corresponding author for the article.