Kinetic studies of the effect of a 17-nucleotide difference in the 0.3-kb region containing the R-U5-5′ leader sequence of Friend murine leukemia virus on viral gene expression

Authors


Correspondence

Sayaka Takase-Yoden, Department of Bioinformatics, Faculty of Engineering, Soka University, 1-236, Tangi-machi, Hachioji-shi, Tokyo 192-8577, Japan.

Tel/fax: +81 42 691 2375; email: takase@soka.ac.jp

ABSTRACT

In addition to the env gene, a 0.3-kb fragment containing the R-U5-5′ leader sequence is essential for the induction of spongiform neurodegeneration by Friend murine leukemia virus (Fr-MLV) clone A8 and it also influences expression of the Env protein. Kinetic studies were carried out using two recombinant viruses, R7f, carrying the A8 0.3-kb fragment, and Rec5, carrying the 0.3-kb fragment of the non-neuropathogenic Fr-MLV clone 57. These analyses suggested that the 0.3-kb fragment influenced the expression level of the Env protein by regulating the amount of spliced env-mRNA rather than the amount of total viral mRNA or viral production.

List of Abbreviations
Ct

threshold cycle

dpi

day(s) post-infection

Fr-MLV

Friend murine leukemia virus

LTR

long terminal repeat

moi

multiplicity of infection

PBS

primer binding site

Several MLV cause spongiform neurodegeneration when infected into neonatal mice or rats [1-8]. One common feature of these viruses, such as the neuropathogenic variant Fr-MLV A8, is that the primary determinant of the induction of neurodegenerative disease is in the env gene [9-15]. The pathomechanism of spongiosis is still not well understood, but several possibilities have been proposed. For example, inefficient processing or folding of neuropathogenic Env protein may induce endoplasmic reticulum stress and/or oxidative stress [16-23]. Alternatively, cellular effectors, such as cytokines and inducible nitric oxide synthase, may be aberrantly expressed in the brains of infected animals [24-31]. In a previous study of the viral clone A8, we showed that a high level of expression of A8-Env protein in rat brain was correlated with neuropathogenicity [32-34]. We also previously showed that, in addition to the env gene, a 0.3-kb fragment containing the R-U5-5′ leader sequence of Fr-MLV A8 was necessary for neuropathogenicity [32]. The 0.3-kb fragment influences the amount of Env protein in cultured cells and in rat brains [32, 33]. This fragment contains functional domains, such as a signal for poly(A) addition to mRNA that works in the 3′ LTR, a PBS for reverse transcription, and a 5′ splice site. However, it is not clear how the 0.3-kb fragment influences the level of Env protein. Here, we sought to answer this question by a kinetic analysis to determine the effect of the 0.3-kb fragment on viral gene expression and viral production.

The chimeric virus R7f, which contains a 0.3-kb fragment of viral clone A8 and the A8-env gene on a non-neuropathogenic clone 57 background, induces spongiform neurodegeneration (Fig. 1) [32]. In contrast, the chimeric virus Rec5, which contains only the A8-env gene on a clone 57 background, does not exhibit neuropathogenicity. Comparison of the sequences of the 0.3-kb fragment of clones A8 and 57 revealed that they had a 17-nucleotide difference [32].

Figure 1.

Structures of the R7f and Rec5 viruses. In the viral genomes, solid regions indicate sequences derived from the A8 virus and open regions show sequences derived from the clone 57 virus. Numbering of the nucleotides is based on the transcript. The primers and probes used for RT-PCR to detect the corresponding mRNA are shown. Inset shows the 0.3-kb KpnI–AatII fragment. Nucleotides marked by numbered black triangles are those that differ between clones A8 and 57. The following functional domains are indicated: Poly(A), polyadenylation signal; PBS, primer binding site; 5′ss, 5′ splice site.

