SEARCH

SEARCH BY CITATION

Keywords:

  • Rhizobium ;
  • Bradyrhizobium ;
  • Millettia pinnata ;
  • numerical taxonomy;
  • 16S rRNA gene

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. References

Millettia pinnata (Synonym Pongamia pinnata) is a viable source of oil for the mushrooming biofuel industry, source for agroforestry, urban landscaping, and the bio-amelioration of degraded lands. It also helps in maintaining soil fertility through symbiotic nitrogen fixation. However, not much work is reported on classification and characterization of the rhizobia associated with this plant. In the present study, an attempt was made to isolate rhizobial strains nodulating Millettia from soils collected from southern regions of India. The isolates were characterized using numerical taxonomy, 16S rRNA gene sequencing, and cross nodulation ability. The results showed high phenotypic and genetic diversity among the rhizobia symbiotic with Millattia pinnata. The isolates formed five clusters at similarity level of 0.82 based on the results of numerical taxonomy. Results on 16S rRNA gene sequence analysis revealed that most microsymbionts of M. pinnata belonged to Rhizobium and Bradyrhizobium, which are closely related to Rhizobium sp., B. elkanii and B. yuanmingense. Among these isolates, some isolates could grow in a pH range of 4.0–10.0, some could tolerate a high salt concentration (3% NaCl) and could grow at a maximum temperature between 35 and 45 °C. M. pinnata formed nodules with diverse rhizobia in Indian soils. These results offered the first systematic information about the microsymbionts of M. pinnata grown in the soils from southern part of India.


Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. References

Millettia pinnata (L.) Pierre, an arboreal legume, is a member of the subfamily Papilionoideae. This medium-size multi-purpose tree is indigenous to the Indian sub-continent and south-east Asia and has been successfully introduced to humid tropical regions of the world as well as parts of Australia, New Zealand, China, and the United States. Historically, this plant has been used in India and neighboring regions as a source of traditional medicines, animal fodder, green manure, timber, poisoning the fish, and fuel. Millettia pinnata plays an important socioeconomic role in reforestation programs, urban landscaping and has recently been recognized as a viable source of oil for the burgeoning biofuel industry (Azam et al., 2005; Karmee & Chadha, 2005). It is also used in agriculture and environmental management, due to its insecticidal and nematicidal properties (Kabir et al., 2001).

The association between rhizobia and members of the family Leguminosae accounts for 80% of biologically fixed nitrogen and contributes 25–30% of the worldwide protein intake (Vance, 1997). To date, more than 98 species have been described for legume-associated symbiotic nitrogen-fixing bacteria within the genera Rhizobium, Mesorhizobium, Ensifer, Bradyrhizobium, Burkholderia, Phyllobacterium, Microvirga, Azorhizobium, Ochrobactrum, Methylobacterium, Devosia, and Shinella in the Alphaproteobacteria group, as well as Burkholderia and Cupriavidus in the Betaproteobacteria group (webpage of Dr Euzeby: http://www.bacterio.cict.fr). Rhizobia have been characterized from wild and tree legumes, and several novel taxa have been proposed on the basis of these studies (Wolde-Meskel et al., 2005; Yan et al., 2007; Diouf et al., 2010; Shetta et al., 2011). The isolation and characterization of new Rhizobium isolates from different leguminous species is an interesting field of work that helps to understand the diversity and evolution of rhizobia.

The existing and potential importance of M. pinnata has been highlighted (Paul et al., 2008). Its nodulation has been reported (Allen & Allen, 1981; Ather, 2005). Dayama (1985) noted nodulation in M. pinnata grown in sandy loam soil and the stimulatory effect of foliar applied sucrose on nodule number and plant growth. Siddiqui (1989) reported the nodulation and associated nitrate reductase activity of M. pinnata seedlings grown on locally derived garden soil, sand, and farm manure. Interestingly, in preliminary nodulation studies, Pueppke & Broughton (1999) were able to demonstrate the effective nodulation in M. pinnata with three strains of rhizobia; Bradyrhizobium japonicum strain CB1809, a strain more commonly associated with Glycine max; Bradyrhizobium sp. strain CB564, a strain previously isolated in Australia from M. pinnata; and Rhizobia sp. strain NGR234. However, taxonomic work on rhizobia nodulating this legume tree is not well reported, and there is a clear need to characterize in more detail the spectrum of rhizobia that can form an effective symbiotic relationship with M. pinnata.

Considering the potential value of M. pinnata in sustainable agriculture, agroforestry, and the lack of studies on the diversity of rhizobia associated with these plants, we aimed to collect and characterize rhizobia associated with this plant in the southern region of India where large-scale plantations of this plant were taken up for biodiesel production. In this research, 29 nodule rhizobia, isolated from soils of the M. pinnata growing southern region of India, were characterized. The aims of the research were to examine the diversity and to study the taxonomic position of the isolates by both phenotypic and genetic analysis. We also aimed at the selection of strains with a potential to promote plant growth of M. pinnata.

