SEARCH

SEARCH BY CITATION

Keywords:

  • ompA;
  • ompB;
  • polymerase chain reaction;
  • Rickettsia monacensis

Abstract

  1. Top of page
  2. Abstract
  3. 1 MATERIALS AND METHODS
  4. 2 RESULTS
  5. 3 DISCUSSION
  6. ACKNOWLEDGMENT
  7. 5 DISCLOSURE
  8. REFERENCES

Rickettsia monacensis, a spotted fever group rickettsia, was isolated from Ixodes nipponensis ticks collected from live-captured small mammals in South Jeolla province, Korea in 2006. Homogenates of tick tissues were inoculated into L929 and Vero cell monolayers using shell vial assays. After several passages, Giemsa staining revealed rickettsia-like organisms in the inoculated Vero cells, but not the L929 cells. Sequencing analysis revealed that the ompA-small part (25–614 bp region), ompA-large part (2849–4455 bp region), nearly full-length ompB (58–4889 bp region) and gltA (196–1236 bp region) of the isolates had similarities of 100%, 99.8%, 99.3% and 99.5%, respectively, to those of R. monacensis. Furthermore, phylogenetic analysis showed that the isolate was grouped into the cluster in the same way as R. monacensis in the trees of all genes examined. These results strongly suggest that the isolate is closely related to R. monacensis. As far as is known, this is the first report of isolation of R. monacensis from ticks in Korea.

List of Abbreviations
A. agrarius

Apodemus agrarius

A. peninsulae

Apodemus peninsulae

C. lasiura

Crocidura lasiura

gltA

citrate synthase gene

H. flava

Haemaphysalis flava

H. longicornis

Haemaphysalis longicornis

I. nipponensis

Ixodes nipponensis

I. ovatus

Ixodes ovatus

I. persulcatus

Ixodes persulcatus

I. ricinus

Ixodes ricinus

M. regulus

Myodes regulus

MSF

Mediterranean spotted fever

ompA

outer membrane protein A gene

ompB

outer membrane protein B gene

R. akari

Rickettsia akari

R. bellii

Rickettsia bellii

R. canadensis

Rickettsia canadensis

R. conorii

Rickettsia conorii

R. felis

Rickettsia felis

R. helvetica

Rickettsia helvetica

R. japonica

Rickettsia japonica

R. massiliae

Rickettsia massiliae

R. monacensis

Rickettsia monacensis

R. prowazekii

Rickettsia prowazekii

R. rickettsii

Rickettsia rickettsii

R. sibirica

Rickettsia sibirica

R. typhi

Rickettsia typhi

SFG

spotted fever group

TG

typhus group

Members of the genus Rickettsia (subfamily Rickettsiae, family: Rickettsiaceae, order: Rickettsiales) are obligate intracellular gram-negative bacteria, 0.8–2.0 µm long and 0.3–0.5 µm wide and consisting of a single circular chromosome of 1.0–1.6 Mbps [1-3]. Rickettsia spp. are zoonotic pathogens classified as part of the SFG (including R. rickettsii, R. massiliae, R. helvetica, and R. akari subgroups), TG (including R. prowazekii and R. typhi), and R. canadensis, R. bellii and other groups [4]. SFG rickettsiae have a worldwide geographic distribution including Japan, China and Russia, all of which are close to the Korean peninsula [1, 5-9], and are transmitted by arthropods such as lice, ticks, chigger mites and fleas. Studies over the past decade have shown that many of the rickettsial agents reportedly isolated from ticks result in mild to severe disease in humans, symptoms including high fever (39.5–40°C), headache, eschar and rash [1, 10]. Most ticks associated with the SFG rickettsiae are hard ticks belonging to the family Ixodidae and their distributions are related to rickettsioses [11, 12]. Ticks are parasitic on a wide variety of vertebrate hosts throughout their distribution and demonstrate variable feeding preferences for small to large mammals, birds or other vertebrates, whereas humans are incidental hosts [11].

To diagnose and properly treat rickettsial disease and reduce the potential for rickettsial infections among human populations, it is important to correctly identify Rickettsia spp. and determine their geographic distributions, including associated arthropod vectors and vertebrate reservoirs. Various Rickettsia spp. have been detected and classified by rickettsial gene-based molecular assays and serological analyses in several countries, including Korea [2, 13-16]. However, previous to this report, only R. japonica (isolated from the blood of a patient diagnosed with Japanese spotted fever) had been isolated in Korea [17]. In this study, ticks were collected from small mammals (rodents and soricomorphs) captured in South Jeolla province, Korea and examined for Rickettsia spp. Subsequently, rickettsial agents were isolated and characterized by comparative analysis of selected gene fragments.