R7f and Rec5 were infected into NIH3T3 cells at a moi of 1. Western blot analysis using anti-Rauscher MLV gp70 (Quality Biotech Incorporated Resource Laboratory, NJ, USA) and anti-AKR p30Gag (Quality Biotech Incorporated Resource Laboratory) antibodies was carried out on viral-infected cells as described previously [32]. Cellular genomic DNA was extracted using a DNeasy Blood and Tissue Kit (Qiagen, Germantown, MD, USA). Real-time PCR was done to quantify the amount of viral DNA in the cells. The amount of gapdh DNA (the internal control) was measured using TaqMan Rodent GAPDH Control Reagents (Applied Biosystems, Foster City, CA, USA). Detection of viral DNA was carried out using the following primers and probe: forward primer Env-F (AGGACCTCGGGTCCCAATAG), reverse primer Env-R (TTAGGTAGCGGGAACGAAAGTT), and the TaqMan probe (CCGAACCCCGTCCTGGCAGAC). RNA extraction was carried out using an RNase Mini Kit (Qiagen) according to the manufacturer's instructions. RNA was reverse transcribed using OligodT20 primer and SSIII reverse transcribing kit (Invitrogen, Carlsbad, CA, USA). A portion of the resulting cDNA was subjected to real-time PCR to quantify the amount of total viral mRNA and spliced viral mRNA. The specific primers and probes used for detection of total viral mRNA were as follows: forward primer Env-F (AGGACCTCGGGTCCCAATAG), reverse primer Env-R (TTAGGTAGCGGGAACGAAAGTT), and the TaqMan probe: CCGAACCCCGTCCTGGCAGAC. Spliced viral-mRNA was detected using s6 (GGGTCTTTCATTTGGGGGCTC), s2 (TGCCGCCAACGGTCTCC), and the TaqMan probe (CACCACCGGGAGCTCATTTACAGGCAC). In each experiment, standard curves were generated with the splA8 vector and used to quantify both mRNAs [35]. The Ct (threshold cycle) values for all standard curves were produced within 13–35 cycles of amplification. Ct values that fell within the range of the standard curve were used for quantifying the sample mRNA. In addition, gapdh-mRNA was quantified as an internal control using TaqMan Rodent GAPDH Control Reagents with the primer sets and probes supplied by the manufacturer (Applied Biosystems). Standard curves to calculate the amount of mRNA were generated using serially diluted gapdh T-easy vector. Negative control samples in which the cDNA synthesis step was omitted showed undetectable levels of amplification. Viral titers were determined by a focal immunoassay on Mus dunni cells in the presence of 10 µg/mL polybrene [36].

The effect of the 0.3-kb fragment on viral growth was first determined. As shown in Figure 2, a viral titer of approximately 104 was achieved at 1 dpi for both R7f and Rec5. The viral titer increased to above 106 at 2 dpi and reached a lag phase from 3 dpi onwards. There was no difference in the level of viral production between R7f and Rec5 throughout the 5 days of incubation.

Figure 2.

Viral titers in cultured supernatants of cells infected with R7f or Rec5. Viral titers from 1 to 5 dpi were determined by focal immunoassays using Mus dunni cells. Graphs represent the average value (±SEM) of four independent experiments.

Next, we carried out an immunoblot analysis to determine the amount of viral protein in NIH3T3 cells over a 5-day incubation period. Significantly greater amounts of Env protein were present in R7f-infected cells at 2 dpi compared to Rec5-infected cells (Fig. 3a). In contrast, the amount of Gag protein in R7f-infected cells was similar to that in Rec5-infected cells (Fig. 3b). These results are in agreement with those reported previously for rat glial cells F10 [32]. The amounts of Env and Gag proteins at 1, 3, and 5 dpi were determined by measuring the intensity of the band from the Western blot membrane and normalized against the intensity of β-actin and the amount of viral DNA in the infected cells (Table 1). The amounts of Env and Gag proteins are shown relative to those in R7f-infected cells at 1 dpi. The relative amount of Env in R7f-infected cells was 1.0, 8.3, and 10.3 at 1, 3, and 5 dpi, respectively. In Rec5-infected cells, the relative amount of Env was 0.5, 1.9, and 3.1 at 1, 3, and 5 dpi, respectively. Thus, Env expression in R7f was three- to fourfold higher than that of Rec5 at 3 dpi (P < 0.05) and 5 dpi (P < 0.005). By contrast, the relative amount of Gag in R7f-infected cells was 1.0, 2.9, and 4.1 at 1, 3, and 5 dpi, respectively. In Rec5-infected cells, the relative amount of Gag was 1.1, 2.4, and 3.0 at 1, 3, and 5 dpi, respectively. Thus, there was no significant difference in the amount of Gag protein between R7f and Rec5.

Figure 3.

Expression of (a) Env protein and (b) Gag protein in NIH3T3 cells infected with R7f or Rec5. Lysates from the infected cells were analyzed by immunoblotting with anti-Env (gp70) and anti-Gag (p30) antibodies. p65Gag, Gag precursor protein. After reprobing, the blot was subsequently stained using anti-β-actin antibody to control for loading differences. This figure is representative of the results obtained. Experiments were carried out using three independent samples and similar results were obtained.