Materials and methods

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. References

Isolates and strains

Rhizospheric soil samples of M. pinnata were collected from different locations in the states of Andhra Pradesh, Maharashtra, and Karnataka. Rhizobia were isolated from the soil samples using M. pinnata as a trap crop (Fig. 1, Table 1). Millettia pinnata seeds of single germplasm were surface sterilized using Tween-80 (100 μL L−1) for 10–30 min followed by 0.1% HgCl2 and 70% ethanol for 30 s and washed 4–6 times with sterile distilled water. These seeds were sown in the pots filled with test soil, and the experiment was conducted under glass house conditions. After 90 days of germination, the plants were uprooted carefully, and mature nodules were collected as explained by Vincent (1970), and rhizobia were isolated using Yeast Extract Mannitol Agar (YEMA) medium containing Congo-red. Single isolated colonies were picked and checked for purity by repeated streaking and by microscopic examination. For confirmation, each isolate was tested individually for nodulation in the host plant. The experiment was conducted in the pots filled with sterile sand. Surface sterilized seeds were sown after germination inoculated with culture broth as described by Vincent (1970). Inoculated plants were grown in a greenhouse at 30 °C during the day and 26 °C during the night.

image

Figure 1. Location of the soil sampling sites

Download figure to PowerPoint

Table 1. Rhizobial isolates, origin and climatic conditions
Isolate no.Isolate nameOriginStateAgro-ecological zoneSoil typeAnnual rainfall (mm)Temperature (oC)
Max.Min.
1PRNB-1JaggayyapetaAndhra PradeshKrishna GodavariVertisols800–11003623
2PRNB-2VatsavaiAndhra PradeshKrishna GodavariAlfisols800–11003623
3PRNB-3SirpurMaharashtraCentral Maharashtra PlateauVertisols700–9004121
4PRNB-4AkolaMaharashtraCentral Maharashtra PlateauVertisols700–9004121
5PRNB-5RajamundryAndhra PradeshKrishna GodavariVertisols800–11003623
6PRNB-6EturnagaramAndhra PradeshNorthern TelanganaVertisols900–15003721
7PRNB-7ChevellaAndhra PradeshSouthern TelanganaVertisols700–9003422
8PRNB-8CuddapahAndhra PradeshSouthernVertisols700–11004623
9PRNB-9GuntakalAndhra PradeshScare rainfallVertisols500–7503624
10PRNB-10YemmiganurAndhra PradeshScare rainfallVertisols500–7503624
11PRNB-11ProdduturAndhra PradeshScare rainfallVertisols500–7503624
12PRNB-12BijapurKarnatakaNoarth Eastern TransitionVertisols600–7504221
13PRNB-13Hanuman junctionAndhra PradeshKrishna GodavariVertisols800–11003623
14PRNB-15ChoppadandiAndhra PradeshNorthern TelanganaVertisols900–15003721
15PRNB-16Sunigram,Andhra PradeshNorthern TelanganaVertisols900–15003721
16PRNB-21Cuddapah forestAndhra PradeshSouthernAlfisols700–11004623
17PRNB-22AdimilliAndhra PradeshSouthern TelanganaVertisols700–9003422
18PRNB-23PenpahadAndhra PradeshSouthern TelanganaVertisols700–9003422
19PRNB-24ChoutuppalAndhra PradeshSouthern TelanganaVertisols700–9003721
20PRNB-25ChintapalliAndhra PradeshSouthern TelanganaAlfisols700–9003422
21PRNB-26DammayyagudemAndhra PradeshKrishna GodavariVertisols800–11003623
22PRNB-27RamkrishnapuraAndhra PradeshNorthern TelanganaAlfisols900–15003721
23PRNB-28PragnapurAndhra PradeshNorthern TelanganaVertisols900–15003721
24PRNB-29AnantasagarAndhra PradeshNorthern TelanganaVertisols900–15003721
25PRNB-30KanchikacherlaAndhra PradeshKrishna GodavariVertisols800–11003623
26PRNB-31AmaravathiAndhra PradeshKrishna GodavariVertisols800–11003623
27PRNB-32AtmakurAndhra PradeshSouthern TelanganaVertisols700–9003422
28PRNB-33UlavapaduAndhra PradeshSouthernVertisols700–11004623
29PRNB-34TirumalaAndhra PradeshSouthernVertisols700–11004623

Phenotypic characterization

A total of 108 phenotypic features, including utilization of sole carbon (22) and nitrogen sources (6), resistance to antibiotics (9), tolerance to dyes and chemicals, effect of temperature, drought, pH, and salinity on growth and some physiological and biochemical reactions, described previously (Gao et al., 1994) were examined. Colony morphology characters were determined as per Vincent (1970). Mean generation times of the isolates were determined spectrophotometrically (Yelton et al., 1983) in Yeast mannitol broth (Vincent, 1970). The ability to grow in Bringers' Tryptone Yeast extract (TY), urea hydrolysis, nitrate reduction, and indole acetic acid (IAA) production were assessed according to the methods of Somasegaran & Hoben (1994), Gerhardt et al. (1994), Roussel-Delif et al. (2005) and Huddedar et al. (2002), respectively.

Cross nodulation studies

Cross nodulation ability of rhizobial isolates was tested as per Vincent (1970) using Vigna radiata, V. mungo, V. unguiculata, Cajanus cajan, Macrotyloma uniflorum, Cicer arietinum, Phaseolus vulgaris, Cyamopsis tetragonolobus, Dolichos lablab, and Arachis hypogaea as host plants.

Numerical taxonomy

Unweighted Pair Group Method with Arithmetic Mean (UPGMA) (Sneath & Sokal, 1973) was used for clustering analysis of phenotypic features. The mean similarity for each isolate within a cluster was estimated to present the phenotypic variation in the cluster, and a phenogram was constructed by applying coefficient Sj (Sneath & Sokal, 1973).

16S rRNA gene sequencing and phylogenetic analysis

Genomic DNA was extracted using DNA-XPress kit (Himedia). Nearly the full 16S rRNA gene was amplified using primers 16SF (AGAGTTTGATCCTGGCTCAG), 16SR (ACG GCT ACC TTG TTA CGA CTT) (Nuswantara et al., 1999) and reaction mixture (50 ng of bacterial DNA, 2.5 mM 10X buffer, 20 pmol primer, 0.4 nM dNTPs and 1 U Taq DNA polymerase) in an Applied Biosystems thermal cycler. The PCR conditions were one cycle 94 °C for 5 min; 35 cycles 94 °C for 1 min, 56 °C for 1 min, and 72 °C for 1.5 min; one cycle 72 °C for 10 min.