1 MATERIALS AND METHODS

  1. Top of page
  2. Abstract
  3. 1 MATERIALS AND METHODS
  4. 2 RESULTS
  5. 3 DISCUSSION
  6. ACKNOWLEDGMENT
  7. 5 DISCLOSURE
  8. REFERENCES

1.1 Collection and processing of ticks

Small mammals were live-captured using Sherman traps (7.7 × x 9 × 23 cm; H.B. Sherman, Tallahassee, FL, USA) in South Jeolla province, Korea, from March through November, 2006, as described by O'Guinn et al. [18]. The traps containing small animals were numbered sequentially and transported to Gwangju Health College, where they were killed in accordance with an approved animal use protocol, examined for ectoparasites (ticks and fleas) and their species identified. After identification of species, 1–10 ticks pooled in 2 mL cryovials according to date, site of collection and specific mammalian host. A total of 29 tick pools were eventually prepared and used for the rickettsial isolation.

1.2 Isolation of rickettsiae using shell vial assay

Ticks in each pool were washed twice in 70% alcohol and once in sterile distilled water, then mashed with filtered pipet tips in 200 µL of Eagle's minimum essential medium (Welgene, Daegu, Korea). Aliquots of each of the ground pools were inoculated into shell vials containing a monolayer of L929 cells and Vero cells for shell vial assay to isolate any rickettsial agents [19]. After several subcultures, a subsample of cells from each subculture was transferred to 1.5 mL cryovials and centrifuged at 1000 g for 3 mins. The cells were then resuspended in 0.1 mL PBS and a drop placed onto a glass slide, which was then fixed, and stained with Giemsa to detect any rickettsial agents present. Additionally, Rickettsia spp. were detected from the cells or culture supernatant by PCR using rickettsia specific primers as described below.

1.3 DNA extraction, polymerase chain reaction and cloning

Total genomic DNA was extracted using 15% (wt/vol) Chelex-100 (Bio-Rad, Hercules, CA, USA) as described by Choi et al. [15]. The 17 kDa antigen gene, outer membrane protein A (ompA) encoding gene, outer membrane protein B (ompB) encoding gene, and citrate synthase gene (gltA) primer sets used for the amplification of rickettsial DNA were based on sequences obtained from the GenBank database (National Institutes of Health, Rockville Pike, Bethesda, MD, USA) and synthesized by Bioneer (Daejeon, Korea) (Table 1). The Rr17k.1p and Rr17k.539n primers were designed based on 17 kDa antigen gene and have been used for detection of various rickettsiae. To amplify the ompA-small part (region of ompA 1–645 bp: 645 bp) and the ompA-large part (region of ompA 2829–4479 bp: 1651 bp), “190-70F, RompA642R” and “190-3588F, 190-5238R” primers, respectively, were used. For amplification of the full-length coding sequence of ompB, two regions were cloned; the ompB-beginning section (region of ompB 1–2654 bp: 2654 bp) and the ompB-end section (region of ompB 2552–4911 bp: 2360 bp) and “Rc.rompB.1p, Rc.rompB.2654n” and “Rc.rompB.2552p, Rc.rompB.4911n” primers, respectively, used to amplify the regions. RpCS.62p and RpCS.1258n primers were used for amplification of gltA (region of gltA 62–1258 bp: 1197 bp). A top-Taq DNA polymerase kit (CoreBio, Seoul, Korea), 2 µL of template DNAs and 1 µL of 20 pmol primers were used for amplification and PCR reactions run on a Veriti 96 well Thermal Cycler (Applied Biosystems, Foster, CA, USA). ompA PCR products were purified using a PCR quick-spin PCR product purification kit (iNtRON, Sungnam, Korea) and ompB PCR products cloned using the pGEM-T Easy Vector System I (Promega, Madison, WI, USA) according to the manufacturer's protocols. Plasmid DNAs were confirmed in regards to whether clones contained DNA inserts by enzyme digestion. The purified ompA-PCR products and plasmid DNAs inserted with ompB were prepared for sequence analyses.

Table 1. Nucleotide sequences of primers and conditions for PCR (P) and sequencing (S) used in this study
Target genesaPrimerNucleotide sequence (5′ [RIGHTWARDS ARROW] 3′)Products size (bp)PCR conditionGene positionRef.
Denaturation (°C)cAnnealing (°C)cExtension (°C)cCycles
  • a

    17 kDa, Rickettsia genus-specific outer membrane antigen gene;

  • b

    reverse orientation;

  • c

    temperature (°C);

  • small part, 1–645 region of ompA;

  • large part, 2829–4479 region of ompA;

  • §

    beginning part, 1–2654 region of ompB;

  • end part, 2552–4911 region of ompB.

