SEARCH

SEARCH BY CITATION

Keywords:

  • env-mRNA;
  • gag gene;
  • murine leukemia virus;
  • splicing

ABSTRACT

  1. Top of page
  2. ABSTRACT
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. ACKNOWLEDGMENTS
  7. DISCLOSURE
  8. REFERENCES

The genome of the Friend murine leukemia virus (Fr-MLV) contains a 5′ splice site (5′ss) located at 205 nt and a 3′ss located at 5489 nt. In our previous studies, it was shown that if the HindIII–BglII (879–1904 bp) fragment within gag is deleted from the proA8m1 vector, which carries the entire Fr-MLV sequence, then cryptic splicing of env-mRNA occurs. Here, attempts were made to identify the genomic segment(s) in this region that is/are essential to correct splicing. First, vectors with a serially truncated HindIII–BglII fragment were constructed. The vector, in which a 38 bp fragment (1612–1649 bp) is deleted or reversed in proA8m1, only produced splice variants. It was found that a 38 nt region within gag contains important elements that positively regulate splicing at the correct splice sites. Further analyses of a series of vectors carrying the 38 bp fragment and its flanking sequences showed that a region (1183–1611 nt) upstream of the 38 nt fragment also contains sequences that positively or negatively influence splicing at the correct splice sites. The SphI–NdeI (5140–5400 bp) fragment just upstream of the 3′ss was deleted from vectors that carried the 38 bp fragment and its flanking sequences, which yielded correctly spliced mRNA; interestingly, these deleted vectors showed cryptic splicing. These findings suggest that the 5140–5400 nt region located just upstream of the 3′ss is required for the splicing function of the 38 nt fragment and its flanking sequences.

List of Abbreviations
FeLV

feline leukemia virus

Fr-MLV

Friend murine leukemia virus

hnRNP

heteronuclear ribonucleoprotein

LTR

long-terminal repeat

MLV

murine leukemia virus

MSV

Moloney murine sarcoma virus

NRS

negative regulator of splicing

SR protein

serine/arginine-rich protein

ss

splice site

XMRV

xenotropic MLV-related virus

The genome of MLV, which belongs to the simple retrovirus family, contains a 5′-LTR (long terminal repeat), a 5′ leader sequence, gag, pol, env, and a 3′-LTR. The gag gene encodes the structural proteins of the virion and the pol gene encodes enzymes, including a reverse transcriptase. The env gene encodes the Env protein, which consists of a surface domain and a transmembrane domain. A 5′ splice site is located in the 5′ leader sequence and a 3′ splice site in the 3′ end of the pol gene. In MLV-infected cells, both full-length unspliced mRNA and spliced mRNA are produced. Gag and Pol proteins are translated from the unspliced mRNA, and Env protein is translated from the spliced mRNA [1]. The Env protein of MLV plays important roles, not only in viral adsorption to cells, but also in induction of neuropathogenic disease following infection by the virus [2-8]. In previous studies, we showed that the level of Env expression in neuropathogenic A8-MLV is correlated with neuropathogenicity [9, 10]. Thus, elucidation of the regulatory mechanisms for production of env-mRNA is important for understanding the functions of the Env protein. MLV and other simple retroviruses have no regulatory genes, such as those that control gene expression, including splicing events, in lentiviruses. There are, however, several reports of splicing regulation in simple retroviruses. In Moloney MLV, the capsid protein-encoding region within the gag gene is reportedly a negative cis-regulatory element and the region immediately upstream of the 3′ss a positive cis-regulatory element that regulates expression of unspliced mRNA [11-13]. Rous sarcoma virus and other members of the avian leukosis virus family contain a unique cis-acting element, termed the NRS, which acts globally to repress splicing to both the env and src splice sites [14-21]. Cellular factors, such as SR protein and hnRNP H, are recruited to the NRS of Rous sarcoma virus, resulting in regulation of recognition of splice sites [16, 22, 23]. We have also shown that the positive and negative regulatory regions within the intron that controls Env expression in Fr-MLV at the level of env-mRNA expression do so by controlling splicing efficiency [24]. In addition, the proximal sequence of the 5′ss of MLV contains cis-elements that regulate splicing efficiency [25-28]. Overall, however, the molecular mechanisms that regulate splicing in MLV, including the selection of splice sites, are not well understood.

In eukaryotic cells, splicing involves a series of reactions catalyzed by spliceosomes. Spliceosomes are ribonucleoprotein complexes that remove introns from precursor mRNA [29, 30]. For splicing to occur, in addition to a 5′ss and a 3′ss, a branch point is required within the intron. The sequences of the 5′ss, 3′ss and branch points are short and have been poorly conserved during evolution. We have frequently identified these sequences in genes; however, some of them are cryptic splice sites. The presence of 5′ss, 3′ss and branch points in genes is not sufficient for the proper recognition of exonic and intronic sequences and regulation of splicing. Other regulatory cis-elements are required for the recognition of splice sites; these elements, which are classified according to their location and function, are known as exonic splicing enhancers ESEs and intronic splicing enhancers ISEs or exonic splicing silencers and intronic splicing silencers [31-34]. The best characterized exonic splicing enhancers and intronic splicing enhancers have purine-rich sequences that recruit splicing activators from the SR protein family [35]; whereas the best characterized exonic splicing silencers and intronic splicing silencers are recognized by members of the hnRNP family including polypyrimidine track-binding protein [36, 37].

In a previous investigation aimed at understanding the role of the intron within the Fr-MLV gene in Env expression, we used vectors with serially truncated introns and showed that when the HindIII–BglII (879–1904 bp) fragment was deleted from the proA8m1 vector (which contains the full-length sequence of the A8-Fr-MLV proviral gene), mRNA splice variants were detectable by RT-PCR using primers designed to amplify the splice junction and env regions [24]. In the splice variants of env-mRNA, the 205–807 nt and the 2042–5488 nt regions have been spliced out; therefore, we utilized additional splice sites in addition to the correct splices sites. These findings suggested that the HindIII–BglII fragment is crucial to selection of the correct splice sites. In the present study, we first narrowed down the region within the HindIII–BglII fragment crucial for splicing at the correct 5′ss and 3′ss of Fr-MLV. We found that a 38 nt fragment (1612–1649 nt) within gag plays an important role in this splicing. Further analyses using a series of vectors carrying the 38 bp fragment and its flanking sequences showed that a region (1183–1611 nt) upstream of the 38 nt fragment also contains sequences that positively or negatively influence splicing at the correct splice sites. In addition, we found that the SphI–NdeI (5140–5400 nt) fragment just upstream of the 3′ss, which had previously been shown to influence splicing [24], is required for the splicing function of the 38 nt fragment and its flanking sequences. Possible mechanisms for the regulation of splicing by the 38 nt fragment and its flanking sequences in MLV are discussed.

