Single nucleotide polymorphism-based molecular typing of M. leprae from multicase families of leprosy patients and their surroundings to understand the transmission of leprosy



The exact mode of transmission of leprosy is not clearly understood; however, many studies have demonstrated active transmission of leprosy around a source case. Families of five active leprosy cases and their household contacts were chosen from a high endemic area in Purulia. Fifty-two soil samples were also collected from different areas of their houses. DNA was extracted from slit-skin smears (SSS) and soil samples and the Mycobacterium leprae-specific RLEP (129 bp) region was amplified using PCR. Molecular typing of M. leprae was performed for all RLEP PCR-positive samples by single nucleotide polymorphism (SNP) typing and confirmation by DNA sequencing. SSS of these five patients and six out of the total 28 contacts were PCR positive for RLEP whereas 17 soil samples out of 52 showed the presence of M. leprae DNA. SNP typing of M. leprae from all RLEP PCR-positive subjects (patients and smear-positive contacts) and 10 soil samples showed the SNP type 1 genotype. M. leprae DNA from the five leprosy patients and the six contacts was further subtyped and the D subtype was noted in all patients and contacts, except for one contact where the C subtype was identified. Typing followed by subtyping of M. leprae clearly revealed that either the contacts were infected by the patients or both patients and contacts had the same source of infection. It also revealed that the type of M. leprae in the soil in the inhabited areas where patients resided was also of the same type as that found in patients.


Leprosy is a chronic infectious disease caused by Mycobacterium leprae. It is one of the oldest recorded diseases of mankind. The changes in the registry pattern after the implementation of Multi drug therapy (MDT) in the vertical programme have drastically brought down the prevalence (PR) of leprosy, whereas the incidence has not come down in many places in the world [1], including India [2], where a prevalence of <1/10 000 has been attained. A total of 11 districts with an incidence rate of >50/100 000 population still exist in Chhattisgarh, Gujarat, Maharashtra, West Bengal, Dadra & Nagar Haveli, Orissa and Delhi [2]. The global use of MDT seems to have had only minimal, if any, effect on transmission of the disease [3] and an adequate explanation for this situation is lacking. Multibacillary (MB) leprosy patients harbour enormous numbers of leprosy bacilli and discharge them freely from their skin, nasal ulcers and saliva [4, 5]. Coughing and sneezing can give rise to formation of droplets and droplet nuclei, which in turn enter the respiratory system of close contacts. In a house or in a community such leprosy patients are in contact with households and neighbours and have other social relationships. The contacts of leprosy patients are known to have an increased risk of contracting leprosy themselves. The estimated risk of leprosy was about nine times higher in households of patients and four times higher in direct neighbouring houses of patients compared with households that had no such contact with patients [6, 7]. The highest risk of leprosy was associated with households of multibacillary patients [6]. It has been reported that a single mouthwash of an MB patient may yield 1.6 million M. leprae [8].

Various studies have suggested that M. leprae can be found in the environment and may have a role in continuing transmission of the disease [9-11]. The presence of M. leprae DNA has also been reported in water samples in Indonesia [9] and soil samples from high prevalence areas of northern India [10]. In such endemic areas molecular tools can be of help in devising techniques for understanding the epidemiology of leprosy and identifying sources, as well as finding out the source of persisting foci of infection. Application of molecular methods to elicit strain differences within the leprosy bacillus would be of utmost importance for this purpose. Molecular typing will make it feasible not only to study the global and geographical distribution of distinct clones of M. leprae in the population, but also to explore correlation between the M. leprae and the type of disease manifested and provide insight into historical and phylogenetic evolution of the bacillus [12]. Ultimately these genetic markers may hold the key to establishing species and strain-specific markers for identifying the sources of M. leprae and tracing transmission patterns.