17 kDaRr17k.1ppTTTACAAAATTCTAAAAACCAT539954772351–2213
 Rr17k.539nbpTCAATTCACAACTTGCCATT     539–52013
ompA190-70FpsATGGCGAATATTTCTCCAAAA645945072401–2120
 RompA642RbpsATTACCTATTGTTCCGTTAATGGCA     645–621 
 190-3588FpsAACAGTGAATGTAGGAGCAG1651944572402829–284820
 190-5238RbpACTATTAAAGGCTAGGCTATT     4479–445920
 RompARm4433RbsGAATTTAAGGTTACTATACCTTC     3659–3637 
 RompA1FsGAATAACATTACAVGCYGGAGGAAG     2849–287321
 190-5044RbsAACTTGTAGCACCTGCCGT     4282–426220
 RhoA4336FsAGTTCAAATGCAAATGACCGTA     3574–359521
ompB§Rc.rompB.1ppsATGGCTCAAAAACCAAATTTTC2654945072351–22 
 §Rc.rompB.2654nbpsCCTACGGTACTTTTAATTGTTA     2654–2633 
 Rc.rompB.2552ppsCTTTTCAAAATKGAAGTTTAGG2360945072352552–2573 
 Rc.rompB.4911nbpsTTAGAAGTTTACACGKACTTTT     4911–489037
 §120-611bsAAACCTTTAGCTTGGTTACC     611–592 
 §120-1402bsTTATAACTCGGCAGTATGTGTT     1402–1380 
 §120-1935bsGAATTGRACTGAACCGTTAT     1935–1916 
 §120-1419bsTTAACCGGCATTTCCTAAACGTAA     1419–1396 
 §120-1222 sGGTAATTTTACAGGTGATGC     1222–1241 
 §120-1854 sCGGCTCAAGTAAAACAGTTT     1854–1873 
 120-3415bsTACTTCCGGTTACAGCAAAGT     3415–339737
 120-2971 sATTGCAACTAACACAACAATTA     2971–2993 
 120-4160bsTCTAAACCRAYTACRACMCCRG     4160–4139 
 120-4378bsCGAAGAAGTAACGCTGACTT     4378–435937
 120-4264 sGGTTTCTCATTCTCTCTATATGG     4264–428637
 §,M13FsCAGGGTTTTCCCAGTCACGA       
 §,M13RbsGAAACAGCTATGACCATG       
gltARpCS.62ppsGCAAGTATCGGTGAGGATGTAN11979452723562–84 
 RpCS.1258nbpsATTGCAAAAAGTACAGTGAACA     1258–123727
 RpCS.877psGGGGACCTGCTCACGGCGG     877–89522
 RpCS.746nbsGCTCATCCGGAGCTAACCCTN     746–726 

1.4 Determination and analysis of nucleotide sequences

Determination of sequences of the amplified PCR products was performed at Genotech (Daejeon, Korea) using specific primer sets (Table 1). Primers used for the sequence analysis of the ompA-small part were 190-70F (1 bp region), RompA642R (645 bp region) and 590 bp sequence from 25 to 614 bp. The primers used to analyze the ompA-large part sequences were 190-3588F (2829 bp region), RompARm4433R (3637 bp region), RompA1F (2849 bp region), 190-5044R (4282 bp region) and RhoA4336F (3574 bp region). For analysis of ompA-large part sequences, the sequence (831 bp from 2829 to 3659 bp) of the ompA-large part was confirmed using 190-3588F and RompARm4433R primers. In addition, the approximately 800 bp sequence forward direction starting from 2849 to 3574 bp was confirmed using RompA1F and RhoA4336F primers, respectively, and confirmed using the 190-5044R primer reverse direction from the 4282 bp region. The sequences for the partial ompA-large part were combined as one gene (1607 bp, from 2849 to 4455 bp). Primers used for the sequence analysis of the front part of ompB were Rc.rompB.1p, Rc.rompB.2,654n, M13F, M13R, 120-611, 120–1402, 120–1935, 120–1419, 120–1222 and 120–1854, whereas the primers used for sequence analysis of the end part of ompB were Rc.rompB.2,552p, Rc.rompB.4911n, M13F, M13R, 120-3415, 120–2971, 120–4160, 120-4378 and 120-4264. All sequences were confirmed in duplicate. The partial sequences were combined as one full ompB (4832 bp from 58 to 4889 bp). For sequence analysis of gltA, RpCS.62p, RpCS.1258n, RpCS.877p and RpCS.746n primers were used.

Sequence analyses were performed using the Clustal W of MegAlign software package (DNASTAR, Lasergene 7.1, Madison, WI, USA) according to the manufacturer's instructions. To investigate tree stability, bootstrap analysis was performed with 1000 iterations.

2 RESULTS

  1. Top of page
  2. Abstract
  3. 1 MATERIALS AND METHODS
  4. 2 RESULTS
  5. 3 DISCUSSION
  6. ACKNOWLEDGMENT
  7. 5 DISCLOSURE
  8. REFERENCES

2.1 Distribution of captured wild small mammals

In all, 82 small mammals (49 Apodemus agrarius, 17 Apodemus peninsulae, 10 Myodes regulus, and 6 Crocidura lasiura) were captured in South Jeolla province from March through November, 2006. A total of 63 ticks were collected from 29/82 of those mammals. Tick infestation rates were highest for C. lasiura (number of infested mammals/total number of species, 3/6; 50.0%), followed by A. agrarius (18/49; 36.7%), A. peninsulae (6/17; 35.3%) and M. regulus (2/10; 20.0%). Of the infested small mammals, tick indices were the highest for A. peninsulae (number of ticks collected/number of infested animals, 28 ticks/6 rodents; 3.0%) and M. regulus (6/2; 3.0%), followed by C. lasiura (6/3; 2.0%) and A. agrarius (33/49; 1.8%). All of the ticks collected from the small mammals were Ixodes nipponensis nymphs.

