Effects of ceftriaxone-induced intestinal dysbacteriosis on dendritic cells of small intestine in mice

Authors

  • Ming Li,

    1. Department of Microecology, Dalian Medical University, No.9 Western Section, Lvshunkou District, Dalian, China
    Search for more papers by this author
    • These authors contributed equally to this work.
  • Weihua Li,

    1. Department of Microecology, Dalian Medical University, No.9 Western Section, Lvshunkou District, Dalian, China
    Search for more papers by this author
    • These authors contributed equally to this work.
  • Shu Wen,

    1. Department of Microecology, Dalian Medical University, No.9 Western Section, Lvshunkou District, Dalian, China
    Search for more papers by this author
    • These authors contributed equally to this work.
  • Yinhui Liu,

    1. Department of Microecology, Dalian Medical University, No.9 Western Section, Lvshunkou District, Dalian, China
    Search for more papers by this author
  • Li Tang

    Corresponding author
    • Department of Microecology, Dalian Medical University, No.9 Western Section, Lvshunkou District, Dalian, China
    Search for more papers by this author

Correspondence

Li Tang, Department of Microecology, Dalian Medical University, No.9 Western Section, Lvshun South Street, Lvshunkou District, 116044, Dalian, China.

Tel: +86 411 8611 0305; fax: +86 411 8611 0152; email: tangli1484@sina.com

ABSTRACT

Intestinal microflora plays a pivotal role in the development of the innate immune system and is essential in shaping adaptive immunity. Dysbacteriosis of intestinal microflora induces altered immune responses and results in disease susceptibility. Dendritic cells (DCs), the professional antigen-presenting cells, have gained increasing attention because they connect innate and adaptive immunity. They generate both immunity in response to stimulation by pathogenic bacteria and immune tolerance in the presence of commensal bacteria. However, few studies have examined the effects of intestinal dysbacteriosis on DCs. In this study, changes of DCs in the small intestine of mice under the condition of dysbacteriosis induced by ceftriaxone sodium were investigated. It was found that intragastric administration of ceftriaxone sodium caused severe dysteriosis in mice. Compared with controls, numbers of DCs in mice with dysbacteriosis increased significantly (P = 0.0001). However, the maturity and antigen-presenting ability of DCs were greatly reduced. In addition, there was a significant difference in secretion of IL-10 and IL-12 between DCs from mice with dysbacteriosis and controls. To conclude, ceftriaxone-induced intestinal dysbacteriosis strongly affected the numbers and functions of DCs. The present data suggest that intestinal microflora plays an important role in inducing and maintaining the functions of DCs and thus is essential for the connection between innate and adaptive immune responses.

List of Abbreviations
APC

antigen-presenting cell

CD

cluster of differentiation

CFU

colony forming unit

DC

dendritic cell

IL-10

interleukin-10

IL-12

interleukin-12

KM mice

Kunming mice

MACS

magnetic activated cell sorting

MHC-II

MHC class-II

NOD

nucleotide-binding oligomerization domain

PE

phycoerythrin

PerCp

peridinin chlorophyll protein

SEM

standard error of means

TEM

transmission electron microscopy

TLR

Toll-like receptor

The human gastrointestinal tract is inhabited by large numbers of microorganisms that are crucial for regulating gut motility, intestinal barrier homeostasis, nutrient absorption and fat disruption [1, 2]. In addition, they are intimately involved in the development and functionality of innate and adaptive immune responses [3, 4]. Normally, the human intestinal microbiota has a balanced composition that confers health benefits; disruptions of this balance may result in disease susceptibility [5]. It has been suggested that the presence of microflora in the gut is necessary to develop an extensive and activated intestinal immune system [6]. Colonization of the gastrointestinal tract by symbiotic bacteria forms the mucosal immune system, which promotes the integrity of the intestinal barrier function and induces generation of natural immunity responses through TLRs or receptors with NOD that recognize pathogen-associated molecular patterns [7, 8]. Interactions between innate immunity and intestinal microflora also play a significant role in shaping adaptive immunity. Indeed, innate immune responses in infancy can affect the emergence of allergy and impact on whether adaptive immune responses shift towards Th2-type responses [9].

Dendritic cells function as professional APCs and connect innate and adaptive immunity [10]. DCs mature after antigen exposure and signalling through a variety of surface receptors, such as CD205 or TLRs, and endocytosis. Mature DCs in the intestine specifically express CD83 and have a strong antigen presentation function. They stimulate the proliferation and differentiation of T cells via the highly expressed MHC class-II molecules and co-stimulatory molecules that activate naive T cells [11]. Intestinal DCs can also induce helper T cells to differentiate to Th1 or Th2 cells that secrete IL-12 and gamma interferon or IL-4, 5, 10 and 13, respectively, to activate B cells or macrophages [12].