The PCR products were purified using QIA-quick spin columns (Qiagen, Inc., CA), and sequence determination was carried out in an automated DNA sequencer model Perkin Elmer's ABI PRISM 377 using ABI PRISM Big Dye terminator cycle sequencing ready reaction kit with Amplitaq® DNA polymerase (Applied Biosystem) following the manufacturer's instructions. Amplified sequences of the 16S rRNA gene were assembled using online tool ‘Align’ (www.ebi.ac.uk/embl). Sequences were aligned using the multiple alignment tool MUSCLE (Edgar, 2004), and phylogenetic tree was constructed using PhyML program of TREEDYN (www.phylogeny.fr). The evolutionary distances were computed as described by Jukes & Cantor (1969) and inferred by the neighbor-joining method (Saitou & Nei, 1987). A bootstrap analysis based on 1000 resamplings of the neighbor-joining data was performed. The 16S rRNA gene sequences of rhizobial-type strains related to the isolates were retrieved from the GenBank database and included in the phylogenetic analysis.

Results

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. References

Phenotypic characterization and numerical taxonomy

Overall, 29 isolates were isolated from the nodules of host plant Millettia pinnata and were designated as PRNBs (Table 1). Among them, the majority of the isolates (65%) were creamy or white opaque with little to moderate exo-polysaccharide (EPS) production. The remaining isolates were watery, milky-translucent, and curdled milk having moderate to copious EPS production. Depending on the mean generation time (MGT), isolates were marked as fast growing (MGT, 2.8–4.8 h), slow growing (MGT, 6.8–9.8 h), and intermediate (MGT, 5.2–5.9 h) (data not shown).

The 108 features that varied among the tested strains were used for cluster analysis. Computerized analysis allowed us to group the strains into five distinctive clusters at a boundary level of 0.82 average distances (Fig. 2), with clusters I, II, III, IV, and V consisting of 14, five, three, two, and five isolates, respectively. All the isolates of clusters I, II, III, and IV produced alkali at least using one or the other carbon source and did not assimilate disaccharide lactose, failed to grow in pH 9.5 and at a salt concentration of more than 0.5%. The Tmax of clusters I and V ranged between 40 and 45 °C and 40 °C for clusters II, III, and IV. However, the antibiotic sensitivity varied among the clusters (Table 2). In cluster I, all isolates were sensitive to erythromycin and rifampicin, but four isolates were sensitive to carbenicillin. All the isolates in cluster II were sensitive to all three antibiotics and cluster III isolates showed sensitivity to carbenicillin and rifampicin, whereas cluster IV showed resistance to all the tested antibiotics except erythromycin. Similarly, the growth rate pattern also varied among the isolates of clusters, i.e. clusters I (medium), II (slow), III, IV, and V (fast). All isolates of cluster II showed negative nitrate reduction besides urease production. Isolates of cluster 1 (PRNB 16, 28, 29) and cluster II (PRNB-34) also failed to produce urease. Clusters I, II, and III did not produce IAA and failed to grow in Bringer's TY medium; in contrast clusters IV and V produced IAA and showed growth in TY medium. Further, clusters I, II, and III cross nodulated Vigna unguiculata, Cajanus cajan, Macrotyloma uniflorum, Dolichos lablab, and Arachis hypogaea, whereas clusters IV and V in addition nodulated in V. radiata. Vigna mungo, however, failed to nodulate in M. uniflorum. In contrast to isolates under all the clusters, isolates under cluster V produced acid to utilized carbon source, assimilated disaccharides (sucrose, lactose and maltose), and grew well at pH 10 and 3.0% NaCl concentration. They cross nodulated Vigna unguiculata, Cajanus cajan, and Macrotyloma uniflorum, and they were sensitive to tetracycline, chloramphenicol, and rifampicin.

image

Figure 2. UPGMA dendrogram showing the phenotypic diversity of Pongamia rhizobia isolated from southern and part of western region of India. The dendrogram was constructed based on phenotypic characteristics. Five phena were defined at an 82% level similarity.

Download figure to PowerPoint

Table 2. Rhizobial isolates, antibiotic resistance and abiotic stress tolerance
Isolate no.Isolate nameAntibiotic concentrations (μg mL−1)Abiotic stress tolerance
Trimethoprim (50)Vancomycin (100)Nalidixic acid (50)Tetracycline (100)Streptomycin (100)Erythromycin (250)Chloramphenicol (500)Rifampicin (500)Carbenicillin (500)Temp. (oC)Osmotic stress (MPa)Salinity (% NaCl)pH
  1. +, growth; −, no growth; ±, less growth when compared to control.