2.2 Isolation and identification of rickettsiae

Sixteen of the total 29 tick pools (55.2%) were positive for 17 kDa rickettsial antigen gene. For each of the 16 positive pools, blind subcultures were performed by shell vial culture. At the fifth passage, monolayers of these infected cells were harvested and placed into 25 cm2 flasks containing monolayers of Vero cells. Cytopathic effects were observed in Vero cells when the level of infected cells reached five passages. After staining the inoculated Vero cells with Giemsa, rickettsia-like organisms were observed in their cytoplasm (Fig. 1).

image

Figure 1. Giemsa stain of rickettsial isolate MT34 in Vero cells. The isolate was inoculated into Vero cell monolayers in a four well chamber slide (Lab-Tek II chamber slide, Nalge-Nunc International, Naperville, IL, USA). Four days after inoculation, the cells were fixed and prepared for Giemsa staining. The arrows indicate bacteria in the cytoplasm of cells (100 ×).

Download figure to PowerPoint

Four weeks post-inoculation, DNA was extracted from the cell cultures with rickettsia-PCR-positive tick samples and PCR for 17 kDa antigen gene performed using the DNA from the infected cells to confirm the presence of rickettsial isolates. PCRs for ompA-small part (645 bp) and ompA-large part (1651 bp) were further conducted in subsequent subcultures to identify rickettsial isolates. Several PCR products of rickettsiae in the infected cells from pools of I. nipponensis obtained from MT22 (A. peninusulae), MT34 (A. agrarius), MT76 (A. agrarius) and MT79 (C. lasiura), where MTxx is the small mammal serial number, were identical to one another according to sequence analysis. Only isolate MT34 was successfully established. The remaining isolates (MT22, MT76 and MT79) could not be maintained using L929 and Vero cells.

2.3 Sequence analysis

Sequences of amplified products (ompA-small part, ompA-large part, ompB and gltA) of isolate MT34 were compared to rickettsial sequences which have previously been published in the GenBank database. This comparison showed that the isolate is closely related to R. monacensis. The similarities of ompA-small part (590 bp, 25–614 bp region), ompA-large part (1607 bp, 2849–4455 bp region), almost full-length ompB (4832 bp, 58–4889 bp region), and gltA (1041 bp, 196–1236 bp region) of the isolate with those of R. monacensis were 100%, 99.8% (3 nucleotide differences), 99.3% (35 nucleotide differences) and 99.5% (8 nucleotide differences), respectively. Phylogenetic analyses supported the isolate M34 being grouped into the same cluster as R. monacensis in the trees of all genes tested (Figs. 2-5). Additionally, the tree of gltA showed that Rickettsia sp. IRS3 located in the same cluster as R. monacensis was also closely related to the isolate (with 99.6% similarity) (Fig. 5).

image

Figure 2. Phylogenetic tree representing relationships between the partial ompA-small part sequences of various rickettsial strains and the ompA-small part product amplified from DNA of cells infected with MT34. The phylogenetic tree was constructed using MegAlign software and bootstrap analysis was performed with 1000 replicates.

Download figure to PowerPoint

image

Figure 3. Phylogenetic tree representing relationships between the partial ompA-large part sequences of various rickettsial strains and the ompA-large part product amplified from DNA of cells infected with MT34. The phylogenetic tree was constructed using MegAlign software and bootstrap analysis was performed with 1000 replicates.

Download figure to PowerPoint

image

Figure 4. Phylogenetic tree representing relationships between the full ompB sequences of various rickettsial strains and the full ompB of sequence of MT34. The phylogenetic tree was constructed using MegAlign software and bootstrap analysis was performed with 1000 replicates.

Download figure to PowerPoint

image

Figure 5. Phylogenetic tree representing relationships between the partial gltA sequences of various rickettsial strains and the gltA of sequence of MT34. The phylogenetic tree was constructed using MegAlign software and bootstrap analysis was performed with 1000 replicates.

Download figure to PowerPoint

2.4 Nucleotide sequence accession numbers

The GenBank accession numbers of the ompA-small part, ompA-large part, ompB, and gltA sequences for MT34 are JX972178, JX625149, JX625150 and JX972177, respectively.

3 DISCUSSION

  1. Top of page
  2. Abstract
  3. 1 MATERIALS AND METHODS
  4. 2 RESULTS
  5. 3 DISCUSSION
  6. ACKNOWLEDGMENT
  7. 5 DISCLOSURE
  8. REFERENCES

Rickettsia spp., zoonotic pathogens of veterinary and medical importance, are transmitted by arthropods to vertebrate hosts and, incidentally, to humans [1]. Rickettsiae are distributed worldwide [11]; various rickettsiae have been reported in Korea. Rickettsial DNAs related to R. japonica, R. conorii and other SFG rickettsiae have been detected in Haemaphysalis spp. collected in Chungju city [23, 24]. SFG rickettsiae that are closely related to R. japonica and R. monacensis have also been identified in Haemaphysalis spp. from Jeju island [25]. As to serologic evidence of the presence of these species in Korea, antibodies to R. japonica were identified by indirect immunofluorescence assay in 2004 in a patient with an acute febrile illness [16]. Additionally, indirect immunofluorescence showed antibodies for R. sibirica, R. conorii, R. akari were prevalent in sera of patients with acute febrile illnesses [26]. Furthermore, R. akari, R. japonica, R. sibirica, R. conorii and R. felis have been detected by PCR in human sera [15, 27].