Recently, a complete genome sequence of an isolate from Tamil Nadu, India (TN strain), helped to develop a polymorphic genomic marker for M. leprae. After screening a large number of Mleprae isolates from different parts of the world, Mleprae has been classified into four single nucleotide polymorphism (SNP) types and 16 subtypes [12, 13]. Therefore, SNPs may hold the promise of establishing species and strain-specific markers for identifying the sources of M. leprae and tracing transmission patterns. The aim of present study was to detect Mleprae DNA by using PCR and perform typing based on SNP PCR, followed by restriction enzyme digestion from slit-skin smears of leprosy patients and their household contacts and environmental samples.

Materials and Methods

Ethical approval

The study was approved by the Ethical Committee of The Leprosy Mission, India. Informed consent was obtained from all the patients and contacts enrolled in the study.

Slit-skin smear samples

Slit-skin smear collection is an invasive procedure where 5 mm long and 2 mm deep incisions are made on the left and right earlobe, patches and forearm, after blanching the area between the thumb and forefinger, and the superficial tissue material is scraped four times with horizontal strokes of the blade without any contamination with blood along the skin-slit, and mixed with 700 μL of 70% ethanol in a micro-centrifuge tube. Later the samples were transferred to the laboratory and centrifuged to sediment a pellet of tissue material. After receiving consent, slit-skin smear samples were collected from both earlobes of five active MB leprosy patients and their household contacts. The contacts selected for the study had clinical assessment data available from the records of The Leprosy Mission Hospital, Purulia.

We observed that the mean bacterial index (BI) of all five patients was 3+ and six contacts on follow-up were found to be MB cases with an average BI of 2+. BI is an expression of the extent of bacillary load. It is calculated by counting six to eight stained smears under the 100× oil immersion lens. The BI 2+ means at least one bacillus observed in every 10 fields of slides under the microscope and BI 3+ indicates one bacillus in every field. Intense clinical assessment of the contacts in each family revealed a total of six contacts manifesting cardinal signs of leprosy and 22 contacts without any signs and symptoms of leprosy. Slit-skin smear samples were collected and AFB staining was performed for all. (Table 2). The slit-skin smear samples (SSS) were collected during field visits in different blocks of Purulia District, West Bengal, and were transported in 70% ethanol in micro-centrifuge tubes to the laboratory at room temperature (25°C). The tubes were kept at 4°C until further use.

Environmental samples

Fifty-two soil samples were collected from different places around the houses of leprosy patients. Soil samples were collected from areas used for bathing, drinking, sleeping and sitting and the entrances of the houses. Initially soil was dug (3–4 inches deep) and 10 gm from each site was collected in clean plastic containers with the help of a ‘trowel’ and labelled with a unique specific code. The collected samples were transported to the laboratory at room temperature (within 2 days) and thereafter stored at 4–8°C till further processing.

DNA extraction from slit-skin smears

The Proteinase K Lysis method was used for Mleprae DNA extraction from slit-skin smear samples [14]. In brief, smears collected in 1 mL 70% ethanol were centrifuged at 8000 g for 10 min. The supernatant was discarded and the pellet was air-dried for the removal of ethanol. After ethanol removal, samples were kept for overnight lysis in lysis buffer (100 mM Tris buffer pH 8.5 with 1 mg/mL proteinase K and 0.05% Tween 20) at 60°C. The Proteinase K was inactivated at 97°C for 10 min. This lysate preparation was further used for PCR.