1PRNB-1+++++±45−0.81.04.0–7.0
2PRNB-2++++±±+45−1.11.05.0–9.5
3PRNB-3+++++±40−1.20.54.0–9.5
4PRNB-4+++++40−1.23.04.0–10.0
5PRNB-5+++++±+40−1.10.54.0–9.5
6PRNB-6+++++±45−1.10.55.0–9.5
7PRNB-7+++++±+45−1.00.54.0–9.5
8PRNB-8+++++±+45−1.00.54.5–9.5
9PRNB-9++++±45−1.00.55.0–9.5
10PRNB-10+++++±+45−0.90.54.5–9.5
11PRNB-11+++++±+40−0.93.04.5–10.0
12PRNB-12++++40−1.23.04.5–10.0
13PRNB-13++++40−1.13.04.0–10.0
14PRNB-15+++45−0.90.55.0–10.0
15PRNB-16++++±45−1.10.54.5–9.5
16PRNB-21+++±±±40−1.11.04.0–7.0
17PRNB-22+++±±±±+40−0.91.04.0–10.0
18PRNB-23+++++±±+40−1.10.54.5–10.0
19PRNB-24++++±±40−0.91.04.5–9.5
20PRNB-25++++45−1.00.54.0–9.5
21PRNB-26++±+±40−1.21.04.0–9.5
22PRNB-27++++±45−1.20.55.0–10.0
23PRNB-28+++++±40−1.10.54.0–9.5
24PRNB-29+++++±±+40−1.20.54.5–9.5
25PRNB-30+++±++±45−1.10.54.0–9.5
26PRNB-31+++±++±45−1.10.54.5–10.0
27PRNB-32++++±40−1.20.54.5–9.5
28PRNB-33+++±+±40−1.10.54.5–7.0
29PRNB-34++++++40−1.10.55.0–7.0

16S rRNA gene sequencing and phylogenetic analysis

Amplification of the 16S rRNA gene of the isolated strains yielded a single band of about 1450 base pairs, which corresponded to the expected size of the 16S rRNA gene. A preliminary blast search against the databases revealed a high similarity between the 16S rRNA gene of strains, and three groups of rhizobia were identified in Millettia pinnata nodules. Groups 1, 2 and 3 showed 99% similarities to Bradyrhizobium sp. GX5, Bradyrhizobium elkanii SEMIA5002, and Rhizobium sp. TANU14, respectively. However, subsequent alignment of all determined 16S rRNA gene sequences together with those of a number of rhizobial reference type strains was used to generate a phylogenetic tree, as described in Materials and methods. The phylogenetic analysis clustered the representative strains of 16S rRNA gene with the type strains of B. yuanmingense, B. elkanii, and R. undicola, respectively (Fig. 3). The sequences of all the M. pinnata rhizobial isolates were submitted to the NCBI databank under different accession numbers (Table 3).

image

Figure 3. Neighbor-joining phylogenetic tree showing the relationship between the isolates and the type species of Rhizobium and Bradyrhizobium based on 16S rRNA gene sequences. Bootstrap values greater than 50% are indicated in the corresponding nodes.

Download figure to PowerPoint

Table 3. Classification of rhizobial isolates using biochemical and partial 16S rRNA gene sequencing
Isolate No.Isolate nameBiochemical identificationIdentical or similar partial 16S rRNA gene sequenceSimilarity (%)NCBI accession number
1PRNB-1Bradyrhizobium sp.FJ555226 Bradyrhizobium sp. GX599 HM125055
2PRNB-2Bradyrhizobium sp.FJ555226 Bradyrhizobium sp. GX599 HQ589023
3PRNB-3Bradyrhizobium sp.FJ555226 Bradyrhizobium sp. GX599 GQ867049
4PRNB-4Rhizobium sp.AJ971481 Rhizobium sp. TANU 1499 HQ589024
5PRNB-5Bradyrhizobium sp.FJ555226 Bradyrhizobium sp. GX599 HM125056
6PRNB-6Bradyrhizobium sp.FJ555226 Bradyrhizobium sp. GX599 HM125057
7PRNB-7Bradyrhizobium sp.FJ555226 Bradyrhizobium sp. GX599 GU451287
8PRNB-8Bradyrhizobium sp.FJ555226 Bradyrhizobium sp. GX599 GU451288
9PRNB-9Bradyrhizobium sp.FJ555226 Bradyrhizobium sp. GX599 GU451289
10PRNB-10Bradyrhizobium sp.FJ555226 Bradyrhizobium sp. GX599 GU451290
11PRNB-11Bradyrhizobium sp.FJ555226 Bradyrhizobium sp. GX599 GU451291
12PRNB-12Rhizobium sp.AJ971481 Rhizobium sp. TANU 1499 HQ589025
13PRNB-13Rhizobium sp.AJ971481 Rhizobium sp. TANU 1499 HQ589026
14PRNB-15Rhizobium sp.AJ971481 Rhizobium sp. TANU 1499 HQ589027
15PRNB-16Bradyrhizobium sp.FJ555226 Bradyrhizobium sp. GX599 HM125058
16PRNB-21Bradyrhizobium sp.FJ390934 Bradyrhizobium sp. SEMIA 643499 HM125059
17PRNB-22 Bradyrhizobium elkanii FJ390895 Bradyrhizobium elkanii SEMIA 500299 HQ171486
18PRNB-23 Bradyrhizobium elkanii FJ390895 Bradyrhizobium elkanii SEMIA 500299 HQ171487
19PRNB-24Bradyrhizobium sp.FJ390934 Bradyrhizobium sp. SEMIA 643499 HM125060
20PRNB-25Rhizobium sp.AJ971481 Rhizobium sp. TANU 1499 HQ589028
21PRNB-26Bradyrhizobium sp.FJ555226 Bradyrhizobium sp. GX5100 HQ171479
22PRNB-27Bradyrhizobium sp.FJ555226 Bradyrhizobium sp. GX599 HQ589029
23PRNB-28Bradyrhizobium sp.FJ555226 Bradyrhizobium sp. GX599 HQ171480
24PRNB-29Bradyrhizobium sp.FJ555226 Bradyrhizobium sp. GX5100 HQ171481
25PRNB-30Bradyrhizobium sp.FJ555226 Bradyrhizobium sp. GX5100 HQ171482
26PRNB-31Bradyrhizobium sp.FJ555226 Bradyrhizobium sp. GX599 HQ171483
27PRNB-32Bradyrhizobium sp.FJ555226 Bradyrhizobium sp. GX599 HM125061
28PRNB-33Bradyrhizobium sp.FJ555226 Bradyrhizobium sp. GX5100 HQ171484
29PRNB-34Bradyrhizobium sp.FJ555226 Bradyrhizobium sp. GX5100 HQ171487

Discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. References

As M. pinnata was introduced as the most important multipurpose tree for biodiesel production, it has become the most widespread legume in India and other parts of the world. This predominance has resulted from the massive planting of the species for multipurpose use in a broad edaphic range including urban and social forestry. As for reports on nodulation from different parts of the world (Allen & Allen, 1981; Ather, 2005), we also found that soils collected from different regions of Andhra Pradesh, Karnataka, and Maharashtra of India contained rhizobial isolates able to nodulate Millettia pinnata.

