Molecular characterization of the β-lactamases in Escherichia coli and Klebsiella pneumoniae from a tertiary care hospital in Riyadh, Saudi Arabia

Authors


ABSTRACT

The widespread use of antimicrobials has increased the occurrence of multidrug resistant microbes. The commonest mechanism of antimicrobial resistance in Enterobacteriaceae is production of β-lactamases such as metallo-β-lactamases (MBL) and extended spectrum β-lactamases (ESBL). Few studies have used a molecular approach to characterize the prevalence of β-lactamases. Here, the prevalence of different β-lactamases was characterized by performing three multiplex PCRs targeting genes similar to those described in earlier publications. Antimicrobial susceptibility tests for all isolates were performed using the agar dilution method. β-lactamase was detected in 72% of the isolates, the detection rate being 64% in 2011 and 75% in 2012. The isolates were highly resistant to carbapenems such as meropenem and imipenem and susceptible to colistin and tigecycline. In this study, 22% of isolates contained both MBL and ESBL. ESBL was detected more frequently in Escherichia coli isolates, whereas carbapenemase was detected more frequently in Klebsiella pneumoniae isolates. These findings suggest the spread of multi-resistant ESBL and MBL producers in the community. Our results have implications for patient treatment and also indicate the need for increased surveillance and molecular characterization of isolates.

List of Abbreviations
BL

β-lactamase

blaCTX-M-1

CTX-M-1 β-lactamase

blaCTX-M-2

CTX-M-2 β-lactamase

blaCTX-M-9

CTC-M-9 β-lactamase

blaIMP

IMP-type carbapenemases (metallo-β-lactamases)

blaKPC-2

K. pneumoniae carbapenemase β-lactamase

blaNDM

NDM β-lactamase

blaOXA-48

oxacillinase β-lactamase

blaSHV

SHV β-lactamase

blaTEM

TEM β-lactamase

blaVIM

verona integron-encoded metallo-β-lactamase

CRE

carbapenem-resistant Enterobacteriaceae

ESBL

extended spectrum β-lactamases

MBL

metallo-β-lactamases

NDM-1

New Delhi metallo-β-lactamase-1

VIM

verona integron-encoded metallo-β-lactamase

The management of transmittable diseases caused by multidrug resistant bacteria has become complicated in recent years because of the acquisition and expansion of bacterial resistance to different antimicrobial agents. In particular, multidrug resistance in the Enterobacteriaceae family of bacteria has been well documented worldwide. Enterobacteriaceae rapidly develop drug resistance and are capable of vertical (intraspecies) and horizontal (interspecies) dissemination [1]. The widespread use of antibacterial drugs has resulted in infections with multidrug- and pandrug-resistant gram-negative bacteria, posing challenges in an era when new antibiotic choices are limited.

The commonest drug-resistance mechanism identified in Enterobacteriaceae is production of β-lactamases such as MBL and ESBLs [2, 3]. Until recently, carbapenems provided effective treatment for gram-negative, nosocomial infections. In the past decade, intensive use of carbapenems has facilitated emergence of CRE [4, 5], and treatment failure has increased.

An increase in carbapenemase production by Enterobacteriaceae was recently reported, with a marked endemicity in India [6-8]. Among the different classes and members of the carbapenemases family, NDM-1 is of great concern [7]. An increase in production of metallo-enzymes such as metallo-β-lactamase IMP by Enterobacteriaceae has also been reported worldwide. This has a higher prevalence in southern Europe and Asia, whereas Enterobacteriaceae producing carbapenemases of the oxacillinase-48 type have been identified mostly in Mediterranean and European countries and in India [6, 9, 10].

Resistance of Enterobacteriaceae to all antibiotics except polymyxins is now a reality facing many medical centers. Despite extensive study of multidrug resistance, little is known about the mechanisms of this resistance in clinical isolates of Enterobacteriaceae from Saudi Arabia. This study was undertaken to determine the common mechanisms of resistance in different clinical isolates of Enterobacteriaceae. This data will facilitate the implementation of proper infection control measures, which could decrease the duration and expenditure of hospital stays and thereby help reduce morbidity and mortality caused by Enterobacteriaceae. In this study, we have characterized isolates using molecular identification methods for the presence of the genes blaSHV, blaTEM, blaCTX-M-1, blaCTX-M-2, blaCTX-M-9, blaNDM, blaKPC-2, blaIMP, blaVIM and blaOXA-48.

MATERIALS AND METHODS

Bacterial strains

During a 16-month study period from July 2011 to October 2012, non-duplicate isolates of the Enterobacteriaceae Escherichia coli and Klebsiella pneumoniae were collected from various clinical samples from patients at el Iman Hospital, Riyadh. The strains were obtained from blood, urine, wounds, sputum and other body fluids. Most of the samples were isolated from urine (69%) or blood (21%), the remainder beinge from other sources. All species were identified by conventional methods and by using the GN cards on the VITEKw2 system (bioMérieux, Marcy l'Etoile, France). Minimal inhibitory concentrations of antimicrobials were determined by agar dilution according to Clinical and Laboratory Standards Institute guidelines and interpretative criteria. E. coli (ATCC 25922), Enterococcus (ATCC 209212), and K. pneumoniae (ATCC 27853) were used as reference strains.