DNA extraction from environmental soil samples

These soil samples were processed for DNA extraction by using a method described earlier [11]. In brief, 100 mg of soil was weighed and dried in a 1.5-mL microfuge tube; 500 μL ethanol was added to the tube along with 0.1 mm zirconium beads and homogenized using a bead beater to ensure and facilitate lysis of the cells. It was then centrifuged at 8000 g at 4° C and ethanol was discarded. Following this, 250 μL of lysis buffer (100 mM Tris buffer pH 8.5 with 1 mg/mL proteinase K and 0.05% Tween 20) was added to the pellet and incubated at 60°C overnight in a water bath. The reaction was terminated by inactivating Proteinase K at 97°C for 15 mins, and then 30 μL of 10% SDS was added to the tube and incubated at 60°C for 1 h in a water bath. Subsequently, 500 μL of Tris-EDTA NaCl-PVP buffer (TENP buffer) pH 9.0 was added and the tube was incubated for 1 h at room temperature with regular vortexing at 5-min intervals. This was followed by centrifugation at 3300 g for 10 mins. DNA was precipitated by adding 70% ethanol and incubated at −20° C for 2–3 h (preferably overnight). Subsequently, the tubes were centrifuged at 8000 g for 15 mins and supernatant discarded. The pellet was air-dried for about 15–20 min to ensure complete removal of ethanol. The pellet was resuspended in 50 μL 10 mM TE buffer (pH 8.0) and incubated at 37°C in a water bath for 1 h to ensure that DNA went into solution. The DNA solution was then passed through the inhibitor removal resin columns (Epicentre Biotechnologies, Madison, WI, USA, Catalogue no. SR04350) prior to storage at −20°C until further use.

PCR amplification using the M. leprae-specific repetitive element (RLEP) region

PCR amplification was carried out in 25 μL of reaction volume that contained 2 μL of template DNA, primers at a final concentration of 0.5 μM (forward and reverse) and 1X Genei Mix (Merck, Delhi, India). We used M. leprae-specific primers (PS1- TGCATGTCATGGCCTTGAGG; PS2 -CACCGATACCAGCGGCAGAA) described previously [15]. The amplification was carried out in a thermal cycler (Corbett Research, Sydney, Australia) using the following conditions: one cycle of denaturation at 95°C for 5 min followed by 35–45 cycles at 94°C for 30 s, annealing at 58°C for 30 s, extension at 72°C for 1 min and one cycle of final extension at 72°C for 10 min. PCR product (129 bp) containing amplified fragments of the target region was electrophoresed in a 2% agarose gel (Sigma-Aldrich, New Delhi, India) using Tris-Borate-EDTA buffer at 100 volts constant voltage.

SNP typing of Mleprae using the PCR-RFLP method

To amplify three SNP loci, 1, 2 and 3 at nucleotide positions 14676, 1642875 and 2935685, Mleprae genomic DNA (RLEP-positive samples) was amplified using previously reported primer sequences [12]. Details of primers used for genotyping are given in Table 1. Briefly, reactions (20 μL) typically contained M. leprae DNA from different samples, 10 mM Tris-HCl (pH 9.0), 50 mM KCl, 1.5 mM MgCl2, 1.5 U Taq DNA polymerase (Qiagen, Delhi, India) and 200 nM each of forward and reverse primers. PCR was carried out by initial denaturation at 95°C for 5 min followed by 35 cycles consisting of denaturation at 95°C for 30 s, annealing at 58°C for 30 s and extension at 72°C for 30 s, with a final extension at 72°C for 10 min in a thermal cycler. The PCR products were resolved by agarose gel electrophoresis and detected by ethidium bromide staining.

Table 1. Primers used for genotyping DNA
Locus (Nt)Primer nameOligonucleotide primers
  1. Primer sequences per Monot et al. [13].


Restriction digestion assays were carried out according to the protocol described earlier [16] using SmlI, CviKI-1 and BstUI (New England Biolabs, Ipswich, MA, USA) for SNP loci 1, 2 and 3, respectively. The PCR products (5 μL) were digested with 1 unit of the enzymes. The SmlI, BstUI and CviKI-1 reactions were performed at 55, 60 and 37°C, respectively, for 1 h.

The SmlI- and BstUI-uncut and -cut DNAs were subjected to electrophoresis on 3% agarose gels. The gels were stained with ethidium bromide and visualized by UV transillumination using the Gel Documentation System. M. leprae DNA from Brazilian strain Br 4923 and Thai 53 from Thailand were used as reference strains for type 4 and type 1, respectively.