Earlier reports of rhizobia associated with woody legumes described them as either of slow-growing type or cowpea miscellany (Lange, 1961; Habish & Khairi, 1968; Basak & Goyal, 1980), but more recent reports have shown that this population includes very diverse type of rhizobia including fast-, intermediate-, and slow-growing bacteria (Barnet & Catt, 1991; Xu et al.,1995). The mean generation times for the isolated strains ranged from fast (MGT, 2.8–4.8 h) to slow (MGT, 6.8–9.8 h), which includes an intermediate growth category (MGT, 5.2–5.9) that fit with the new categories reported by Barnet & Catt (1991) and Moreira et al. (1993) to accommodate Australian Acacia species.

Utilization of different compounds by rhizobial isolates, as sole carbon and nitrogen sources, is one of the most useful traits for their differentiation and identification (Hungria et al., 2001). Rhizobial isolates obtained from M. pinnata were able to utilize different carbohydrate sources; thus, it was assumed that they may produce important enzymes like amylase and cellulases. The obtained results showed that these strains might belong to one of two groups, Rhizobium or Bradyrhizobium, based on the utilization of carbon and nitrogen, respectively. However, they could not be distinguished with each other based on these characteristics. The results of our study suggest that bacteria of different genera may adapt to the environmental conditions influenced by root exudates from their hosts. Root exudates are composed of both low and high components, including an array of primary and secondary metabolites, portions and peptiodes (Bias & Weir, 2006; Weisskopf & Abou-Mansour, 2006), that vary in quantity and chemical structure depending on the plant selective environments for a specific group of bacteria. Similar findings were reported on carbon assimilation patterns of Derris elliptica (Leelahawonge et al., 2010) and Pueraria mirifica rhizobia (Neelawan et al., 2010).

Intrinsic antibiotic resistance is also one of the characteristics that can distinguish between strains of Rhizobium and Bradyrhizobium. The obtained results clearly distinguished the rhizobia into three groups: group 1 sensitive to erythromycin and rifampicin (Bradyrhizobium sp. 75% isolates), group 2 sensitive to erythromycin (Bradyrhizobium elkanii 7% isolates), and group 3 sensitive to vancomycin, tetracycline, chloramphenicol, rifampicin, and carbenicillin (Rhizobium sp. 17% isolates). This shows that the pattern of IAR is useful in the strain identification (Chanway & Holl, 1986).

High soil and root temperature in tropical and subtropical areas is a major constraint for biological nitrogen fixation (BNF) of legume crops (Michiels et al., 1994). Most of the isolates in this study possessed optimum growth at 30 °C, but some of the isolates were found to grow at 45 °C. This could be because they were isolated from temperate dryland agro-ecosystems due to which they could tolerate such high temperature. Indeed, the present findings are in agreement with previous work of Swelim et al. (2010) on temperature tolerance of rhizobia from different tree species. Soil-moisture deficit has a profound effect on growth and persistence of rhizobia (Cytryn et al., 2007) and N2 fixation because nodule initiation, growth, and activity are all highly sensitive to water stress (Albrecht et al., 1994). About 30% of the isolates in this study have a potential to withstand −1.2 MPa osmotic pressures. Mohammad et al. (1991) reported that R. meliloti isolates were able to grow at up to −1.0 MPa osmotic stresses.

Salinity (Shetta, 2002) and pH (Munns, 1986) are also major limiting factors restricting symbiotic nitrogen fixation. Salt stress or salinity significantly reduces nitrogen fixation and nodulation in legumes. In the present study, most of the isolates persisted under salt concentrations of 0.5%, and only four isolates showed tolerance to 3.0% (815 mM) NaCl. Hence, these isolates may be candidates for application in salinity-affected soils. The results coincide with the findings of Lal & Khanna (1995), who reported rhizobial isolates from woody legume showing tolerance to 500–800 mM NaCl. The adaptation to high salinity could be attributed to the accumulation of low-molecular-weight organic solutes called osmolytes (Csonka & Hanson, 1991) that prevent the cell lysis. Similarly, slight variation in pH of the medium might have significant effects on the growth of bacteria (Singh et al., 2008). The results indicated that most of the isolates grew at pH of 6.5, 7.0, and 8.0, but only 11 isolates grew at acidic pH 4.0 and nine isolates grew at alkaline pH 10.0 (Table 1). These findings are in agreement with Shetta et al. (2011) on Rhizobium associated with woody legumes trees grown in Saudi Arabia. However, there is no significant correlation between the origin of isolate and its ability to tolerate extreme pH values (data not shown). It was observed that fast-growing strains were generally more tolerant to high NaCl concentrations than slow-growing rhizobia as reported by Odee et al. (1997). Similarly, fast growers were more tolerant to high temperature, drought and pH. Strains with these traits give a way to develop abiotic stress-tolerant bio-inoculants for M. pinnata for improved tree growth.