Table 1. Comparison of viral protein expression levels, env-mRNA and total viral mRNA levels, and the ratios of the amount of env-mRNA to that of total viral mRNA
VirusdpiRelative amount ofCopy number ofRatio§ of env-mRNA per total viral mRNA
Env proteinGag proteinenv-mRNATotal viral mRNA
  • Statistical comparisons were done using Student's t-test.
  • *P < 0.05 vs Env of Rec5 at 3 dpi,
  • **P < 0.005 vs Env of Rec5 at 5 dpi,
  • ***P < 0.01 vs the ratio of Rec5 at 3 dpi,
  • ****P < 0.01 vs the ratio of Rec5 at 5 dpi.
  • Means (±SEM) of three independent experiments are shown.
  • Means (±SEM) of four independent experiments are shown. For quantification of the amount of mRNA, 2 µg total mRNA of virus-infected cells was used for reverse transcription. An aliquot (1/200) of the cDNA sample was subjected to real-time PCR analysis. The copy number of env-mRNA and total viral mRNA was normalized against the amount of gapdh-mRNA and viral DNA.
  • §Ratio in each of four independent experiments was calculated; the mean ratio (±SEM) is shown.
R7f11.0 ± 0.01.0 ± 0.01.6 ± 0.3 × 1042.9 ± 0.6 × 1050.06 ± 0.00
 38.3 ± 2.3*2.9 ± 0.31.7 ± 0.4 × 1051.4 ± 0.5 × 1060.14 ± 0.02***
 510.3 ± 1.2**4.1 ± 0.93.0 ± 0.4 × 1052.4 ± 0.5 × 1060.13 ± 0.01****
Rec510.5 ± 0.11.1 ± 0.31.6 ± 0.5 × 1042.6 ± 0.7 × 1050.06 ± 0.01
 31.9 ± 0.22.4 ± 0.67.4 ± 1.8 × 1041.1 ± 0.3 × 1060.08 ± 0.01
 53.1 ± 0.73.0 ± 1.01.4 ± 0.2 × 1052.0 ± 0.4 × 1060.07 ± 0.01

The effect of the 0.3-kb fragment on mRNA expression levels was also determined. First, total viral mRNA of both viruses was measured by real-time RT-PCR using Env-F and Env-R primers (Fig. 1) and normalized against the amount of gapdh-mRNA and viral DNA. We found that total viral mRNA was similar in R7f- and Rec5-infected cells over the course of the observation period (Fig. 4a). Next, we measured spliced env-mRNA levels by real-time RT-PCR using s6 and s2 primers (Fig. 1), which amplify a fragment containing the splicing junction from the cDNA of spliced transcripts; env-mRNA levels were normalized as described above. The amounts of spliced env-mRNA of R7f and Rec5 were identical at 1 dpi. However, the amount of spliced env-mRNA of R7f increased to about double that of Rec5 at 3 dpi (P < 0.01) and at 5 dpi (P < 0.005; Fig. 4b). The ratio of the amount of spliced env-mRNA to total viral mRNA was estimated as 0.06, 0.14, and 0.13 in R7f-infected cells at 1, 3, and 5 dpi, respectively, on the basis of the copy number of env-mRNA and total viral mRNA (Table 1). In contrast, the ratios in Rec5-infected cells were 0.06, 0.08, and 0.07 at 1, 3, and 5 dpi, respectively. Thus, the ratio of abundance of spliced env-mRNA in R7f-infected cells was about double that in Rec5-infected cells at 3 dpi (P < 0.01) and at 5 dpi (P < 0.01).

Figure 4.

Relative amounts of (a) total viral mRNA and (b) spliced env-mRNA. Total RNA extracted from NIH3T3 cells infected with R7f or Rec5 was subjected to first-strand cDNA synthesis. The amount of mRNA was measured using real-time PCR and the value was normalized against the amount of gapdh-mRNA and viral DNA. The amount shown is relative to the amount of R7f on 1 dpi. Graphs represent the average value (±SEM) of four independent experiments. Statistical comparisons were carried out using Student's t-test. ns, differences were not significant.