PCR used for subtyping of Mleprae

To amplify four SNP subtyping loci 1 at nucleotide positions 8453, 313361, 61425 and 1642879, Mleprae genomic DNA was amplified using previously reported [13] primer sequences as shown in Table 1. The reaction mix (25 μL) consisted of 10 mM Tris-HCl (pH 9.0), 50 mM KCl, 1.5 mM MgCl2, 1.5 U Taq DNA polymerase (Qiagen), 200 nM of each primers and 2 μL DNA sample. PCR was carried out using initial denaturation at 95°C for 5 min followed by 40 cycles consisting of denaturation at 94°C for 1 min, annealing at 55°C for 1 min and extension at 72°C for 2 min, with a final extension at 72°C for 10 min in a thermal cycler. After amplification of PCR products were run on 2% agarose gel by electrophoresis. The amplicons were outsourced for commercial sequencing (Xplorigen Technologies, Delhi, India). Sequence data were visualized by using the Codon Code aligner and quality trimmed sequence data aligned using Basic Local Alignment Search (tool) (BLAST) from National Centre for Biotechnology Information (NCBI).


Detection of Mleprae DNA by PCR

Polymerase chain reaction of DNA extracted from SSS samples of the five patients and six household contacts showed amplification of RLEP region (Table 2). Similarly, when DNA extracted from soil samples was screened using PCR (RLEP region) specific for Mleprae it was observed that 17 soil samples out of 52 were positive for Mleprae DNA (Fig. 1).

Table 2. Leprosy patients and their household contacts
Sr.noFamiliesRelationAge/SexBacillary index (BI)M. leprae DNA PCR Results
  1. a

    Means case.

  2. b

    First person in the family is primary case whereas the subsequent subjects with PCR-positive results are the ones who developed disease subsequently.

1Family 1Son a25/M3+Positive
5Family 2Mother a45/F3+Positive
8Son15/MCured caseNegative
9Family 3Son a23/M4+Positive
15Elder child5/MNegative
16Younger child7/MNegative
17Family 4Daughter a15/F4+Positive
20Family 5Sistera15/F4+Positive
21Brother 126/M2+Positive
22Brother's wifea24/FNegative
26Brother's wifeb20/FNegative
27Brother's son (elder)2/MNegative
28Brother's son (younger)5/MNegative
Figure 1.

Detection of Mycobacterium leprae from environmental samples targeting the RLEP region. PCR amplification of the RLEP region of M. leprae obtained from the environmental samples from Purulia. PCR product was electrophoresed on a 2% agarose gel. Samples were: lane 1, negative control; lane 2, positive control; lane 3, 100 bp ladder, lanes 4–11, environmental samples.

SNP typing and subtyping of M. leprae DNA from multicase families

Eleven SSS samples and ten soil samples that were positive for Mycobacterium leprae DNA PCR were subjected to polymerase chain reaction restriction fragment length polymorphism (PCR-RFLP)-based SNP typing. The samples were amplified using primer for locus 3, which gave a 180 bp amplicon. After restriction of the locus-3 amplicon all samples remained unrestricted. These samples were then amplified for locus-2, which gave a 114 bp amplicon. Restriction of locus-2 was carried out for these samples and we found a restriction pattern with 72 bp and 42 bp fragments. It was observed that all 11 SSS samples and ten soil samples were of SNP type-1.(Fig. 2) The SNP type for all samples was limited to SNP type 1with base combination for the nucleotide position of loci 1, 2, 3 having C,G,A. The 11 SSS samples were further subtyped. (Table 3). It was observed that samples from all the patients and their contacts were of the D subtype (Fig. 3), except for one who had a C subtype (Fig. 4).