MATERIALS AND METHODS

  1. Top of page
  2. ABSTRACT
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. ACKNOWLEDGMENTS
  7. DISCLOSURE
  8. REFERENCES

Construction of vectors

To construct the d3 vectors AatII and SphI were used to carry out a restriction digest of proA8m1. The enzyme sites were blunted using a DNA Blunting Kit (TaKaRa, Shiga, Japan), after which blunt-end ligation was performed. To construct the d3 + 1026 vector, the HindIII–BglII fragment of proA8m1 was cloned by PCR using a forward primer containing an AatII restriction site in the 5′ terminus, 5′-GAGACGTCAGCTTTAGCAGTAGAC-3′, and a reverse primer containing the SphI restriction site in the 5′ terminus, 5′-TGGCATGCTTTTCAGCTTCCCTCA-3′. The ArtII–SphI fragment was recombined using the restriction site of proA8m1.

The vectors B1, B2, B3, B2-a, B2-b, B2-c, B3-d, B3-e, B3-f, B3-d1, B3-d2, B3-d3 and B3-d4, which have serially truncated HindIII–BglII regions of proA8m1, were constructed using a KOD-Plus-Mutagenesis Kit (Toyobo, Osaka, Japan). Point mutations, G to T (2608 nt), G to T (2614 nt) and G to T (2629 nt), were introduced into the pol gene of proA8m1 in order to suppress production of progeny [24]. The mutations A to T (2126 nt) and T to A (2777 nt) were also introduced into proA8m1. To construct the B1 vector, the 879–1182 bp fragment was deleted from proA8m1 by inverse PCR using the primer sets listed in Table 1. The B2, B3, B2-a, B2-b, B2-c, B3-d, B3-e, B3-f, B3-d1, B3-d2, B3-d3 and B3-d4 vectors were constructed by deleting the 1183–1541, 1542–1904, 1183–1296, 1297–1443, 1444–1541, 1542–1649, 1650–1770, 1771–1904, 1542–1569, 1570–1591, 1592–1611 and 1612–1649 bp fragments, respectively, from proA8m1, using the same method as for B1. The primers used for generation of these vectors are listed in Table 1. To construct the B3-d4inv38 vector, two-stage inverse PCR was performed using the two sets of primers shown in Table 1.

Table 1. List of primers used for construction of vectors
Name of vectorForward (5′ [RIGHTWARDS ARROW] 3′) primerReverse (5′ [RIGHTWARDS ARROW] 3′) primer
B1CCTGACTCTTCCCCAATGGTATCGCTAAAGCTTCCCAGGTCACGAT
B2TAATGATGCTTTTCCCTTGGAACGTCCGATACCATTGGGGAAGAGTCAGG
B3GTGAGGGAAGCTGAAAAGATCTATATCATTGGGCAGCTGAGTTGGG
B2-aTACTGGCCATTTTCCTCCTCTGGATACCATTGGGGAAGAGTCAGG
B2-bACCCTGCTGACGGGAGAAGAAATTGAAACTGTCCATTCCCTCCC
B2-cTAATGATGCTTTTCCCTTGGAACGTCCCCCTAATAGCTGTTGGCAGTCA
B3-dGGGCAGAAGCCCCACCAATTTATATCATTGGGCAGCTGAGTTGGG
B3-eGAGGACCCAGGGCAAGAAACCAAGCGCTTTGGAGACCCGCTAGGA
B3-fGTGAGGGAAGCTGAAAAGATCTAGGGTCATAAGGAGTGTATCTGCG
B3-d1GACTGGGACTACAACACCCAACATATCATTGGGCAGCTGAGTTGGG
B3-d2GAGGTAGGAACCACCTAGTCCAGGGACGTTCCAAGGGAAAAGCA
B3-d3CACTATCGCCAGTTGCTCCTAGGTTGGGTGTTGTAGTCCCAGTC
B3-d4GGGCAGAAGCCCCACCAATTTGACTAGGTGGTTCCTACCTCGT
B3-d4inv381.CCGCTATCACGGGCAGAAGCCCCACCAATT1.GGTTTCGCGGACTAGGTGGTTCCTACC
 2.CCTCGTTGACCGCTATCACGGGCAGAA2.ATCGCCCAGAGGTTTCGCGGACTAGGTGGT
57TAGCGGGTCTCCAAAACGCGGGAGCAACTGGCGATAGT
MSVTAGCGGGTCTCCAAAACGCGTGAGCAACTGGCGATAGTGG
FeLVTATTAGCGGGTCTCCGCGGGGCGGGCAGAAGGCAACTGGCGATAAAGGACTAGG
XMRVTAGCGGGTCTCCAAAACGCGAGAGCAACTGGCGGTAGAGG
CasBrETAGCGGGTCTCCAAAACGCGAGAGCAACTGGCGATAGAGG
d3 + 771CCACAGGTATTGGGAACCGAGCGCTTTGGAGACCCGCTAGGA
d3 + 293CACTATCGCCAGTTGCTCCTAGACGTCTCCCAGGGTTGCGGC
d3 + 467CCTGACTCTTCCCCAATGGTATCACGTCTCCCAGGGTTGCGGC
d3 + 353TACTGGCCATTTTCCTCCTCTGACGTCTCCCAGGGTTGCGGC
d3 + 206ACCCTGCTGACGGGAGAAGAAAACGTCTCCCAGGGTTGCGGC
d3 + 108TAATGATGCTTTTCCCTTGGAACGTCCACGTCTCCCAGGGTTGCGGC
d3 + 80GACTGGGACTACAACACCCAACACGTCTCCCAGGGTTGCGGC
d3 + 58GAGGTAGGAACCACCTAGTCCAACGTCTCCCAGGGTTGCGGC

To construct 57 MLV, MSV, FeLV, XMRV and CasBrE vectors, point mutations were inserted into d3 + 1026 by inverse PCR using the primer pairs shown in Table 1.