DNA isolation

Whole genomic DNA was extracted from colonies grown overnight on blood agar (Remel, Lenexa, KS, USA) using a QIAamp DNA Mini Kit and a QIAcube instrument (Qiagen, Valencia, CA, USA) according to the manufacturer's instructions.

Amplification and detection of the β-lactamase genes by three multiplex polymerase chain reactions

To detect the presence of β-lactamase genes (Tables 1-3), total DNA from isolates was subjected to three multiplex PCRs on an ABI 9700 thermocycler (Applied Biosystems, Carlsbad, CA, USA) using a Multiplex PCR kit (Qiagen) according to the manufacturer's instructions. Amplicons were visualized in a 2% agarose gel containing ethidium bromide (Fig. 1).

Table 1. Primers for amplification of the β-lactamase genes CTX-M1, preOXA-48 and VIM2 by a single multiplex PCR
Primer namePrimer sequence (5′to 3′)Base length (bp)References
CTX-M1C-fGACTATTCATGTTGTTGTTATTTC923[8]
CTX-M1C-RTTACAAACCGTTGGTGACG  
preOXA-48-fTATATTGCATTAAGCAAGGG800[9]
preOXA-48-rCACACAAATACGCGCTAACC  
VIM2-fGATGGTGTTTGGTCGCATA390[10]
VIM2-rCGAATGCGCAGCACCAG  
Table 2. Primers for the amplification of the β-lactamase genes SHV, CTX-M2, CTX-M9, and IMP
Primer namePrimer sequence (5′to 3′)Base length (bp)References
SHV-1CGCCGGGTTATTCTTATTTGTCGC1016[11]
SHV-2TCTTTCCGATGCCGCCGCCAGTCA  
CTX-M2AACTCAGAGCATTCGCCGCTCA879[12]
CTX-M2BTTATTGCATCAGAAACCGTG  
CTX-M9AATGGTGACAAAGAGAGTGCAACG837[12]
CTX-M9BACAGCCCTTCGGCGATGATTC  
IMP2-fGGAATAGAGTGGCTTAAYTCTC232[13]
IMP2-rCCAAACYACTASGTTATCT  
Table 3. Primers for the amplification of the β-lactamase genes TEM, KPC and NDM
Primer namePrimer sequence (5′to 3′)Base length (bp)References
TEM-1ATAAAATTCTTGAAGAC1079[14]
TEM-2TTACCAATGCTTAATCA  
preNDM-fCACCTCATGTTTGAATTCGCC984[15]
preNDM-rCTCTGTCACATCGAAATCGC  
Bla KPCATGTCACTGTATCGCCGTCT882[16]
Bla KPCTTACTGCCCGTTGACGCCC  
Figure 1.

Single multiplex PCR for the β-lactamase genes CTX-M1, preOXA-48 and VIM2 . Lanes 1 and 5, 100 bp ladder; lane 2, positive control; lanes 3 and 4, test strains.

Sequencing analysis of multiplex polymerase chain reaction products

To confirm the identity of the amplified β-lactamase genes detected in the PCR assays, the amplicons were analyzed by DNA sequencing. The PCR products were purified using a ExoSap purification kit (ExoSap-it; GE Healthcare, Piscataway, NJ, USA). Fragments were sequenced using the ABI 3730XL DNA analyzer (Applied Biosystems), analyzed with SeqScape v7.0 (Applied Biosystems), and compared to known β-lactamase gene sequences available from the National Center for Biotechnology Information website (www.ncbi.nlm.nih.gov) through multiple-sequence alignments using the BLAST program.

RESULTS

During the study period, 4250 gram-negative bacterial isolates were recovered: 3358 (79%) were E. coli and 892 (21%) K. pneumoniae. β-lactamase was detected in 72% (3060/4250) of the isolates, the detection rate being 64% (736/1150) in 2011 and 75% (2324/3100) in 2012.

Antimicrobial susceptibility profile

The isolates showed the highest resistance to ciprofloxacin, followed by tobramycin, ceftriaxone, gentamicin and amikacin. A very small proportion of the isolates were susceptible to aztreonam, amikacin and co-trimoxazole. Resistance to nitrofurantoin was significantly higher in K. pneumoniae strains than in E. coli strains. High resistance for carbapenems, such as meropenem and imipenem, was noted. Most of the isolates were susceptible to colistin and tigecycline (Figs 2 and 3).

Figure 2.

Antibiotic resistance pattern of E. coli isolates.

Figure 3.

Antibiotic resistance pattern of K. pneumoniae isolates.