Table 3. SNP typing and subtyping from leprosy multicase families
FamiliesFamiliesContactVillagePCR (RLEP region)SNP typeSNP subtype
1Family 1CaseJaipurPositiveType-1D
2Family 2CaseJaipurPositiveType-1D
3Family 3CaseJaipurPositiveType-1D
4Family 4CaseJhaldaPositiveType-1D
5Family 5CaseJaipurPositiveType-1D
Figure 2.

Polymerase chain reaction restriction fragment length polymorphism of locus-2. Product was electrophoresed on 4% agarose gel. Samples were: lanes 1, 3, 5, 7, unrestricted sample; restricted 2, 4, 6, 8 and lane 9, Thai strain unrestricted sample; lane 10 restricted, Thai strain.

Figure 3.

SNP subtype D from slit-skin smears.

Figure 4.

SNP subtype C from slit-skin smears.


Transmission of leprosy in family units remains a serious concern. Transmission of leprosy disease from one person to another is generally by direct and close contact with an infectious case. The possibility of indirect transmission depends mainly upon the viability of the organisms outside the human body. It has been shown that M. leprae can survive outside the human body [17]. We had conducted extensive studies on standardization of the DNA and RNA extraction protocols in one of our previous studies funded by the Indian Council of Medical Research, India. We had spiked soil samples with different numbers of M. smegmatis and carried out DNA extraction to see workability as well as sensitivity of our protocols. Further while undertaking this study, we considered the laboratory observations of Dr Desikan and his colleagues, who demonstrated the viability of M. leprae in different environmental and laboratory conditions. Viability of M. leprae was verified by their multiplication in the footpads of normal mice. After drying in the shade the organisms were viable for up to 5 months. On wet soil, they remained alive for 46 days. Kept in saline at room temperature, the organisms lived for 60 days. Surprisingly, on exposure to direct sunlight for 3 h a day the bacteria survived for 7 days. On refrigeration at 4°C, the bacteria could be preserved for 60 days. On the other hand, when kept at −70°C, the bacteria could be maintained in a living condition for only 28 days. On exposure to antiseptics such as Savlon (R) and alcohol, the bacteria were rapidly killed. Based on their observations, we designed this study to identify and validate similar observations from the environment and field conditions.

All the experiments were performed under controlled sterile aseptic conditions and all the reagents utilized in the extraction protocols were mixed and used as sample for PCR amplifications in order to determine the possible cross-contamination of the actual samples with reagents involved in various protocols. The presence of M. leprae DNA has also been reported in water samples in Indonesia [9]) and soil samples from high-prevalence areas of northern India [10, 11]. In some studies, it has been suggested that in endemic countries >50% of leprosy patients may have a history of intimate contact with an infected person (often a household contact) [18]. Leprosy patients in non-endemic locales can identify such contact only 10% of the time [19]. Transmission of leprosy can be by direct contact or by indirect means involving fomites but is thought to occur most frequently through long-term direct contact with an infected host [20]. The present study was therefore conducted in order to understand the transmission of infection within families with leprosy living in a rural endemic village. We have collected soil samples from around the inhabited areas, washing areas, bathing areas, entrance of the house and sitting areas of the positive and high bacillary index active MB leprosy cases as these areas are most likely to get contaminated by patients. Furthermore, the areas chosen for sample collection were from high endemic zones of leprosy and were from typical villages with very poor sanitation and hygiene.

It was also reported in the literature that a single mouthwash of an MB patient may yield 1.6 million M. leprae [8]. Other than this, spitting, sneezing, blowing the nose and shedding of bacteria during bathing, washing, etc., will also contaminate the soil. Hence we assume the load in the inhabited areas may have a concentration of M. leprae sufficient enough to detect using molecular techniques. Soil contains abundant humic acid and fulvic acid, which are inhibitory to Taq DNA polymerase and other enzymes used in PCR assay. We modified the soil DNA extraction protocol by incorporating a step of using inhibitor removal resin (Epicenter), which removed the PCR inhibitors from soil samples. To ensure complete removal of PCR inhibitory substances and successful DNA extraction, we spiked some of the samples during processing with Mycobacterium smegmatis and checked for the DNA using PCR. Further, we used a highly specific and sensitive M. leprae gene region called RLEP, which is repeated 28 times in the M. leprae chromosome only and is absent in all other Mycobacteria.