To construct the d3 + 771 vector, the 1650–1904 bp fragment of d3 + 1026 was deleted by inverse PCR using the primer set shown in Table 1. The d3 + 293, d3 + 467, d3 + 353, d3 + 206, d3 + 108, d3 + 80 and d3 + 58 vectors were constructed by deleting the 879–1611, 879–1182, 879–1296, 879–1443, 879–1541, 879–1569 and 879–1591 bp fragments, respectively, from d3 + 1026, using the same method as for d3 + 771. The primer pairs listed in Table 1 were used to construct the vectors. To construct d3 + 38, a 38 bp fragment with an AatII restriction site in the 5′ terminus and a SphI restriction site in the 3′ terminus was prepared by annealing the following synthetic single-stranded DNAs: 5′-CCACTATCGCCAGTTGCTCCTAGCGGGTCTCCAAAGCGCGCATG-3′ and 5′-CGCGCTTTGGAGACCCGCTAGGAGCAACTGGCGATAGTGGACGT-3′. To construct d3 + inv38 vectors, a fragment with the inverse sequence of the 38 bp fragment and with an AatII restriction site in the 5′ terminus and a SphI restriction site in the 3′ terminus was prepared by annealing the following synthetic single-stranded DNAs: 5′-CCGCGAAACCTCTGGGCGATCCTCGTTGACCGCTATCACGCATG-3′ and 5′-CGTGATAGCGGTCAACGAGGATCGCCCAGAGGTTTCGCGGACGT-3′. These fragments were inserted into the AatII and SphI restriction sites of proA8m1.

To construct the d4 + 58 and d4 + 1026 vectors, SphI and NdeI were used to carry out a restriction digest of d3 + 58 and d3 + 1026, respectively. The enzyme sites were blunted using a DNA Blunting Kit (TaKaRa), after which blunt-end ligation was performed.

Cell cultures and transfections

NIH3T3 cells were grown in Dulbecco modified eagle medium (Cellgro, Manassas, VA, USA) supplemented with 10% (v/v) FCS (MP Biomedicals, Santa Ana, CA, USA), 50 U penicillin (Gibco, Gaithersburg, MD, USA)/mL, and 50 µg streptomycin (Gibco) at 37°C in a 7% CO2 atmosphere. Cells were seeded with 1 × 106 cells in a 6 cm dish with growth medium minus penicillin–streptomycin. They were transfected the next day with 8 µg of vectors using Lipofectamine 2000 Reagent (Invitrogen, Carlsbad, CA, USA) diluted with OPTI-MEM (Invitrogen) according to the manufacturer's instructions.

RT-PCR analysis of viral spliced mRNA in transcripts

Total cellular RNA was isolated from transfected cells using an RNeasy Mini Kit (Qiagen, Gaithersburg, MD, USA) according to the manufacturer's instructions. After treatment with RNase-free DNase (Qiagen), 2 µg of RNA were added to the RT reaction, which used an oligo (dT) primer (Invitrogen). The spliced mRNA was detected by PCR using Go Taq (Promega, Madison, WI, USA) and specific primers. The primers for detecting spliced mRNA containing the splicing junction region were: s1 forward primer 5′-GAGACCCTTGCCCAGGGA-3′ and s2 reverse primer 5′-TGCCGCCAACGTCTCC-3′. The env coding region was detected by PCR, using KOD-plus (Toyobo) and the s1 forward primer and the u3 reverse primer 5′-TGCGGCTATCAGGCTAAGCAACTTGGT-3′. PCR products were separated on 2% or 1% agarose gels in tris-borate-EDTA or tris-acetate-EDTA buffer, respectively, and stained with ethidium bromide. Negative control samples without the cDNA synthesis step did not yield specific bands.

Sequence analysis of splice variants

To analyze the sequences of splice variants, the relevant electrophoretic bands were extracted from the agarose gel using a QIAquick Gel Extraction Kit (Qiagen), and cloned into a pGEM-T-easy vector (pGEM-T-easy Vector System; Promega). The sequences of the cloned fragment in T-easy vector were amplified using T7 (5′-GTAATACGACTCACTATAGGGC-3′), or sp6 (5′-ATTTAGGTGACACTATAGAA-3′) primers, and a BigDye Terminator v 3.1 Cycle Sequencing Kit (Applied Biosystems, Foster, CA, USA). The sequences were analyzed using an ABI PRISMOR 3100 Genetic Analyzer (Applied Biosystems).

RESULTS

  1. Top of page
  2. ABSTRACT
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. ACKNOWLEDGMENTS
  7. DISCLOSURE
  8. REFERENCES

Narrowing down the region within the HindIII–BglII fragment (879–1904 bp) that is crucial for splicing at the correct 5′ss and 3′ss

During splicing of the Fr-MLV gene, the 205–5488 nt region is normally spliced out and, subsequently, env-mRNA is produced (Fig. 1). We previously investigated the role of the intron within the Fr-MLV gene in Env expression using vectors with serially truncated introns. We found that when the HindIII–BglII (879–1904 bp) fragment was deleted from the proA8m1 vector, which contains the full-length A8-Fr-MLV proviral gene sequence, there were abundant splice variants among the transcripts [24]. We transfected the proA8m1 vector into NIH3T3 cells and examined generation of spliced mRNA after 48 hr by RT-PCR using the s1 and s2 primers (Figs. 1, 2a). These primers were designed to amplify a 94 bp fragment containing the splicing junction region from the cDNA of normal spliced transcripts. As shown in Figure 2b, we detected the 94 bp band in the transcripts of proA8m1. In contrast, in the transcripts of the B vector (called the pA8d1b vector in our previous report) with a truncated HindIII–BglII fragment from proA8m1, we detected a band of approximately 300 bp (Fig. 2b). Sequence analysis showed that the 300 bp band came from an mRNA splice variant in which the 205–807 nt (D1-A3) and 2042–5488 nt (D6-A13) regions were spliced out (mRNA-D1-A3/D6-A13). These results are in agreement with those of our previous study [24]. We used the d3 vector to analyze the importance of the HindIII–BglII fragment in splicing, in which the majority of the intronic AatII–SphI (366–5139 bp) fragment has been deleted from proA8m1 (Fig. 2a). The d3 vector yielded the splice variant mRNA-D1-A1/D12-A13 and unspliced transcripts (Fig. 2b,c). When we inserted the HindIII–BglII fragment between 366 and 5139 bp of the d3 vector (to produce the d3 + 1026 vector), we detected only correctly spliced mRNA (Fig. 2b).