Results obtained from UPGMA analysis of phenotypic features showed that the isolates formed into five clusters at the boundary level of 0.82 average distances. These clusters showed no relatedness to each other and the diversity also applied to isolates from the same genera (Bradyrhizobium) that had different phenotypic traits. Diversity occurring in one site could be explained by soil microsites having distinct aeration, nutrient availability, moisture content, and competition (Postgate, 1982), which may induce different strain adaptations. No relationship was found between clustering patterns on the phenogram and the geographical origin of the isolate. Our data demonstrated a high phenotypic diversity of rhizobia associated with M. pinnata, which has also been found among the rhizobia nodulating leguminous trees (Dreyfus et al., 1988; Zhang et al., 1991; Batzli et al., 1992).

Various phenotypic and genotypic methodologies have been used to identify and characterize bacteria (Vincent, 1970; Obaton et al., 2002). Although phenotypic methods play a significant role in identification, molecular tools are more reliable and authentic for identification and to study genetic diversity of bacterial isolates. Currently, it is known that 16S rRNA gene analysis is not the most reliable method to differentiate close species of Rhizobium and Bradyrhizobium, but this gene is the most suitable to classify new strains of rhizobia because it constitutes the basis of rhizobial classification (Kuykendall, 2005). The 16S rRNA gene sequence results of our study showed that M. pinnata is a promiscuous legume, able to establish efficient symbiosis with Bradyrhizobium and Rhizobium. It was found that fast-growing Rhizobium spp. were the predominant microsymbionts with M. pinnata from the soils collected from Akola, Bijapur, Hanumanjunction, Choppadandi and Chintapalli, and Bradyrhizobium elkanii from the soils of Adimilli and Penpahad, whereas Bradyrhizobium spp. were the predominant microsymbionts found with M. pinnata from rest of the soils. Variations in the nature of rhizobia nodulating the M. pinnata in different geographic and climatic areas so far have not been reported, but it has been reported in several acacia species (Lafay & Burdon, 2001; Liu et al., 2005; Gu et al., 2007; Lafay & Burdon, 2007; Bala et al., 2003), Parasponia andersonii (Trinick et al., 1989), Pachyrhizus erosus (Fuentes et al., 2002), Prosopis glandulosa (Jenkins, 2003), Acacia mangium (Ngom et al., 2004), and Pueraria mirifica (Neelawan et al., 2010). This symbiotic promiscuity, found mostly in legumes from warm or tropical parts of the world, ensures effective nodulation of host plant in most soils, thereby increasing its ability to succeed in colonizing barren sites and to spread into new habitats.

To conclude, the present study is the first report that phenotypically and genotypically characterizes root-nodule microsymbionts of the multipurpose tree legume, M. pinnata. The microsymbionts were identified genotypically as Rhizobium and Bradyrhizobium, predominant symbionts with most legume species. These genera are genotypically and phenotypically distinct from each other based on the constructed phylogenetic trees. Additional experimental work would be necessary, for instance DNA–DNA hybridization, multilocus sequence analysis of housekeeping genes, and phylogenetic reconstructions based on accessory symbiotic loci such as nodB, nodC, or nifH. This study therefore provides the basis for further research on the phylogeny and biodiversity of rhizobial strains nodulating M. pinnata, as well as their use as inoculants to improve growth and nitrogen fixation in arid and semi-arid lands of India and other countries. Physiological and biochemical studies are the basis for detailed polyphasic taxonomy and should not be used alone in taxonomic analysis. This was well illustrated by the differences between clusters defined here using phenotypic characteristics and molecular tools. However, the results concerning carbon sources utilization, antibiotic sensitivity, salinity, and maximum growth temperature may give strong indications about the taxonomic position of the isolates.