Multiplex polymerase chain reaction

The isolates often carried two, and occasionally three, different types of broad-spectrum β-lactamases (Fig. 4). In this study, blaVIM (297/4250, 7%) and blaIMP (382/4250, 9%) were detected in combination with the carbapenemase (blaNDM) gene in 55% (2338/4250) of the isolates. KPC and OXA-48 were not detected in our isolates. The major ESBL-producing isolates were of the CTX-M type. Cumulatively, at least one bla gene was present in 66.6% (2830/4250) of the isolates. blaCTX-M, blaTEM and blaSHV were detected in 63.5% (2698/4250), 58% (2465/4250), and 27.3% (1169/4250) of the isolates. The combination of blaCTX-M + blaTEM was found in 55% (2335/4250) of the isolates and blaCTX-M + blaTEM + blaSHV in 18.8% (805/4250). Of the CTX-M types, CTX-M 9 (57%) and CTX-M 1 (32%) were more prevalent than CTX-M 2 (11%). MBL and ESBL were found together in 22% of the isolates in our study. ESBL was detected more frequently in E. coli isolates, and carbapenemase more frequently in K. pneumoniae isolates, as shown in Table 4.

Figure 4.

Distribution of various β-lactamase-producing isolates.

Table 4. Percentage distribution of β-lactamase in isolates
 Total number of isolatesβ-lactamaseESBLCarbapenemase
E. coli33582353 (70%)2,283 (68%)1779 (53%)
K. pneumonaie892579 (65%)565 (63%)558 (63%)
Total42502932 (69%)2848 (67%)2337 (55%)

DISCUSSION

Very few studies have characterized β-lactamase prevalence in Enterobacteriaceae isolated from patients with nosocomial and community-acquired infections in the Arabian Gulf region. However, a high frequency of ESBL among in-patients in Kuwait and the United Arab Emirates [17] has been reported. The observations in our study are similar to the data reported for European and Asian countries [18-20], which have also shown an increase in prevalence in the last few years [20]. In this study, the proportion of E. coli (83%) in the isolates was higher than that found in other studies, but similar to that reported in data from the United Arab Emirates [18, 19].

A report from Saudi Arabia showed 17.7% fecal carriage of ESBL isolates, the majority (over 80%) being E. coli [19]. In this study, ESBL pathogens were most often isolated from the urine of both in-patients and outpatients; the resistance pattern of ESBL- or carbapenemase-producing isolates did not differ significantly between these groups of patients (Fig. 1). Among these isolates, 36% showed resistance to imipenem and 53% to meropenem, which is alarming, because carbapenems have been the drug of choice for infections with these organisms. ESBL production was the major resistance mechanism, followed by MBL production. The isolates were resistant to almost all commonly available antibiotics, thus limiting treatment options. Significantly, 22% of the isolates in our study produced both MBL and ESBL. The susceptibility of CRE to aztreonam has been attributed to production of MBLs in the absence of ESBLs or AmpC BLs [21]. A study of an Indian population reported that 35.16% of strains produced ESBL, 10.98% MBL and 15 (5.4%) AmpC; co-production of ESBL/MBL/AmpC was seen in 19.04% of E. coli strains [22]. The major ESBL and AmpC producer was E. coli, whereas K. pneumoniae was the predominant MBL producer [22], similar to the findings of our study. This is an infrequent feature in NDM-1 producers; they are generally associated with ESBL or AmpC BL production [23]. Our isolates, however, were not tested for the AmpC gene.

Because Enterobacteriaceae with carbapenem resistance are also usually resistant to many other classes of antibiotics, including β-lactams, fluoroquinolones and aminoglycosides, they may pose a serious therapeutic challenge. ESBLs and MBLs have been reported in various parts of the world by researchers using phenotypic and/or molecular approaches (detection of bla genes). However, few reports have described their detection in Gulf countries. Given the scarcity of information on carbapenem-resistance genes in Enterobacteriaceae in the Middle East, scientific studies of multidrug resistance covering wider geographical areas are needed.

In concordance with previous reports, we found that ESBL E. coli isolates had a high susceptibility rate to nitrofurantoin, nearly 75%. In contrast, K. pneumoniae isolates producing ESBL have greater resistance to nitrofurantoin [24, 25]. Based on these findings, we suggest that nitrofurantoin may be an effective option for treating urinary tract infection caused by ESBL E. coli (Figs 2 and 3).

In conclusion, we here report an increasing number of antibiotic resistant pathogens, which predominantly produce different β-lactamases, circulating within the community in Saudi Arabia. We recommend additional evaluation of ESBL types and assessment of the prevalence of other ESBL-producing microorganisms.

ACKNOWLEDGMENTS

The authors extend their sincere appreciation to the Deanship of Scientific Research at King Saud University for funding this research through the Research Group Project (no. RGP-VPP-314).

DISCLOSURE

The authors certify that there is no conflict of interest with any financial organization regarding the material discussed in the manuscript.

Ancillary