image

Figure 1. Structure of proviral DNA of MLV and the primers used to detect env-mRNA by RT-PCR. Throughout these figures, native 5′ss (204 nt) and 3′ss (5489 nt) are designated D1 and A13, respectively (see splice site numbers in Fig. 6a). The numbering of nucleotides is based on the transcript. The s1 and s2 primers were designed to amplify a 94 bp fragment from the cDNA of spliced transcripts containing the splice junction region and the s1 and u3 primers to amplify a 2.4 kbp fragment from cDNA of spliced env-mRNA.

Download figure to PowerPoint

image

Figure 2. (a) Structures of d3, d3 + 1026 and vectors with a serially truncated HindIII–BglII fragment of proA8m1. (b) Detection of the splice junction region of env-mRNA in the transcripts of vectors. (c) Structures of splice variants in transcripts of d3, B3-d, B3-d4, and B3-d4inv38 and sizes of the PCR products. (b) The proA8m1 vector and vectors with the serially truncated HindIII–BglII fragment were designed to generate both unspliced mRNA and spliced mRNA; however, bands corresponding to unspliced mRNA were not detected in the transcripts of all tested vectors under the conditions used in the present experiments. Sequence analysis confirmed that the 94 bp band came from normally spliced transcripts. (c) The closed circles represent the splice sites that were utilized in splice variants (see splice site numbers in Fig. 6a), thick solid lines represent the exon region in splice variants, and broken lines represent regions that were spliced out. The splice variants not included in (c) are as follows: B2, mRNA-D1-A4/D2-A13 that was produced by splicing out of 205–1006 nt (D1-A4) and 1201–5488 nt (D2-A13) regions; B3, mRNA-D1-A6/D6-A13; B2-c, mRNA-D1-A6/1444 nt (artificial splice site that arose as a result of vector construction)-A13; B3-e, mRNA-D1-A6 or A7/D4-A13; and B3-d1, mRNA-D1-A6, A7, or A8/D4-A13.

Download figure to PowerPoint

We first sought to narrow down the region within the HindIII–BglII fragment that is crucial for splicing at the correct 5′ss and 3′ss of Fr-MLV. To this end, we constructed B1, B2, and B3 vectors with serially truncated 1 kbp (HindIII–BglII) fragments from the entire sequence of proA8m1 (Fig. 2a). Among these vectors, B2 and B3 yielded a small amount of mRNA splice variants in addition to correctly spliced mRNA (Fig. 2a,b). Details of the splice variants B2 and B3 are described in the legend to Figure 2. We sought to further narrow down the 0.7 kb (1183–1904 bp) region by constructing the B2-a to B3-f vectors that are serially truncated in this region. The transcripts of the B2-a, B2-b and B2-f vectors included only correctly spliced mRNA (Fig. 2b). The transcripts of the B2-c and B3-e vectors included abundant correctly spliced mRNA and a few mRNA splice variants (see the legend to Fig. 2 for details). It is noteworthy that B3-d included only mRNA splice variants, as described in Figure 2c. To further narrow down the 0.1 kb (1542–1649 bp) fragment, we next constructed the B3-d1 to B3-d4 vectors that were serially truncated in the fragment. In B3-d1, the transcripts contained normally spliced mRNA and a few mRNA splice variants (see the legend to Fig. 2 for details). In B3-d2 and B3-d3, the transcripts contained only correctly spliced mRNA and we detected no splice variants. Interestingly, B3-d4, in which the 1612–1649 bp fragment was deleted from proA8m1, only yielded mRNA splice variants. The transcripts from the B3-d4inv38 vector carrying a reverse sequence of the 1612–1649 bp fragment included only splice variants. These findings showed that the 38 nt region (1612–1649 nt) contains the important elements that regulate splicing at the correct 5′ss and 3′ss.

We performed RT-PCR using the s1 and u3 primers to examine whether the spliced mRNA of the tested vectors contains the entire sequence of the env coding region (Fig. 1). These primers were designed to amplify a 2.4 kbp band in the spliced mRNA of proA8m1. We found that the spliced mRNAs of all of the tested vectors contains the entire sequence of the env coding region (data not shown).

Comparison of the 38 nt fragment among gamma retroviruses

The 38 nt fragment sequence is well conserved among simple retroviruses such as gamma retroviruses, although a few nucleotides differ from A8-MLV (Fig. 3a). To determine whether the differences in sequences of the 38 nt fragment in gamma retroviruses influence splicing, we replaced the 38 bp fragment of the d3 + 1026 vector with the 38 bp fragment from Fr-MLV 57, MSV, FeLV, XMRV or CasBrE MLV (Fig. 3a). We transfected the derived vectors into NIH3T3 cells and analyzed their mRNA transcripts by RT-PCR using the s1 and s2 primers. In the transcripts of A8, 57, MSV, XMRV and CasBrE, we observed only the 94 bp band of the correctly spliced transcript (Fig. 3b). In FeLV, we detected a few mRNA splice variants in addition to correctly spliced mRNA.

image

Figure 3. (a) Structures of vectors in which the 38 bp fragment of d3 + 1026 was replaced by the 38 bp fragment derived from Fr-MLV 57, MSV, FeLV, XMRV, or CasBrE. (b) Detection of the splice junction region of env-mRNA in the transcripts of vectors.