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. References
  • Albrecht SL, Bennett JM & Boote KJ (1994) Relationship of nitrogenase activity to plant water stress in field grown soybeans. Field Crops Res 8: 6171.
  • Allen ON & Allen EK (1981) The Leguminosae: A Source Book of Characteristics, Uses, and Nodulation. The University of Wisconsin Press, Wisconsin.
  • Ather M (2005) Nodulation of native legumes in Pakistani rangelands. Agriculturae Conspectus Scientificus 70: 4954.
  • Azam MM, Waris A & Nahar NM (2005) Prospects and potential of fatty acid methyl esters of some non-traditional seed oils for use as biodiesel in India. Biomass Bioenergy 29: 293302.
  • Bala A, Murphy P & Giller KE (2003) Distribution and diversity of rhizobia nodulating agro-forestry legumes in soils from three continents in the tropics. Mol Ecol 12: 7929.
  • Barnet YM & Catt PC (1991) Distribution and characteristics of root-nodule bacteria isolated from Australian Acacia sp. Plant Soil 135: 109120.
  • Basak MK & Goyal SK (1980) Studies on tree legumes III characterization of the symbionts and direct and reciprocal cross inoculation studies with tree legumes and cultivated legumes. Plant Soil 56: 3951.
  • Batzli JM, Graves WR & Berkum PV (1992) Diversity among rhizobia effective with Robinia pseudoacacia. Appl Env Microbiol 58: 21372145.
  • Bias HP & Weir T (2006) The role of root exudates in rhizosphere interactions with plants and other organiiisms. Annu Rev Plant Biol, 57: 233266.
  • Chanway CP & Holl FB (1986) Suitability of intrinsic antibiotic resistance as a method of strain identificationin Rhizobium trifolii. Plant Soil 93: 287291.
  • Csonka LN & Hanson AD (1991) Prokaryotic osmoregulation: genetics and physiology. Annu Rev Plant Physiol 45: 569606.
  • Cytryn EJ, Sangurdekar DP, Streeter JG, Franck WL, Chang WS, Stacey G, Emerich DW, Joshi T, Xu D & Sadowsky MJ (2007) Transcriptional and physiological responses of Bradyrhizobium japonicum to desiccation-induced stress. J Bacteriol 186: 9150.
  • Dayama OP (1985) Effect of sucrose on the growth, nodulation and nitrogen content of Pongamia pinnata. Nitrog Fix Tree Res Rep 3: 9.
  • Diouf D, Fall D, Chaintreuil C, Ba AT, Dreyfus B, Neyra M, Ndoye I & Moulin L (2010) Phylogenetic analyses of symbiotic genes and characterization of functional traits of Mesorhizobium spp. strains associated with the promiscuous species Acacia seyal Del. J Appl Microbiol 108: 818830.
  • Dreyfus B, Garcia JL & Gillis M (1988) Characterization of Azorhizobium caulinodans gen nov, sp. nov, a stem nodulating nitrogen-fixing bacterium isolated from Sesbania rostrata. Int J Syst Bacteriol 38: 8998.
  • Edgar RC (2004) MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res 32: 17921797.
  • Fuentes JB, Abe M, Uchiumi T, Suzuki A & Higashi S (2002) Symbiotic root nodule bacteria isolated from yam bean (Pachyrhizus erosus). J Gen Appl Microbiol 48: 181191.
  • Gao JL, Sun JG, Li Y, Wang ET & Chen WX (1994) Numerical taxonomy and DNA relatedness of tropical rhizobia isolated from Hainan Province, China. Int J Syst Bacteriol 44: 151158.
  • Gerhardt P, Murry RGE, Wood AW & Krieg NR (1994) Methods in General and Molecular Bacteriology. American Society for Microbiology, Washington, DC.
  • Gu J, Wang ET & Chen WX (2007) Genetic diversity of rhizobia associated with Desmodium sp. grown in China. Lett Appl Microbiol 44(28): 6292.
  • Habish HA & Khairi SHM (1968) Nodulation of legumes in the Sudan cross-inoculation groups and the associated Rhizobium strains. Exp Agric 4: 227234.
  • Huddedar SB, Shete AA, Tilekar JN, Gore SD, Dhavale DD & Chopade BA (2002) Isolation, characterization and plasmid pUP1126 mediated indole-3-acetic acid production in Acinetobacter strains from rhizosphere of wheat. Appl Biochem Biotech 102–103: 2139.
  • Hungria M, Chueire LMO, Coca RG & Megias M (2001) Preliminary characterization of fast growing rhizobial strains isolated from soybean nodules in Brazil. Soil Biol Biochem 33: 13491361.
  • Jenkins MB (2003) Rhizobial and bradyrhizobial symbionts of mesquite from the Sonoran desert: salt tolerance, facultative halophily and nitrate respiration. Soil Biol Biochem 35: 16751682.
  • Jukes TH & Cantor RC (1969) Evolution of protein molecules. Mammalian Protein Metabolism, Vol. 3 (Munro HN, ed.), pp. 21132. Academic Press, New York, NY.
  • Kabir KE, Islam F & Khan AR (2001) Insecticidal effect of the petroleum ether fraction obtained from the leaf extract of Pongamia glabra Vent on the American cockroach, Periplaneta americana (L.) (Dictyoptera: Blattidae). Int Pest Control 43: 152154.
  • Karmee SJ & Chadha A (2005) Preparation of biodiesel from crude oil of Pongamia pinnata. Bioresour Technol 96: 14251429.
  • Kuykendall LD (2005) Order VI. Rhizobiales ord. nov. Bergey's Manual of Systematic Bacteriology, 2nd edn, Vol. 2 (The Proteobacteria), part C (The Alpha-, Beta-, Delta-, and Epsilonproteobacteria) (Brenner DJ, Krieg NR, Staley JT & Garrity GM, eds), p. 324. Springer, New York, NY.
  • Lafay B & Burdon JJ (2001) Small subunit ribosomal RNA genotyping of rhizobia nodulating Australian Acacia spp. Appl Environ Microbiol 67: 396402.
  • Lafay B & Burdon JJ (2007) Molecular diversity of legume root-nodule bacteria in Kakadu National Park, Northern Territory, Australia. PLoS ONE 2: e277.
  • Lal B & Khanna S (1995) Selection of salt tolerant Rhizobium isolates of Acacia nilotica. World J Microbiol Biotechnol 10: 637639.
  • Lange RT (1961) Nodule bacteria associated with the indigenous Leguminosae of South-Western Australia. Aust J Gen Microbiol 61: 351359.