To diagnose and properly treat rickettsiosis and to develop and institute strategies for mitigation of the risk of rickettsial disease, it is important to clarify the distribution of SFG rickettsial pathogens, arthropod vectors and vertebrate hosts, and also the human activities that increase transmission risks. In this study, both the centrifugation-shell vial technique and molecular-based methods such as PCR and sequencing were used to isolate and identify rickettsial agents from ticks. For PCR, the target genes we used were the 17 kDa antigen gene, ompA (small and large parts), ompB and gltA genes. These genes are usually used to detect rickettsiae and identify their species, especially for SFG rickettsiae [28-30]. The ompA gene is specific for SFG rickettsiae and includes a domain comprised of 6–10 tandem repeat units with almost identical sequences [30-32]. Although there are differences in the number and sequence of ompA repeat units among rickettsial species, except for the repeat units the sequences have highly been conserved [20, 30]. Therefore, we selected two sets of PCR primers (small and large parts) that target the ompA in front of and behind the repeat regions. The full sequences of the ompB of several Rickettsia species, namely R. prowazekii, R. typhi, R. rickettsii and R. japonica, have been reported [30, 33, 34]. PCR-RFLP analysis of the ompB fragment has also been used to identify SFG rickettsiae, except for R. africae and R. parkeri [35]. gltA encodes citrate synthase, an enzyme for a central metabolic pathway that plays a key role in energy production and provides important biosynthetic precursors [36]. The gene is located on the chromosomes and is conserved among rickettsiae. The gltA sequence is informative and has been well-used to analyze the evolutionary relationships among closely related rickettsiae [20]. ompA and ompB have also been used for phylogenetic analysis of members of the genus Rickettsia [36, 37]. Accordingly, we selected these genes in several rickettsial species for comparative analysis of MT34 isolate. We further determined the full-length sequence of the ompB of the MT34 isolate and compared it with those of other rickettsiae to identify more precisely the rickettsial species of this isolate.

Rickettsia monacensis was first isolated from I. ricinus collected from the English Garden in Germany in 1998 [38]. Subsequently, R. monacensis was detected in I. ricinus ticks collected in Slovakia, Italy, Hungary, Portugal and Morocco [39-43] and from migratory birds in Europe [44, 45]. In addition, Rickettsia spp. IRS3 was detected in Hyalomma plumbeum and Rhipicephalus bursa infesting cattle in Albania [46]. R. monacensis, which was first isolated from patients in Spain, causes an MSF-like rickettsial disease [47] and was more recently detected in Italy [48]. Until now, R. monacensis has usually been observed only in I. ricinus, in particular, from southern and eastern Europe [49].

Various ixodid ticks, including H. longicornis, H. flava, H. phasiana, Amblyomma testudinarium, I. nipponensis, I. persulcatus and I. ovatus, have been collected throughout the Korean mainland and on Jeju island [50-53]. H. longicornis and H. flava ticks have commonly been collected by sweeping and dragging in South Jeolla province [52], whereas I. nipponensis has been collected primarily from small mammals [51]. In Korea, flag sweeping and dragging techniques often yield more numerous of ticks at all developmental stages (larvae, nymphs and adults) than are normally obtained from small mammals.

This is the first report of the isolation of R. monacensis from I. nipponensis collected from small mammals in Korea. Although infection by R. monacensis has not been reported in Korea, it has been confirmed that R. monacensis is present in H. longicornis on Jeju island [25]. In addition, cases of tick bite by I. nipponensis, a suspected vector of R. monacensis, have been reported [54-56]. Follow-up of patients reporting tick bites is therefore important in order to identify development of symptoms specific to either SFG rickettsiae or to any other tick-borne pathogens that have so far been reported in Korea.

ACKNOWLEDGMENT

  1. Top of page
  2. Abstract
  3. 1 MATERIALS AND METHODS
  4. 2 RESULTS
  5. 3 DISCUSSION
  6. ACKNOWLEDGMENT
  7. 5 DISCLOSURE
  8. REFERENCES

This work was supported by the Armed Forces Health Surveillance Center, Global Emerging Infections Surveillance and Response System (AFHSC-GEIS), Silver Spring, MD, USA.

5 DISCLOSURE

  1. Top of page
  2. Abstract
  3. 1 MATERIALS AND METHODS
  4. 2 RESULTS
  5. 3 DISCUSSION
  6. ACKNOWLEDGMENT
  7. 5 DISCLOSURE
  8. REFERENCES

The authors declare that they have no conflicts of interest.