Experimental negative controls (reagent control) included a mix of DNA extraction reagents and a mix of PCR buffers, and PCR was performed with every single test sample and absence of bands on 2% agarose gels was recorded before confirming the results. PCR amplifications using positive control (known M. leprae DNA) are used as standard reference for the comparison of the specific band size. The bias in the visualizations was taken care of by analysis of the gel images by an investigator who was not involved in the study using Alpha Imager Software (Alpha Innotech Inc, Santa Clara, CA, USA.).

Several studies have reported the usefulness of polymorphic markers for M. leprae as an epidemiological tool in differentiation of strains of M. leprae [13, 16, 21-24]. Based on the discovery of three SNPs in M. leprae, it has been previously reported that there are four major SNP types associated with different geographical regions around the world. The most common approach to SNP typing was useful and effective in molecular epidemiological studies [13]. Further studies on the presence of the 78 informative SNPs were subsequently carried out in c. 400 isolates, enabling classification of M. leprae into 16 SNP subtypes of limited geographical distribution that correlate with the patterns of human migrations and trade routes [13]. These 16 SNP subtypes were useful for tracking the transmission of Mleprae and source of infection. It was earlier reported that by using three microsatellite loci containing trinucleotide or dinucleotide repeats, extensive diversity was observed in a cross-sectional survey of 33 patients. Closely related profiles were found in members of a multicase family likely to share a common transmission source [25]. The present study was based on the detection of Mleprae from the slit-skin smears of index cases and their household contacts and the samples from their surrounding environments.

We have detected M. leprae DNA from the SSS and soil samples by using the (repetitive element) RLEP-PCR method. We found M. leprae DNA from soil samples specifically in areas where active leprosy patients reside. This suggests that shedding of M. leprae from active MB leprosy cases in residential areas may lead to a susceptible person being indirectly exposed to and/or infected with M. leprae. All the PCR-positive SSS samples analyzed by SNP typing were of SNP type 1. Mleprae DNA from the patients and their household contacts was further subtyped and it was noted that the 1D subtype was predominant in these families, which strongly indicated that the spread of infection in the families was from active source cases of MB leprosy. Further, it was also observed that a similar subtype 1D was present in the majority of the multicase families, including three families from the Jaipur region (an index case and his father in one family, an index case and mother in another family, and an index case and her brother in the third family). Similarly, we found the same 1D subtype in an index case and his mother from the Jhalda region of Purulia. However, in one of the families from the Jaipur region we observed that an index case and her daughter had a similar 1D subtype but one contact had a 1C subtype, indicating that the source of infection was different from the other two cases and infection might have occurred from other source (outside the home) (Table 3). Thus the present study with subtyping of M. leprae clearly highlights the possible source of infection and that most of the contacts were either infected by the patients and/or both patients and contacts had the same source of infection from the environment.


We wish to thank the Indian Council of Medical Research (ICMR-Task Force Project No. 5/8/3(12)/2009-ECD-I(A)) for the financial support. We are grateful to Mr Atul Roy for assisting us in the sample collection. We also thank the Superintendent and staff of TLM, Purulia, for their help and assistance during the fieldwork. We wish to acknowledge the support of The Leprosy Mission, India, in carrying out this work. We also acknowledge Dr Sunil Anand (Director), TLM India, Dr Annamma John (Research Coordinator) and Dr PSS Sundar Rao, (Consultant), TLM, India, for their guidance and encouragement.

Transparency Declaration

The Authors declare that there are no conflicts of interest.