Download figure to PowerPoint

Effects of the flanking sequence of the 38 nt fragment on splicing at the correct 5′ and 3′ splice sites

As shown in Figure 2, the 38 nt region was demonstrated to play an important role in splicing at the correct splice sites. However, the flanking sequences of the 38 nt region, such as the 1183–1541 nt, 1542–1569 nt and the1650–1770 nt regions, also positively influenced splicing (B2, B3-d1 and B3-e vectors in Fig. 2), as described in the first section of the Results and the first paragraph of the Discussion. In order to further define the region for control of correct splicing within the flanking sequences of the 38 nt fragment, we constructed vectors with serially truncated HindIII–BglII fragments derived from the d3 + 1026 vector (Fig. 4a). The d3 + 771 and d3 + 293 vectors have the upstream and downstream flanking regions, respectively, of the 38 bp fragment of d3 + 1026. In d3 + 771, we detected correctly spliced mRNA (Fig. 4b). By contrast, in d3 + 293, we detected variant transcripts (data not shown) in addition to correctly spliced mRNA. Next, we constructed a series of vectors, d3 + 467 to d3 + 38, in which the 879–1611 bp region of d3 + 771 was serially truncated, to narrow down the critical flanking region within the 879–1611 nt fragment for correct splicing (Fig. 4a). Serial truncation of the upstream region of the 38 bp fragment resulted in production of transcripts with splicing variants in d3 + 353, d3 + 206, d3 + 80 and d3 + 38 in addition to correctly spliced mRNA (Fig. 4b). No correctly spliced transcripts were present in the spliced mRNA products of d3 + inv38 carrying a reverse sequence of the 38 bp fragment; we detected only correctly spliced mRNA in the transcripts of d3 + 467, d3 + 108 and d3 + 58.

image

Figure 4. (a) Structures of vectors with serial truncation of the HindIII–BglII fragment of d3 + 1026. Solid lines represent the 38 bp fragment. (b) Detection of the splice junction region of env-mRNA in the transcripts of the vectors.

Download figure to PowerPoint

Effect of the upstream region of 3′ss of MLV on function of the 38 nt fragment and its flanking sequence

In a previous study, we showed that the SphI–NdeI (5140–5400 nt) fragment located approximately 100 nt upstream of the 3′ss could influence splicing efficiency and the appearance of splice variants [24] (Fig. 1). When we deleted this SphI–NdeI fragment from proA8m1, a splice variant appeared in which the 205–1360 nt (D1-A6) and 1595–5488 nt (D4-A13) regions were spliced out (data not shown). Interestingly, the structure of the splice variant was identical to that of a splice variant observed in the transcripts of B3-d4, in which the 38 bp fragment was deleted from proA8m1 (Fig. 2). The vectors developed for the experiments shown in Figure 4 contain the SphI–NdeI region. To examine whether this region influenced control of splicing by the 38 nt fragment and its flanking sequence, as shown in Figure 5a, we deleted it from d3 + 58 and d3 + 1026 (Fig. 4); the resulting transcripts were all correctly spliced. By contrast, we obtained abundant splice variants from the transcripts of d4 + 58 and d4 + 1026 (Fig. 5b,c). The findings show that a synergistic interaction between the 5140–5400 nt region located in the upstream region of the 3′ss and the 38 nt fragment and its flanking sequence is required for splicing at the correct 5′ss and 3′ss.

image

Figure 5. (a) Structures of vectors produced by deletion of the SphI–NdeI fragment from d3 + 58 and d3 + 1026 (see Fig. 4). (b) Detection of the splice junction region of env-mRNA in the transcripts of the vectors. (c) Structures of splice variants in transcripts of d4 + 58, and d4 + 1026, and sizes of the PCR products. Closed circles represent the splice sites that were utilized in splice variants (see splice site numbers in Fig. 6a), thick solid lines represent the exonic region in splice variants, broken lines represent regions that were spliced out, and thin solid lines represent the regions that were not contained in the vectors.

Download figure to PowerPoint

Mapping of cryptic 5′ss and cryptic 3′ss on the MLV gene

As described in earlier sections, our experiments with vectors carrying truncated fragments from proA8m1 yielded a range of splice variants. On the basis of the sequence data of these splice variants, we mapped the splice sites that were actually used as “D” (5′ss) and “A” (3′ss). Native 5′ss (204 nt) and 3′ss (5489 nt), designated D1 and A13, respectively, are indicated by the boxed regions in Figure 6a. We identified cryptic 5′ss at D2 (1200 nt), D3 (1366 nt), D4 (1594 nt), D5 (1677 nt), D6 (2041 nt) and D12 (5184 nt); we found cryptic 3′ss at A1 (285 nt), A3 (808 nt), A4 (1007 nt), A6 (1361 nt), A7 (1367 nt), A8 (1411 nt) and A9 (1435 nt). A few sites, namely D4, D5, A6 and A7, were frequently used to produce splice site variants in the tested vectors. The sequences of these splice sites are shown in Figure 6b. All of the fragments that were spliced out from the tested vectors contained GU at the 5′ss and AG at the 3′ss, and had a polypyrimidine-tract-like sequence located before the 3′ end of the fragment to be spliced. In addition, we found consensus sequences, GAGGUAAGC and Y(11)AAG, where Y=T or C, that could act as 5′ss and 3′ss, respectively (D7#-11#, D13#-17#, A2#, A5#, A10#-12# and A14# in Fig. 6a). However, all of our tested vectors did not use these predicted sites. We also mapped the consensus sequences of the branch points for splicing, YNYURAY, where Y=T or C, N =A, T, G or C, and R= A or G (black ellipses in Fig. 6a). Predicted branch points were located in the upstream region of each cryptic 3′ss.

image

Figure 6. (a) Mapping of the splice sites that were actually used in splice variants, the predicted splice sites, and the predicted branch points for splicing. Numbers in parentheses represent the positions of splice sites. The consensus sequences for 5′ss and 3′ss (GAGGUAAGC and Y(11)AAG: Y = T or C, respectively) were also mapped and indicated by “#”. Black ellipses represent the consensus sequences of branch points for splicing. Splice sites that were frequently used in splice variants are underlined. The shadowed region on the MLV gene represents the 38 nt fragment. (b) Sequences of the splice sites of splice variants. The splice sites that were used in splice variants were mapped and designated “D” (5′ss) and “A” (3′ss). Artificial splice sites that arose as a result of vector construction are not included. Native 5′ss (D1) and 3′ss (A13) are indicated by the boxes.