Many studies have shown mutualism between microflora and intestinal immune cells. Intestinal flora dysbacteriosis can affect activation of TLRs, reduce secretion of soluble immunoglobulin A and alter mucosal innate immunity [13]. Dysbacteriosis of intestinal flora can impair differentiation of T-cell subtypes [14] and production of cytokines in the intestinal epithelium, which reduces adaptive immune responses in the intestinal mucosa [15]. However, few studies have focussed on DCs under conditions of intestinal dysbacteriosis.

In the present study, we investigated the effects of ceftriaxone sodium-induced intestinal dysbacteriosis on DCs in the small intestines of mice. We purified DCs directly from the small intestines of mice with dysbacteriosis and analyzed changes in the numbers and function of these cells. We hope that this study will clarify the impact of intestinal microflora on the development of DCs and lay the foundation for further research on interactions between intestinal flora and mucosal immune development, immune responses and susceptibility to human diseases such as irritable bowel syndrome, diabetes mellitus and obesity.

MATERIALS AND METHODS

Animals and chemical reagents

Male KM mice (aged 6–8 weeks, weighing 18 ± 2 g) were provided by the experimental animal center of Dalian Medical University, where they were maintained under specific pathogen-free conditions. Ceftriaxone sodium was purchased from Qili Pharmaceutical (Hainan, China). Anti-CD11c microbeads were obtained from Miltenyi Biotech (Bergisch Gladbach, Germany). Antibodies for fluorescein isothiocyanate-CD11c, PE-MHC class-II, PerCp-CD86, PE-cy5-CD80, PE-CD11b, PerCp-CD8a, PE-CD40, PE-CD83, and PerCp-CD205 were purchased from BioLegend (Franklin Lakes, NJ, USA). A Giemsa staining kit was purchased from Jiancheng (Nanjing, China). The reagents for RNA isolation were from Takara (Kyoto, Japan). All other chemical regents used in the current work were of analytical grade.

Mouse model of intestinal dysbacteriosis induced by ceftriaxone sodium

Eighteen KM mice were administered 0.2 mL of ceftriaxone sodium (400 mg/mL) intra-gastrically twice a day at an interval of 6 hrs for 8 days to establish an intestinal dysbacteriosis mouse model. For controls, 18 KM mice were administered sterile water intra-gastrically instead of ceftriaxone sodium. This animal study was approved by the Medical Ethics Committee of Dalian Medical University, China and performed in accordance with their guidelines.

Preparation of mouse small intestinal contents and analysis of microflora

The small intestinal contents of mice were collected and weighed immediately after they had been killed by cervical dislocation. The contents were diluted with two volumes of PBS buffer and homogenized by vortex oscillator. The homogenized solutions were then diluted from 10−1 to 10−6. Diluted suspensions (20 µL) were plated on selective agar media and cultured at 37°C for 48 or 72 hrs under anaerobic or aerobic conditions, respectively. The selective agar media were as follows: deMan Rogosa Sharpe with vancomycin and bromocresol green medium for Lactobacillus; Baird–Parker agar medium for Staphylococcus; Rose bengal medium for yeasts; Bifidobacterium selective agar; Bacteroid selective agar medium; Enterococcus selective agar; Triphenyl tetrazolium chloride, acridine orange, thallous sulfate, aesculin, crystal violet (TATAC) medium for Streptococcus selection; Veillonella selective (VS) medium for Veillonella; peptococcus and micrococcus selective (PMS) for Peptococcus; fusobacterium selective (FS) for Fusobacterium; and eosin methylene blue agar for Escherichia coli. All the media were purchased from Hangzhou Microbiological, Hangzhou, China. At the defined dilution times, CFUs on each plate were counted and the number of bacteria in each sample determined based on the original weight of the sample at the time of collection.

Preparation of single cell suspensions of small intestinal mucosa

After the contents had been removed, the small intestines were washed with D-Hank's solution three times, then cut into 1–2 cm segments and put into a 250 mL flask. EDTA solution (30 mL) was added and the flask shaken at 250 rpm for 20 mins at 37°C. The suspension was filtered through single-layer 200-mesh nylon net and re-suspended with 10 mL digestion enzyme solution (1.5 mg collagenase IV, 50 µL FBS in 950 µL D-Hank's buffer, [Gibco, Gaithersburg, MD, USA]). It was then shaken at 120 rpm for 50 mins at 37°C. When a cell mass appeared, RPMI-1640 was added to terminate digestion. Finally, a single cell suspension was obtained by filtration through three layers of 200-mesh nylon. This digestion process was repeated three times. The cell suspension was then centrifuged at 100 g for 10 mins and re-suspended in 1 mL RPMI-1640 medium. The cells in the suspension were enumerated using a hemocytometer.