  • Leelahawonge C, Nuntagij A, Teaumroong N, Boonkerd N & Pongsilp N (2010) Characterization of root-nodule bacteria isolated from the medicinal legume. Indigofera tinctoria Ann Microbiol 60: 6574.
  • Liu J, Wang ET & Chen WX (2005) Diverse rhizobia associated with woody legumes Wisteria sinensis, Cercis racemosa and Amorpha fruticosa grown in the temperate zone of China. Syst App. Microbiol 28(46): 5477.
  • Michiels J, Verreth C & Vanderleyden J (1994) Effects of temperature stress on bean nodulating Rhizobium strains. Appl Environ Microbiol 60: 12061212.
  • Mohammad RM, Akhavan-kharazian M, Campbell WF & Rumbaugh MD (1991) Identification of salt and drought tolerant Rhizobium meliloti L. strains. Plant Soil 134: 271276.
  • Moreira F, Gillis M, Pot B, Kersters K & Franco AA (1993) Characterization of rhizobia from different divergence groups of tropical leguminosae by comparative polycarylamide gel electrophoresis of their total proteins. Syst Appl Microbiol 16: 135146.
  • Munns DN (1986) Acid soils tolerance in legumes and rhizobia. Adv Plant Nutr 2: 6391.
  • Neelawan P, Chonchanok L, Achara N, Neung T & Nantakorn B (2010) Characterization of Pueraria mirifica-nodulating rhizobia present in Thai soil. Afr J Microbiol Res 4: 13071313.
  • Ngom A, Nakagawa Y, Sawada H et al. (2004) A novel symbiotic nitrogen-fixing member of the Ochrobactrum clade isolated from root nodules of Acacia mangium. J Gen Appl Microbiol 50: 1727.
  • Nuswantara S, Fujie M, Yamada T, Malek W, Inaba M, Kaneko Y & Murooka Y (1999) Phylogenetic position of Mesorhizobium huakuii subsp rengei, a symbiont of Astragalus sinicus cv. Japan. J Biosci Bioeng 87: 4955.
  • Obaton M, Bouniols A, Piva G & Vadez V (2002) Are Bradyrhizobium japonicum stable during a long stay in soil? Plant Soil 245: 315326.
  • Odee DW, Sutherland JM, Makatiani ET, McInroy SG & Sprent JI (1997) Phenotypic characteristics and composition of rhizobia associated with woody legumes growing in diverse Kenyan conditions. Plant Soil 188: 6575.
  • Postgate JR (1982) The Fundamentals of Nitrogen Fixation. Cambridge University Press, Cambridge.
  • Pueppke SG & Broughton WJ (1999) Rhizobium sp. strain NGR234 and R. fredii USDA257 share exceptionally broad nested host ranges. Mol Plant Microbe Interact 12: 293318.
  • Roussel-Delif L, Tarnawski S, Hamelin J, Philippot L, Aragno M & Fromin N (2005) Frequency and diversity of nitrate reductase genes among nitrate-dissimilating Pseudomonas in the rhizosphere of perennial grasses grown in field conditions. Microb Ecol 49: 6372.
  • Saitou N & Nei M (1987) The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol Biol Evol 4: 406425.
  • Scott PT, Pregelj L, Chen N, Hadler JS & Gresshoff PM (2008) Pongamia pinnata: an untapped resource for the biofuels industry of the future. Bioenerg Res 1: 211.
  • Shetta ND (2002) Biological and genetical studies on Rhizobium species isolated from woody trees grown in Egypt. Ph D, Faculty of Agriculture, Alexandria University.
  • Shetta ND, Al-Shaharani TS & Abdel-Aal M (2011) Identification and characterization of rhizobium associated with woody legume trees grown under Saudi Arabia condition. Am Eurasian J Agric Environ Sci 10: 410418.
  • Siddiqui MH (1989) Nodulation study of a few legume tree species during seedling stage. Nitrog Fix Tree Res Rep 7: 6.
  • Singh B, Kaurand R & Singh K (2008) Characterization of Rhizobium strain isolated from the roots of Trigonella foenumgraecum (fenugreek). Afr J Biotechnol 7: 36713676.
  • Sneath PHA & Sokal RB (1973) Numerical Taxonomy. The Principles and Practice of Numerical Classification. W H Freeman and Co, San Francisco, CA.
  • Somasegaran P & Hoben HJ (1994) Handbook for Rhizobia. Methods in Legume-Rhizobium Technology. Springer-Verlag, New York, NY, pp. 332341.
  • Swelim DM, Ali MA & Elham I El-Khatib (2010) Some tree-legume-rhizobia are meagerly arising in Egyptian soil. Aust J Basic Appl Sci 4: 12971304.
  • Trinick MJ, Goodchild DJ & Miller C (1989) Localization of bacteria and hemoglobin in root nodules of Parasponia andersonii containing both Bradyrhizobium strains and Rhizobium leguminosarum biovar trifolii. Appl Environ Microbiol 55: 20462055.
  • Vance CP (1997) Enhanced agricultural sustainability through biological nitrogen fixation. Biological Nitrogen Fixation for Ecology and Sustainable Agriculture (Legocki A, Bothe H & Puhler A, eds), pp. 179186. Springer Verlag, Berlin.
  • Vincent JM (1970) A Manual for the Practical Study of Root Nodule Bacteria. Blackwell Scientific Publications, Oxford.
  • Weisskopf L & Abou-Mansour E (2006) White lupine has developed a complex strategy to limit microbial degradation of secreted citrate required for phosphate acquisition. Plant, Cell Environ 29: 919927.
  • Wolde-Meskel E, Terefework Z, Frostegård A & Lindström K (2005) Genetic diversity and phylogeny of rhizobia isolated from agroforestry legume species in southern Ethiopia. Int J Syst Evol Microbiol 55(Pt 4): 14391452.
  • Xu LM, Ge C, Cui Z, Li J & Fan H (1995) Bradyrhizobium liaoningense sp. nov isolated from the root nodules of soybeans. Int J Syst Bacteriol 45: 706711.
  • Yan XR, Chen WF, Fu JF, Lu YL, Xue CY, Sui XH, Li Y, Wang ET & Chen WX (2007) Mesorhizobium spp. are the main microsymbionts of Caragana spp. grown in Liaoning Province of China. FEMS Microbiol Lett 271: 265273.
  • Yelton MM, Yang SS, Edie SA & Lim ST (1983) Characterization of an effective salt-tolerant, fast-growing strain of Rhizobium japonicum. J Gen Microbiol 129: 15371547.
  • Zhang X, Harper R, Karsisto M & Lindstrom K (1991) Diversity of Rhizobium bacteria isolated from root nodules of leguminous trees. Int J Syst Bacteriol 41: 104113.