Download figure to PowerPoint

DISCUSSION

  1. Top of page
  2. ABSTRACT
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. ACKNOWLEDGMENTS
  7. DISCLOSURE
  8. REFERENCES

The genome of Fr-MLV contains a 5′ss located at 205 nt and a 3′ss located at 5489 nt. In virus-infected cells, env-mRNA is produced by a single-splicing event. In previous studies, we have shown that when the HindIII–BglII (879–1905 bp) fragment within the gag gene is deleted from the proA8m1 vector that has the entire Fr-MLV sequence, cryptic splicing of mRNA occurs [24]. In the present study, we first attempted to narrow down the region within the HindIII–BglII fragment that is crucial for splicing at the correct 5′ss and 3′ss of Fr-MLV. Our findings indicated that a 38 nt fragment (1612–1649 nt) in gag contains the important elements that regulate splicing at the correct 5′ss and 3′ss, and that the orientation of the 38 nt fragment is crucial to its function (Fig. 2a,b). However, elements that positively contribute to splicing at the correct splice sites seem to exist in the HindIII–BglII region except for the 38 nt fragment. In the transcripts of B2, which contains the 38 nt fragment, we observed some mRNA splice variants. There were no splice variants among transcripts of B2-a or B2-b; however, there were splice variants among the transcripts of B2-c. The latter had an artificial splice site at 1444 nt that arose as a result of vector construction and which we used to produce the variants. Therefore, although we were unable to further delimit the 1183–1541 nt region with regard to sequences essential to splicing, our findings indicate that the entire 1183–1541 nt region might play a positive role in splicing at the correct splice sites. We believe that the presence of normally spliced mRNA and a few splice variants in the transcripts from B3, which do not carry the 38 nt fragment, might be attributable to the presence of the 1183–1541 nt region in this vector. Similarly, because the transcripts of B3-e and B3-d1 contain a few mRNA splice variants, we suggest that the 1650–1770 nt and the 1542–1569 nt regions positively contribute to splicing at the correct splice sites. The vectors tested in this study are deletion mutants created within the Gag protein coding region, which is known to be a relatively conserved region in gamma retroviruses. Therefore, we cannot exclude the possibility that other regions in addition to the 38 nt fragment contribute to splicing through changes in pre-mRNA features such as exon length and pre-mRNA secondary structures.

The effects of the 38 nt fragment on splicing are not restricted to NIH3T3 cells, but also occur in F10, RS-A, 293T, U937, HeLa and Jurkat cells (data not shown). When we replaced the env gene of proA8m1 with a luciferase gene, the effects of the 38 nt fragment on splicing were the same as when the vector has an env gene (data not shown). In addition, as shown in Figure 3, the analysis using vectors with the 38 nt fragment, that is 57-MLV, MSV, FeLV, XMRV and CasBrE, showed that this region has a splicing function in all gamma retroviruses. Thus, the 38 nt fragment seems to play a universal role in splicing. FeLV had some splicing variants in addition to correctly spliced mRNA, suggesting that differences between FeLV and other viruses in the nucleotide sequence of the 38 nt region might have influenced the function of this region in splicing.

We analyzed flanking sequences upstream of the 38 nt fragment to determine whether they influenced splicing (see Fig. 4). We found that sequences with a positive or negative influence on splicing were scattered throughout the 1183–1611 nt upstream flanking region. The vector d3 + 353, produced by deletion of the 1183–1296 bp sequence from d3 + 467, yielded a small number of splice variants. In d3 + 206, produced by deletion of the 1297–1443 bp region from d3 + 353, we recovered abundant splice variants. These findings indicate that the 1183–1443 nt region has a positive influence on splicing. When we deleted the 1444–1541 bp fragment from d3 + 206 to produce d3 + 108, we found only correct splicing; this suggests that the 1444–1541 nt region negatively influences splicing. Deletion of the 1542–1569 bp fragment from d3 + 108 to produce d3 + 80 resulted in cryptic splicing; further deletion of the 1570–1591 bp fragment from d3 + 80 to give d3 + 58 resulted in the appearance of correctly spliced products. These results suggest that the 1542–1569 nt and the 1570–1591 nt regions positively and negatively influence splicing, respectively. When we deleted the 1592–1611 bp fragment from d3 + 58 to produce d3 + 38, abundant splice variants appeared, suggesting that the 1592–1611 nt region positively influences splicing. In the vectors used in this experiment, most of the intronic region was deleted. As stated above, it is possible that changes in pre-mRNA features are also involved in regulating correct splicing. In addition, our results also appear to indicate that the 38 nt fragment and its upstream sequences exert a splicing function in cooperation with the 5140–5400 nt region located in the upstream region of the 3′ss, because when we deleted this fragment from the vectors that carry the 38 bp fragment and its flanking sequences and yield correctly spliced mRNA, abundant splice variants appeared (see Fig. 5).

Because it is known that regulatory cis-elements recruit splicing activators or repressors for the recognition of splice sites in human immunodeficiency virus type 1 [38-48], we assume that cellular factors are recruited to the 38 nt region for its function in splicing. We were unable to identify candidate consensus sequences for the binding of such factors in the 38 nt region. However, we did identify several consensus sequences for the binding of splicing-related factors, such as hnRNP family proteins, SR family proteins and polypyrimidine track-binding protein within the upstream region (1183–1611 nt) of the 38 nt fragment (data not shown). Therefore, it is possible that the 38 nt region interacts with upstream cis-elements that regulate splicing and that this interaction has an important role in the selection of splice sites. Although the mechanisms for this putative interaction are not yet clear, the 38 nt region might interact with cellular factors that bind to the cis-elements through its tertiary structure or via new host factors recruited into the 38 nt region.

As shown in Figure 6, the cryptic 5′ss and cryptic 3′ss that we used in splice variants clustered near the 38 nt fragment of the MLV gene. Among these sites, we identified a few cryptic splicing sites, D4, D5, A6 and A7, which were frequently used. It has been reported that a novel subgenomic 4.4 kb RNA is found in cells infected with replication-competent Moloney MLV. The subgenomic RNA is produced by splicing at an alternative 5′ss (1597 nt) within the gag region and the canonical 3′ss before the env gene [49, 50]. Interestingly, the new 5′ss of Moloney MLV is identical to the D4 (1594 nt) of Fr-MLV. Given that the cryptic splicing sites D4, D5, A6 and A7 were easily utilized in the MLV genome, the 38 nt fragment might play an important role in attenuation of the activities of these potential cryptic splice sites.