Isolation of dendritic cells

The single cell suspension was filtered through a 30 µm filter and transferred into a new sterile 15 mL tube. The cells were centrifuged at 100 g for 10 mins and re-suspended in MACS buffer (PBS containing 0.5% [w/v] BSA and 2 mM EDTA, pH 7.2; 400 µL per 108 cells). Microbeads (100 µL) with anti-CD11c were added and the mixture incubated at 4°C for 15 mins. After incubation, MACS buffer (1 mL per 107 cells) was directly added to the centrifuge tube to dilute the cells. The suspension was then centrifuged at 100 g for 10 mins and re-suspended in 500 µL MACS buffer. The cell suspension with microbeads was then put in a MS column and washed out with 500 µL MACS buffer. The MS column was placed in a 10 mL tube until the liquid was almost dry, at which time the piston was depressed quickly to collect the cells in the MS column, which were CD11c+ dendritic cells.

Flow cytometry

For flow cytometry analysis, cell suspensions (1 × 106) were incubated with appropriate amounts of monoclonal antibodies. Monoclonal antibodies and cells were incubated on ice in PBS–1% BSA (Shijiqing Medical, Hangzhou, China) for 30 mins and then washed three times with PBS–1% BSA. The cells were gently resuspended in 300 µL 4% paraformaldehyde, incubated for 15 mins at room temperature in the dark and subjected to flow cytometric analysis within 48 hrs. Cells without fluorescent antibody served as negative control.

Detection of cytokine mRNA expression by reverse transcription polymerase chain reaction

Total RNA was isolated from the small intestine using RNAiso reagent (Takara) according to the manufacturer's instruction. Residual genomic DNA was removed by DNase digestion. Following RNA clean up, the RNA concentration was assessed by measuring A260. The concentration of RNA was determined by measuring the absorbance at 260 nm (A260) in a spectrophotometer (NanoVue, USA). cDNA was synthesized by oligo dT-Adeptor primers using AMV Reverse Transcriptase (TaKaRa), under the following conditions: 50°C for 20 mins, 99°C for 5 mins, 5°C for 5 mins, and samples were taken out after the temperature cooled down to 4°C, and saved at -20°C. The PCR for each sample was carried out in a total volume of 25 µL containing 5 µL of cDNA, 5 µL of 5 × PCR buffer (containing 2 mmol/L deoxyribonucleotide triphosphates), 0.25 µL of each forward and backward primer, 0.13 µL TaKaRa Ex Tag HS DNA polymerase and 14.37 µL water. The reaction was performed in a Thermal Cycler PCR Machine (Thermo Scientific, Marietta, OH, USA) using a 30-cycle program starting with denaturation at 94°C for 2 mins followed by a three-step temperature cycling of (94°C for 30 mins, Tm of different primers listed in Table 1, and 72°C for 1 min) and then terminated by 72°C incubation for 7 mins and cooling at 4°C. The PCR products obtained were subjected to gel electrophoresis on 1.5% agarose gels containing 1 × Tris borate EDTA buffer and visualized by staining with ethidium bromide using a UVP biosystem (UVP, Upland, CA, USA). Bands were quantified using gel analysis software (Bio-Rad Laboratories, Hercules, CA, USA). The density of each mRNA band was normalized to the expression of β-actin. Results were expressed as means and SEM of three independent estimations from each group.

Table 1. Primers used for RT-PCR detection
Target geneSequence of primers (5′→3′)Tm (°C)Amplicon size (bp)References
  1. F, forward primer; R, reverse primer.
β-actinF:TGGAATCCTGTGGCATCCATGAAAC60.5348[16]
 R:TAAAACGCAGCTCAGTAACAGTCCG   
IL-10F:ACCTGGTAGAAGTGATGCCCCAGGCA60237[17]
 R:CTATGCAGTTGATGAAGATGTCAAA   
IL-12 p40F:GCAGCTCGCAGCAAAGCAAGAT59438[18]
 R:AGCACGTGAACCGTCCGGAGT   

Statistical analysis

SPSS17.0 software was used for all computations. Student's t-Test was used as indicated by SEM ± SD. A P-value of <0.05 was considered significant.