REFERENCES

  1. Top of page
  2. Abstract
  3. 1 MATERIALS AND METHODS
  4. 2 RESULTS
  5. 3 DISCUSSION
  6. ACKNOWLEDGMENT
  7. 5 DISCLOSURE
  8. REFERENCES
  • 1
    Raoult D., Roux V. (1997) Rickettsioses as paradigms of new or emerging infectious diseases. Clin Microbiol Rev 10: 694719.
  • 2
    Roux V., Raoult D. (1993) Genotypic identification and phylogenetic analysis of the spotted fever group rickettsiae by pulsed-field gel electrophoresis. J Bacteriol 175: 4895904.
  • 3
    Roux V., Drancourt M., Raoult D. (1992) Determination of genome sizes of Rickettsia spp. within the spotted fever group, using pulsed-field gel electrophoresis. J Bacteriol 174: 74557.
  • 4
    Merhej V., Raoult D. (2011) Rickettsial evolution in the light of comparative genomics. Biol Rev Camb Philos Soc 86: 379405.
  • 5
    Ando S., Kurosawa M., Sakata A., Fujita H., Sakai K., Sekine M., Katsumi M., Saitou W., Yano Y., Takada N., Takano A., Kawabata H., Hanaoka N., Watanabe H., Kurane I., Kishimoto T. (2010) Human Rickettsia heilongjiangensis infection, Japan. Emerg Infect Dis 16: 13068.
  • 6
    Fournier P.E., Takada N., Fujita H., Raoult D. (2006) Rickettsia tamurae sp. nov., isolated from Amblyomma testudinarium ticks. Int J Syst Evol Microbiol 56: 16735.
  • 7
    Mahara F. (1997) Japanese spotted fever: report of 31 cases and review of the literature. Emerg Infect Dis 3: 10511.
  • 8
    Mediannikov O., Matsumoto K., Samoylenko I., Drancourt M., Roux V., Rydkina E., Davoust B., Tarasevich I., Brouqui P., Fournier P.E. (2008) Rickettsia raoultii sp. nov., a spotted fever group Rickettsia associated with Dermacentor ticks in Europe and Russia. Int J Syst Evol Microbiol 58: 16359.
  • 9
    Yu X., Jin Y., Fan M., Xu G., Liu Q., Raoult D. (1993) Genotypic and antigenic identification of two new strains of spotted fever group rickettsiae isolated from China. J Clin Microbiol 31: 838.
  • 10
    Chochlakis D., Ioannou I., Sandalakis V., Dimitriou T., Kassinis N., Papadopoulos B., Tselentis Y., Psaroulaki A. (2011) Spotted fever group Rickettsiae in ticks in Cyprus. Microb Ecol 63: 31423.
  • 11
    Azad A.F., Beard C.B. (1998) Rickettsial pathogens and their arthropod vectors. Emerg Infect Dis 4: 17986.
  • 12
    Parola P., Raoult D. (2001) Ticks and tickborne bacterial diseases in humans: an emerging infectious threat. Clin Infect Dis 32: 897928.
  • 13
    Ishikura M., Ando S., Shinagawa Y., Matsuura K., Hasegawa S., Nakayama T., Fujita H., Watanabe M. (2003) Phylogenetic analysis of spotted fever group rickettsiae based on gltA, 17-kDa, and rOmpA genes amplified by nested PCR from ticks in Japan. Microbiol Immunol 47: 82332.
  • 14
    Zavala-Velazquez J.E., Ruiz-Sosa J., Vado-Solis I., Billings A.N., Walker D.H. (1999) Serologic study of the prevalence of rickettsiosis in Yucatán: evidence for a prevalent spotted fever group rickettsiosis. Am J Trop Med Hyg 61: 4058.
  • 15
    Choi Y.J., Lee S.H., Park K.H., Koh Y.S., Lee K.H., Baik H.S., Choi M.S., Kim I.S., Jang W.J. (2005) Evaluation of PCR-based assay for diagnosis of spotted fever group rickettsiosis in human serum samples. Clin Diagn Lab Immunol 12: 75963.
  • 16
    Jang W.J., Kim J.H., Choi Y.J., Jung K.D., Kim Y.G., Lee S.H., Choi M.S., Kim I.S., Walker D.H., Park K.H. (2004) First serologic evidence of human spotted fever group rickettsiosis in Korea. J Clin Microbiol 42: 23103.
  • 17
    Chung M.H., Lee S.H., Kim M.J., Lee J.H., Kim E.S., Kim M.K., Park M.Y., Kang J.S. (2006) Japanese spotted fever, South Korea. Emerg Infect Dis 12: 11224.
  • 18
    O'Guinn M.L., Klein T.A., Lee J.S., Kim H.C., Baek L.J., Chong S.T., Turell M.J., Burkett D.A., Schuster A., Lee I.Y., Yi S.H., Sames W.J., Song K.J., Song J.W. (2008) Ecological surveillance of small mammals at firing points 10 and 60, Gyeonggi Province, Republic of Korea, 2001- 2005. J Vector Ecol 33: 37084.
  • 19
    Marrero M., Raoult D. (1989) Centrifugation-shell vial technique for rapid detection of Mediterranean spotted fever rickettsia in blood culture. Am J Trop Med Hyg 40: 1979.
  • 20