ACKNOWLEDGMENTS

  1. Top of page
  2. ABSTRACT
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. ACKNOWLEDGMENTS
  7. DISCLOSURE
  8. REFERENCES

This work was supported in part by funding from MEXT (Ministry of Education, Culture, Sports, Science and Technology): the Matching Fund for Private Universities, S0901015, 2009–2014.

DISCLOSURE

  1. Top of page
  2. ABSTRACT
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. ACKNOWLEDGMENTS
  7. DISCLOSURE
  8. REFERENCES

The authors have no conflict of interest associated with this study.

REFERENCES

  1. Top of page
  2. ABSTRACT
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. ACKNOWLEDGMENTS
  7. DISCLOSURE
  8. REFERENCES
  • 1
    Coffin J.M., Hughes S.H., Varmus H.E. (1997) The Interactions of Retroviruses and Their Hosts. Retroviruses. New York, NY: Cold Spring Harber Laboratory Press.
  • 2
    Desgroseillers L., Barrette M., Jolicoeur P. (1984) Physical mapping of the paralysis-inducing determinant of a wild mouse ecotropic neurotropic retrovirus. J Virol 52: 35663.
  • 3
    Masuda M., Hoffman P.M., Ruscetti S.K. (1993) Viral determinants that control the neuropathogenicity of PVC-211 murine leukemia virus in vivo determine brain capillary endothelial cell tropism of the virus in vitro. J Virol 67: 45807.
  • 4
    Masuda M., Remington M.P., Hoffman P.M., Ruscetti S.K. (1992) Molecular characterization of a neuropathogenic and nonerythroleukemogenic variant of Friend murine leukemia virus PVC-211. J Virol 66: 2798806.
  • 5
    Paquette Y., Hanna Z., Savard P., Brousseau R., Robitaille Y., Jolicoeur P. (1989) Retrovirus-induced murine motor neuron disease: mapping the determinant of spongiform degeneration within the envelope gene. Proc Natl Acad Sci USA 86: 3896900.
  • 6
    Szurek P.F., Yuen P.H., Jerzy R., Wong P.K. (1988) Identification of point mutations in the envelope gene of Moloney murine leukemia virus TB temperature-sensitive paralytogenic mutant ts1: molecular determinants for neurovirulence. J Virol 62: 35760.
  • 7
    Takase-Yoden S., Watanabe R. (1997) Unique sequence and lesional tropism of a new variant of neuropathogenic friend murine leukemia virus. Virology 233: 41122.
  • 8
    Yuen P.H., Tzeng E., Knupp C., Wong P.K. (1986) The neurovirulent determinants of ts1, a paralytogenic mutant of Moloney murine leukemia virus TB, are localized in at least two functionally distinct regions of the genome. J Virol 59: 5965.
  • 9
    Takase-Yoden S., Wada M., Watanabe R. (2006) A viral non-coding region determining neuropathogenicity of murine leukemia virus A8 is responsible for envelope protein expression in the rat brain. Microbiol Immunol 50: 197201.
  • 10
    Takase-Yoden S., Watanabe R. (2005) A 0.3-kb fragment containing the R-U5-5′ leader sequence is essential for the induction of spongiform neurodegeneration by A8 murine leukemia virus. Virology 336: 110.
  • 11
    Hoshi S., Odawara T., Oshima M., Kitamura Y., Takizawa H., Yoshikura H. (2002) cis-Elements involved in expression of unspliced RNA in Moloney murine leukemia virus. Biochem Biophys Res Commun 290: 113944.
  • 12
    Oshima M., Odawara T., Hanaki K., Igarashi H., Yoshikura H. (1998) cis Elements required for high-level expression of unspliced gag-containing message in Moloney murine leukemia virus. J Virol 72: 641420.
  • 13
    Oshima M., Odawara T., Matano T., Sakahira H., Kuchino Y., Iwamoto A., Yoshikura H. (1996) Possible role of splice acceptor site in expression of unspliced gag-containing message of Moloney murine leukemia virus. J Virol 70: 228695.
  • 14
    Arrigo S., Beemon K. (1988) Regulation of Rous sarcoma virus RNA splicing and stability. Mol Cell Biol 8: 485867.
  • 15
    Cook C.R., Mcnally M.T. (1999) Interaction between the negative regulator of splicing element and a 3′ splice site: requirement for U1 small nuclear ribonucleoprotein and the 3′ splice site branch point/pyrimidine tract. J Virol 73: 2394400.
  • 16
    Fogel B.L., Mcnally M.T. (2000) A cellular protein, hnRNP H, binds to the negative regulator of splicing element from Rous sarcoma virus. J Biol Chem 275(32) 3718.
  • 17
    Giles K.E., Beemon K.L. (2005) Retroviral splicing suppressor sequesters a 3′ splice site in a 50S aberrant splicing complex. Mol Cell Biol 25: 4397405.
  • 18
    Katz R.A., Kotler M., Skalka A.M. (1988) cis-Acting intron mutations that affect the efficiency of avian retroviral RNA splicing: implication for mechanisms of control. J Virol 62: 268695.
  • 19
    Mcnally M.T., Beemon K. (1992) Intronic sequences and 3′ splice sites control Rous sarcoma virus RNA splicing. J Virol 66: 611.
  • 20
    Mcnally M.T., Gontarek R.R., Beemon K. (1991) Characterization of Rous sarcoma virus intronic sequences that negatively regulate splicing. Virology 185: 99108.
  • 21
    Stoltzfus C.M., Fogarty S.J. (1989) Multiple regions in the Rous sarcoma virus src gene intron act in cis to affect the accumulation of unspliced RNA. J Virol 63: 166976.
  • 22
    Mcnally L.M., Mcnally M.T. (1996) SR protein splicing factors interact with the Rous sarcoma virus negative regulator of splicing element. J Virol 70: 116372.
  • 23