The contribution of the 0.3-kb fragment of clone A8 to the increase in the expression level of Env protein was demonstrated in our previous studies [32, 33]. In the present study, we sought to understand the role of the 0.3-kb fragment in Env protein expression by investigating the effect of a 17-nucleotide difference in the 0.3-kb fragment on various stages of viral growth. In comparison to R7f and Rec5, the 17-nucleotide difference in the 0.3-kb fragment had no effect on viral production (Fig. 2), the level of expression of the Gag protein (Fig. 3b; Table 1), or the amount of total viral mRNA (Fig. 4a). However, the 0.3-kb fragment of clone A8 showed about a twofold increase in the amount of spliced env-mRNA (Fig. 4b). This result differs from that obtained in our previous study, which found little difference in the amount of spliced env-mRNA in R7f-infected cells and Rec5-infected cells [32]. The amounts of mRNA were measured in the previous work using band intensities on electrophoresis gels in the linear range of the PCR amplification; the current protocol measured viral mRNA levels using real-time RT-PCR. The difference between the studies might be due to the increased sensitivity of the real-time RT-PCR method.

The increase in the amount of spliced env-mRNA was consistent with the increase in the amount of Env protein in R7f-infected cells throughout the 5-day period after infection. However, neither viral production nor total viral mRNA was consistent with the level of Env protein in R7f-infected cells. Therefore, we suggest that the 0.3-kb fragment influences the level of Env protein by regulating the amount of spliced env-mRNA rather than of total viral mRNA or viral production. The ratio of the amount of spliced env-mRNA to the amount of total viral mRNA in R7f-infected cells was about twofold higher than that in Rec5-infected cells (Table 1). This fact suggests that the 0.3-kb fragment might influence splicing efficiency. Other studies have shown that the region around the 5′ splice site forms a secondary structure, which has been determined in part by chemical probing and functional analysis; formation of the secondary structure may regulate splicing by modulating accessibility to splicing factors [37, 38]. Another possibility is that the 0.3-kb fragment might also influence other post-transcriptional processes such as poly(A) tail processing, nuclear-cytoplasmic transport of mRNA, and ribosome recycling during the translation step. Indeed, the amount of spliced env-mRNA in R7f-infected cells was twofold higher than that in Rec5-infected cells, whereas the amount of Env protein in R7f-infected cells was three- to fourfold higher than that in Rec5-infected cells. To fully elucidate the role of the 0.3-kb fragment in Env protein expression, analysis using a vector containing the 0.3-kb fragment and a reporter gene will be of value.

In the present study, we showed that the 0.3-kb fragment influenced the expression level of the Env protein by regulating the amount of spliced env-mRNA in cultured cells. This finding supports our proposal that the A8-derived 0.3-kb fragment increases the expression level of the Env protein in brains of infected rats and that the high expression level of the Env protein is correlated with neuropathogenicity [32-34]. In a previous study, we examined the effect of the A8-derived 0.3-kb fragment on the neuropathogenicity of chimeric viruses that had A8-env on a 57 background [32, 33]. R7a virus, which has the A8 sequences from the U3 of the LTR to the end of the 0.3-kb fragment and has A8-env on a 57 background, showed neuropathogenicity. By contrast, the R7g virus, in which the 0.3-kb fragment of R7a is replaced by a 57-derived 0.3-kb fragment, did not show neuropathogenicity [32]. This finding reaffirmed the contribution of the 0.3-kb fragment to neuropathogenicity. However, as the gag and pol genes of R7g are of 57 origin, constructing a chimeric virus that contains the 57-0.3-kb fragment on a complete background of A8 sequences may help to clarify the importance of the 0.3-kb fragment in inducing neuropathogenicity. Additionally, a reverse chimeric virus that carries the A8-0.3-kb fragment on a complete background of 57 sequences may help to elucidate whether or not the A8-0.3-kb fragment increases the expression level of the 57-Env protein. Our previous studies showed that the Rec6 virus, which has the 57-env on a background of A8 sequences, could proliferate well in rat brains but did not induce spongiform neurodegeneration [15]. This suggested that the 57-Env protein was not able to induce spongiosis. However, it is not clear whether a chimeric virus that has the A8-0.3-kb fragment on a complete background of 57 shows neuropathogenicity. Therefore, we hope to ascertain the effect of the 0.3-kb fragment on the expression level of Env and neuropathogenicity by testing these chimeric viruses.

ACKNOWLEDGMENT

This work was supported in part by funding from the Ministry of Education, Culture, Sports, Science and Technology (MEXT): the Matching Fund for Private Universities, S0901015, 2009–2014.

DISCLOSURE

The authors have no conflict of interest associated with this study.

Ancillary