    Fournier P.E., Roux V., Raoult D. (1998) Phylogenetic analysis of spotted fever group rickettsiae by study of the outer surface protein rOmpA. Int J Syst Bacteriol 48: 83949.
  • 21
    Jiang J., Blair P.J., Felices V., Moron C., Cespedes M., Anaya E., Schoeler G.B., Sumner J.W., Olson J.G., Richards A.L. (2005) Phylogenetic analysis of a novel molecular isolate of spotted fever group rickettsiae from northern Peru: Candidatus Rickettsia andeanae. Ann N Y Acad Sci 1063: 33742.
  • 22
    Regnery R.L., Spruill C.L., Plikaytis B.D. (1991) Genotypic identification of rickettsiae and estimation of intraspecies sequence divergence for portions of two rickettsial genes. J Bacteriol 173: 157689.
  • 23
    Lee J.H., Park H.S., Jung K.D., Jang W.J., Koh S.E., Kang S.S., Lee I.Y., Lee W.J., Kim B.J., Kook Y.H., Park K.H., Lee S.H. (2003) Identification of the spotted fever group rickettsiae detected from Haemaphysalis longicornis in Korea. Microbiol Immunol 47: 3014.
  • 24
    Lee J.H., Ahn S.J., Park H.S., Jeong E.J., Choi H.G., Jang W.J., Kang S.S., Park K.H., Kim B.J., Kook Y.H., Lee S.H. (2005) Prevalence of spotted fever group Rickettsia from Haemaphysalis ticks in Chungju Province. J Bacteriol Virol 35: 2037.
  • 25
    Moon B.C., Jeong J.H., Choi Y.J., Kim J.E., Seo H.J., Shin E.H., Song B.G., Lee H.I., Lee S.H., Park K.H., Jang W.J. (2009) Detection and identification of the spotted fever group rickettsial agents from Haemaphysalis ticks in Jeju Island, Korea. J Bacteriol Virol 39: 31727.
  • 26
    Jang W.J., Choi Y.J., Kim J.H., Jung K.D., Ryu J.S., Lee S.H., Yoo C.K., Paik H.S., Choi M.S., Park K.H., Kim I.S. (2005) Seroepidemiology of spotted fever group and typhus group rickettsioses in humans, South Korea. Microbiol Immunol 49: 1724.
  • 27
    Choi Y.J., Jang W.J., Ryu J.S., Lee S.H., Park K.H., Paik H.S., Koh Y.S., Choi M.S., Kim I.S. (2005) Spotted fever group and typhus group rickettsioses in humans, South Korea. Emerg Infect Dis 11: 23744.
  • 28
    Anderson B.E., Regnery R.L., Carlone G.M., Tzianabos T., McDade J.E., Fu Z.Y., Bellini W.J. (1987) Sequence analysis of the 17-kilodalton-antigen gene from Rickettsia rickettsii. J Bacteriol 169: 238590.
  • 29
    Anderson B.E., Tzianabos T. (1989) Comparative sequence analysis of a genus-common rickettsial antigen gene. J Bacteriol 171: 5199201.
  • 30
    Stenos J., Walker D.H. (2000) The rickettsial outer-membrane protein A and B genes of Rickettsia australis, the most divergent Rickettsia of the spotted fever group. Int J Syst Evol Microbiol 50: 17759.
  • 31
    Anderson B.E., McDonald G.A., Jones D.C., Regnery R.L. (1990) A protective protein antigen of Rickettsia rickettsii has tandemly repeated, near-identical sequences. Infect Immun 58: 27609.
  • 32
    Roux V., Fournier P.E., Raoult D. (1996) Differentiation of spotted fever group rickettsiae by sequencing and analysis of restriction fragment length polymorphism of PCR-amplified DNA of the gene encoding the protein rOmpA. J Clin Microbiol 34: 205865.
  • 33
    Carl M., Dobson M.E., Ching W.M., Dasch G.A. (1990) Characterization of the gene encoding the protective paracrystalline-surface-layer protein of Rickettsia prowazekii: presence of a truncated identical homolog in Rickettsia typhi. Proc Natl Acad Sci USA 87: 823741.
  • 34
    Gilmore R.D. Jr., (1990) Characterization of the 120-kDa surface protein gene of Rickettsia rickettsii (R strain). Ann N Y Acad Sci 590: 45967.
  • 35
    Eremeeva M., Yu X., Raoult D. (1994) Differentiation among spotted fever group rickettsiae species by analysis of restriction fragment length polymorphism of PCR-amplified DNA. J Clin Microbiol 32: 80310.
  • 36
    Roux V., Rydkina E., Eremeeva M., Raoult D. (1997) Citrate synthase gene comparison, a new tool for phylogenetic analysis, and its application for the rickettsiae. Int J Syst Bacteriol 47: 25261.
  • 37
    Roux V., Raoult D. (2000) Phylogenetic analysis of members of the genus Rickettsia using the gene encoding the outer-membrane protein rOmpB (ompB). Int J Syst Evol Microbiol 50: 144955.
  • 38