    Mcnally L.M., Mcnally M.T. (1998) An RNA splicing enhancer-like sequence is a component of a splicing inhibitor element from Rous sarcoma virus. Mol Cell Biol 18: 310311.
  • 24
    Yamamoto N., Takase-Yoden S. (2009) Friend murine leukemia virus A8 regulates Env protein expression through an intron sequence. Virology 385: 11525.
  • 25
    Abbink T.E., Berkhout B. (2008) RNA structure modulates splicing efficiency at the human immunodeficiency virus type 1 major splice donor. J Virol 82: 30908.
  • 26
    Kraunus J., Schaumann D.H., Meyer J., Modlich U., Fehse B., Brandenburg G., Von Laer D., Klump H., Schambach A., Bohne J., Baum C. (2004) Self-inactivating retroviral vectors with improved RNA processing. Gene Ther 11: 156878.
  • 27
    Zychlinski D., Erkelenz S., Melhorn V., Baum C., Schaal H., Bohne J. (2009) Limited complementarity between U1 snRNA and a retroviral 5′ splice site permits its attenuation via RNA secondary structure. Nucleic Acids Res 37: 742940.
  • 28
    Choo Y.C., Seki Y., Machinaga A., Ogita N., Takase-Yoden S. (2013) The 0.3-kb fragment containing the R-U5-5′ leader sequence of Friend murine leukemia virus influences the level of protein expression from spliced mRNA. Virol J 10: 124.
  • 29
    Kramer A. (1996) The structure and function of proteins involved in mammalian pre-mRNA splicing. Annu Rev Biochem 65: 367409.
  • 30
    Smith C.W., Valcarcel J. (2000) Alternative pre-mRNA splicing: the logic of combinatorial control. Trends Biochem Sci 25: 3818.
  • 31
    Blencowe B.J. (2000) Exonic splicing enhancers: mechanism of action, diversity and role in human genetic diseases. Trends Biochem Sci 25: 10610.
  • 32
    Cartegni L., Chew S.L., Krainer A.R. (2002) Listening to silence and understanding nonsense: exonic mutations that affect splicing. Nat Rev Genet 3: 28598.
  • 33
    Schaal T.D., Maniatis T. (1999) Multiple distinct splicing enhancers in the protein-coding sequences of a constitutively spliced pre-mRNA. Mol Cell Biol 19: 26173.
  • 34
    Singh R., Valcarcel J. (2005) Building specificity with nonspecific RNA-binding proteins. Nat Struct Mol Biol 12: 64553.
  • 35
    Graveley B.R. (2000) Sorting out the complexity of SR protein functions. RNA (New York, NY) 6: 1197211.
  • 36
    Black D.L. (2003) Mechanisms of alternative pre-messenger RNA splicing. Annu Rev Biochem 72: 291336.
  • 37
    Busch A., Hertel K.J. (2012) Evolution of SR protein and hnRNP splicing regulatory factors. Wiley Interdiscip Rev RNA 3: 112.
  • 38
    Bilodeau P.S., Domsic J.K., Mayeda A., Krainer A.R., Stoltzfus C.M. (2001) RNA splicing at human immunodeficiency virus type 1 3′ splice site A2 is regulated by binding of hnRNP A/B proteins to an exonic splicing silencer element. J Virol 75: 848797.
  • 39
    Caputi M., Freund M., Kammler S., Asang C., Schaal H. (2004) A bidirectional SF2/ASF- and SRp40-dependent splicing enhancer regulates human immunodeficiency virus type 1 rev, env, vpu, and nef gene expression. J Virol 78: 651726.
  • 40
    Caputi M., Zahler A.M. (2002) SR proteins and hnRNP H regulate the splicing of the HIV-1 tev-specific exon 6D. EMBO J 21: 84555.
  • 41
    Domsic J.K., Wang Y., Mayeda A., Krainer A.R., Stoltzfus C.M. (2003) Human immunodeficiency virus type 1 hnRNP A/B-dependent exonic splicing silencer ESSV antagonizes binding of U2AF65 to viral polypyrimidine tracts. Mol Cell Biol 23: 876272.
  • 42
    Jacquenet S., Decimo D., Muriaux D., Darlix J.L. (2005) Dual effect of the SR proteins ASF/SF2, SC35 and 9G8 on HIV-1 RNA splicing and virion production. Retrovirology 2: 33.
  • 43
    Stoltzfus C.M., Madsen J.M. (2006) Role of viral splicing elements and cellular RNA binding proteins in regulation of HIV-1 alternative RNA splicing. Curr HIV Res 4: 4355.
  • 44
    Tange T.O., Damgaard C.K., Guth S., Valcarcel J., Kjems J. (2001) The hnRNP A1 protein regulates HIV-1 tat splicing via a novel intron silencer element. EMBO J 20: 574858.
  • 45
    Tange T.O., Kjems J. (2001) SF2/ASF binds to a splicing enhancer in the third HIV-1 tat exon and stimulates U2AF binding independently of the RS domain. J Mol Biol 312: 64962.
  • 46
    Tranell A., Fenyo E.M., Schwartz S. (2010) Serine- and arginine-rich proteins 55 and 75 (SRp55 and SRp75) induce production of HIV-1 vpr mRNA by inhibiting the 5′-splice site of exon 3. J Biol Chem 285(31) 53747.
  • 47
    Zahler A.M., Damgaard C.K., Kjems J., Caputi M. (2004) SC35 and heterogeneous nuclear ribonucleoprotein A/B proteins bind to a juxtaposed exonic splicing enhancer/exonic splicing silencer element to regulate HIV-1 tat exon 2 splicing. J Biol Chem 279(10) 07784.
  • 48
    Zhu J., Mayeda A., Krainer A.R. (2001) Exon identity established through differential antagonism between exonic splicing silencer-bound hnRNP A1 and enhancer-bound SR proteins. Mol Cell 8: 135161.
  • 49
    Dejardin J., Bompard-Marechal G., Audit M., Hope T.J., Sitbon M., Mougel M. (2000) A novel subgenomic murine leukemia virus RNA transcript results from alternative splicing. J Virol 74: 370914.
  • 50
    Houzet L., Battini J.L., Bernard E., Thibert V., Mougel M. (2003) A new retroelement constituted by a natural alternatively spliced RNA of murine replication-competent retroviruses. EMBO J 22: 486675.