RESULTS

Ceftriaxone-induced dysbacteriosis in mouse small intestine

To observe the effects of altering gut microflora, we established a mouse model of ceftriaxone sodium-induced dysbacteriosis and used selective media to investigate changes in the proportions of intestinal microorganisms. Compared with the control group, there were significantly fewer anaerobic bacteria such as Escherichia coli, Streptococcus and Lactobacilli in the small intestines of mice with dysbacteriosis (Table 2); some bacteria, such as Staphylococcus aureus, Veillonella, Peptococcus, Fusobacterium, Bacteroides and Bifidobacterium were not detected at all. In contrast, because of their tolerance to ceftriaxone sodium, the populations of yeasts and Enterococcus increased by at least one order of magnitude.

Table 2. The populations of commensal bacteria in mouse small intestine
MicroorganismControl (CFU/g)Dysbacteriosis (CFU/g)
  1. Bacterial colony-forming capacity was defined by the CFU formed by 1 g in logarithmic form; *, P < 0.05, ND, not detectable. All values are expressed as means ± SD.
Escherichia coli4.792 ± 1.6191.234 ± 1.560*
Yeast6.08 ± 0.64807.447 ± 0.394*
Streptococcus8.931 ± 0.4838.202 ± 0.544*
Enterococcus7.413 ± 1.4508.760 ± 0.378*
Lactobacilli8.207 ± 1.0116.010 ± 1.260*
Staphylococcus3.891 ± 0.556ND
Veillonella7.460 ± 0.474ND
Peptococcus3.887 ± 0.229ND
Fusobacterium3.806 ± 0.422ND
Bacteroides6.848 ± 1.649ND
Bifidobacterium6.111 ± 1.964ND

Effect of dysbacteriosis on population and subpopulations of dendritic cells

We isolated DCs by MACS with monoclonal CD11c antibody-bound magnetic beads. CD11c, which is strongly expressed by DCs, is used as an identifying marker of mouse DCs [8]. Thus, the CD11c+ cells in the single cell suspension represented DCs. We then enumerated the DCs by flow cytometry. The population of DCs in the small intestine of mice with dysbacteriosis increased significantly (P = 0.0001, Fig. 1a). To assess the populations of CD11c+CD11b+and CD11c+CD8a+ cells, which are the two major subtypes of DCs, we used fluorescence labeled anti-CD11b-PE and anti-CD8a-PerCp antibodies, respectively. There was no obvious difference between the control and dysbacteriosis groups in the proportions of CD11c+CD11b+ (P = 0.773) and CD11c+CD8a+ (P = 0.235) cells (Fig. 1b).

Figure 1.

The population of DCs and their major subpopulations. (a) The percentage of CD11c+ cells among total cells. (b) The percentage of CD11b+ cells and CD8a+ cells among CD11c+ cells. All values are expressed as SEM ± SD, n = 7. **, P < 0.01.

Effects of intestinal dysbacteriosis on the maturity of dendritic cells

Because it is strongly induced during DC maturation, CD83 is a commonly used marker for mature DCs [19]. Thus, we used fluorescence labeled anti-CD83 antibody to detect the population of CD83+ cells. The proportion of DCs that expressed CD83 in control mice was 39.58% (Fig. 2), double that of the dysbacteriosis group (16.43%; P = 0.003).

Figure 2.

The proportion of CD83+ cells among CD11C+ cells. All values are expressed as SEM ± SD, n = 7. **, P < 0.01.

Effects of intestinal dysbacteriosis on dendritic cells functions

To investigate the impact of ceftriaxone-induced intestinal dysbacteriosis on the antigen capturing functions of DCs, we assessed the population of CD205+ cells through flow cytometry analysis. The proportion of CD205+ cells among DCs isolated from dysbacteriosis groups (see Fig. 3) was about 42.80% and from the control 41.49%; this difference was not significant (P = 0.816). We also measured the degree of expression of MHC and co-stimulatory molecules CD86, CD80 and CD40 on DCs. Results are also shown in Figure 3. The proportions of MHC-II+, CD86+, CD80+ and CD40+ cells among DCs of dysbacteriosis mice were all much lower than those of the control (P = 0.0001, 0.030, 0.036 and 0.008, respectively). We assessed the degree of expression of IL-10 and IL-12 p40 in DCs by RT-PCR. Compared with controls, expression of IL-10 of dysbacteriosis mice increased (P < 0.05), accompanied by a significant reduction in IL-12 p40 expression (P < 0.01, Fig. 4).

Figure 3.

The proportion of CD205+, MHC-II+, CD86+, CD80+ and CD40+ cells among CD11c+ cells. All values are expressed as SEM ± SD, n = 7. *, P < 0.05; **, P < 0.01.

Figure 4.