    Simser J.A., Palmer A.T., Fingerle V., Wilske B., Kurtti T.J., Munderloh U.G. (2002) Rickettsia monacensis sp. nov., a spotted fever group Rickettsia, from ticks (Ixodes ricinus) collected in a European city park. Appl Environ Microbiol 68: 455966.
  • 39
    Beninati T., Lo N., Noda H., Esposito F., Rizzoli A., Favia G., Genchi C. (2002) First detection of spotted fever group rickettsiae in Ixodes ricinus from Italy. Emerg Infect Dis 8: 9836.
  • 40
    Sanogo Y.O., Parola P., Shpynov S., Camicas J.L., Brouqui P., Caruso G., Raoult D. (2003) Genetic diversity of bacterial agents detected in ticks removed from asymptomatic patients in Northeastern Italy. Ann N Y Acad Sci 990: 18290.
  • 41
    Milhano N., de Carvalho I.L., Alves A.S., Arroube S., Soares J., Rodriguez P., Carolino M., Núncio M.S., Piesman J., de Sousa R. (2010) Coinfections of Rickettsia slovaca and Rickettsia helvetica with Borrelia lusitaniae in ticks collected in a Safari Park, Portugal. Ticks Tick borne Dis 1: 1727.
  • 42
    Sréter-Lancz Z., Sréter T., Széll Z., Egyed L. (2005) Molecular evidence of Rickettsia helvetica and R. monacensis infections in Ixodes ricinus from Hungary. Ann Trop Med Parasitol 99: 32530.
  • 43
    Sarih M., Socolovschi C., Boudebouch N., Hassar M., Raoult D., Parola P. (2008) Spotted fever group rickettsiae in ticks, Morocco. Emerg Infect Dis 14: 106773.
  • 44
    Elfving K., Olsen B., Bergström S., Waldenström J., Lundkvist A., Sjöstedt A., Mejlon H., Nilsson K. (2010) Dissemination of spotted fever Rickettsia agents in Europe by migrating birds. PLoS ONE 5: e8572.
  • 45
    Hildebrandt A., Franke J., Meier F., Sachse S., Dorn W., Straube E. (2010) The potential role of migratory birds in transmission cycles of Babesia spp., Anaplasma phagocytophilum, and Rickettsia spp. Ticks Tick borne Dis 1: 1057.
  • 46
    Christova I., Van De Pol J., Yazar S., Velo E., Schouls L. (2003) Identification of Borrelia burgdorferi sensu lato, Anaplasma and Ehrlichia species, and spotted fever group rickettsiae in ticks from Southeastern Europe. Eur J Clin Microbiol Infect Dis 22: 53542.
  • 47
    Jado I., Oteo J.A., Aldámiz M., Gil H., Escudero R., Ibarra V., Portu J., Portillo A., Lezaun M.J., García-Amil C., Rodríguez-Moreno I., Anda P. (2007) Rickettsia monacensis and human disease, Spain. Emerg Infect Dis 13: 14057.
  • 48
    Madeddu G., Mancini F., Caddeo A., Ciervo A., Babudieri S., Maida I., Fiori M.L., Rezza G., Mura M.S. (2012) Rickettsia monacensis as cause of Mediterranean spotted fever-like illness, Italy. Emerg Infect Dis 18: 7024.
  • 49
    Schorn S., Pfister K., Reulen H., Mahling M., Silaghi C. (2011) Occurrence of Babesia spp., Rickettsia spp. and Bartonella spp. in Ixodes ricinus in Bavarian public parks, Germany. Parasit Vectors 4: 135.
  • 50
    Cho B.K., Lee W.K. (2004). Mite and tick related dermatoses. Seoheung Publishing Company. Yongsan, Seoul.
  • 51
    Kim H.C., Han S.H., Chong S.T., Klein T.A., Choi C.Y., Nam H.Y., Chae H.Y., Lee H., Ko S., Kang J.G., Chae J.S. (2011) Ticks collected from selected mammalian hosts surveyed in the Republic of Korea during 2008- 2009. Korean J Parasitol 49: 3315.
  • 52
    Ko S., Kang J.G., Kim S.Y., Kim H.C., Klein T.A., Chong S.T., Sames W.J., Yun S.M., Ju Y.R., Chae J.S. (2010) Prevalence of tick-borne encephalitis virus in ticks from Southern Korea. J Vet Sci 11: 197203.
  • 53
    Kim C.M., Yi Y.H., Yu D.H., Lee M.J., Cho M.R., Desai A.R., Shringi S., Klein T.A., Kim H.C., Song J.W., Baek L.J., Chong S.T., O'guinn M.L., Lee J.S., Lee I.Y., Park J.H., Foley J., Chae J.S. (2006) Tick-borne rickettsial pathogens in ticks and small mammals in Korea. Appl Environ Microbiol 72: 576676.
  • 54
    Ko J.H., Cho D.Y., Chung B.S., Kim S.I. (2002) Two human cases of tick bite caused by Ixodes nipponensis. Korean J Parasitol 40: 199203.
  • 55
    Paik S.C., Oh Y.J., Kim S.Y., Cho B.K., Houh W. (1989) A case of tick bite caused by Ixodes nipponensis. Korean J Dermatol 27: 838.
  • 56
    Ryu J.S., Lee J.U., Ahn M.H., Min D.Y., Ree H.I. (1998) A human case of tick bite by Ixodes nipponensis. Korean J Parasitol 36: 5961.