The degree of expression of IL-12p40 and IL-10 in DCs. (a) RT-PCR electropherogram of IL-12p40 and IL-10. (b) The relative mRNA abundance of IL-12p40 and IL-10 in DCs of control and dysbacteriosis mice. The relative mRNA abundance was determined by dividing the intensity of PCR products by the intensity of β-actin PCR product. Values are expressed as SEM ± SD, n = 3. *, P < 0.05; **, P < 0.01.

DISCUSSION

Various studies have shown that changes in microbiota species can induce very different types of immune cells [20], suggesting that gut microbial composition has an important influence on immune responses. To observe the effects of changing the gut microflora, we established a mouse dysbacteriosis model by intragastric administration of ceftriaxone sodium. Ceftriaxone is a broad spectrum, third-generation cephalosporin that is widely used to treat gastrointestinal infections in China. Repeated use of this antibiotic can disrupt the equilibrium of intestinal flora and cause side effects such as antibiotic-associated diarrhea. Intragastric administration of ceftriaxone sodium caused severe dysbacteriosis in mice, altering both the numbers and diversity of intestinal bacteria. This mouse dysbacteriosis is an ideal animal model for mimicking gut dysbacteriosis in human. To the best of our knowledge, this is the first study to document changes in morphology and function of DCs in response to intestinal dysbacteriosis.

Dysbacteriosis in the intestine initially causes inflammation and that inflammation significantly increases the population of CD11c+ DCs in intestinal lamina propria [21]. Our research shows that the overall population of CD11c+ DCs in mice with disrupted small intestinal flora increases dramatically. This suggests that when the balance of intestinal microflora is disturbed, the innate immunity of the intestinal mucosa is activated, disturbing the intestinal homeostasis and leading quickly to inflammatory responses. However, we observed no significant difference in the proportions of CD11c+CD11b+ and CD11c+CD8a+ cells (Fig. 1), which are the two major subtypes of DCs, suggesting that dysbacteriosis of intestinal microflora only increases the numbers of DCs, but does not affect their differentiation.

Because it is strongly induced during DC maturation, CD83 is a commonly used marker for mature DCs [11]. The difference between dysbacteriosis and control mice in DCs expressing CD83 was statistically significant (P = 0.003), indicating that disturbances in intestinal microflora can affect the maturity of DCs in the small intestine and thus directly affect their functions.

Immature DCs capture antigens by phagocytosis, macropinocytosis or via interaction with a variety of cell surface receptors and endocytosis. They become mature after antigen capture. We then further assessed whether antigen capturing abilities are reduced by intestinal dysbacteriosis. CD205 is a C-type lectin that belongs to the family of macrophage mannose receptors. It is expressed by immature DCs and helps in the presentation of antigens [22]. We observed no difference between control and dysbacteriosis groups in the proportion of CD205+ cells among DCs isolated from them (P = 0.816), suggesting that the disturbance in intestinal microflora may affect DC maturation by influencing other receptors, such as FcγR or TLRs.

Mature DCs strongly express MHC and co-stimulatory molecules such as CD86, CD80, CD40 and CD83 [23]. Through interactions between these signal molecules and T-cell receptors, DCs can stimulate proliferation and differentiation of T cells. MHC class-II, CD86, CD80 and CD40 were less strongly expressed in DCs of dysbacteriosis mice than in those from control mice, suggesting a significant reduction in antigen presentation function (Fig. 3).

During the maturation process of DCs, production of cytokines such as IL-10 and IL-12 can influence induction of Th1 or Th2 immune responses [24, 25]. We therefore assessed the degree of expression of IL-10 and IL-12 p40 by RT-PCR. Compared with controls, secretion of IL-10 from DCs of dysbacteriosis mice increased dramatically, accompanied by a significant reduction in IL-12 p40 (Fig. 4). This suggests that the disruption of intestinal microflora may have affected the Th1/Th2 balance. IL-10 is a key regulatory cytokine with pleiotropic effects; release of this cytokine blocks the DC maturation process by interfering with up-regulation of co-stimulatory molecules and production of IL-12 [26]. These findings are consistent with our observation that most DCs isolated from intestines of dysbacteriosis mice are not mature.

In conclusion, our data give a clear insight into the role that the intestinal microflora plays in inducing and maintaining the functions of DCs in the small intestine. Thus, they are essential for connecting innate and adaptive immunity.

ACKNOWLEDGMENTS

This work was supported by grants from the National Program on Key Basic Research Project (973 Program, 2013CB531405), and the National Natural Science Foundation of China (NSFC, No.81150014), China.

DISCLOSURE

The authors confirm that there are no known conflicts of interest associated with this publication and there has been no significant financial support for this work that could have influenced its outcome.

Ancillary