• Open Access

Comparison of dkgB-linked intergenic sequence ribotyping to DNA microarray hybridization for assigning serotype to Salmonella enterica

Authors


Correspondence: Jean Guard, Agricultural Research Service U.S. Department of Agriculture, 950 College Station Rd., Athens, GA 30605, USA. Tel.: +1 706 546 3446; fax: +1 706 546 3035; e-mail: jean.guard@ars.usda.gov

Abstract

Two DNA-based methods were compared for the ability to assign serotype to 139 isolates of Salmonella enterica ssp. I. Intergenic sequence ribotyping (ISR) evaluated single nucleotide polymorphisms occurring in a 5S ribosomal gene region and flanking sequences bordering the gene dkgB. A DNA microarray hybridization method that assessed the presence and the absence of sets of genes was the second method. Serotype was assigned for 128 (92.1%) of submissions by the two DNA methods. ISR detected mixtures of serotypes within single colonies and it cost substantially less than Kauffmann–White serotyping and DNA microarray hybridization. Decreasing the cost of serotyping S. enterica while maintaining reliability may encourage routine testing and research.

Introduction

Serotyping of Salmonella enterica ssp. I is the basis of national and international surveillance and communications, it facilitates determining associations between the pathogen and sources, and it gives some guidance in regards to preventing transmission (P. Fields, pers. commun.) (Foodnet, 2011). The historical method used to serotype S. enterica is the antibody-based Kauffman–White (KW) scheme (Kauffman & Edwards, 1952; Brenner et al., 2000). Positive results generate an antigenic formula based on structural details of the H-antigen of flagella and the O-antigen of lipopolysaccharide (H- and O-antigens, respectively) (Bopp et al., 1999; Popoff & Le Minor, 2001).

A major advantage of DNA analysis is that it is not impacted by variable expression of cell-surface antigens as are antibody-based agglutination assays like the KW scheme. Major obstacles to genome typing of S. enterica becoming broadly available include expense, the need for highly specialized equipment, and in some cases, sophisticated bioinformatics (Wattiau et al., 2011). A DNA-based method for assigning serotype to S. enterica at comparatively low cost and with readily accessible laboratory equipment commonly used for culturing and conducting the polymerase chain reaction (PCR) would be beneficial. A discrete region within S. enterica ssp. I was previously shown to differentiate closely related serotypes (Morales et al., 2006). The region of interest spans from the end of a 23S ribosomal gene, across a 5S gene and includes the last base pair preceding a tRNA aspU ribosomal gene neighboring dkgB (previously yafB) (Fig. 1). We wanted to know if dkgB-linked intergenic sequence ribotyping (ISR) would assign serotype similarly to an AOAC International certified DNA microarray hybridization method (DNAhyb) (Check & Trace by Checkpoints, Certificate 121001) (Malorny et al., 2003; Wattiau et al., 2008; Madajczak & Szych, 2010). The set of isolates examined were previously assigned a KW serotype and this historical information is included.

Figure 1.

Description of the ISR region within the genome of Salmonella enterica serovar Enteritidis strain P125109 (GenBank AM933172). The nucleotide sequence of each ISR is serotype specific and size ranges from 257 to 530 bp. Sequence is required to assign serotype to a submission. An ISR region includes sequence from the end of the rrlH gene (rRNA-23S ribosomal gene) and the start of the aspU (tRNA-Asp) gene that is adjacent to the dkgB gene.

Materials and methods

Salmonella enterica submissions included for analysis

The investigators providing the submissions listed in Table 1 reported serotype. In this laboratory, cultures were streaked on brilliant green (BG) agar (Acumedia; Neogen Corporation, Lansing, MI) and incubated for 24–48 h at 37 °C to obtain well-separated large colonies. One colony was then transferred to brain heart infusion (BHI) broth (Acumedia) and incubated for 16 h at 37 °C with shaking. For submissions that later appeared to have mixed cultures and for those with disagreement between methods, agglutination reactions for single colonies using commercially available absorbed antisera (Difco, BD, Franklin Lakes, NJ) were carried out, and in some cases, isolates were submitted for serotyping (Silliker, South Holland, IL). Thus, single colonies were processed by both ISR and DNAhyb (Check & Trace, Check Points, Wageningen, the Netherlands). In cases of disagreement between methods, a maximum of 10 well-isolated colonies were selected from agar plates and then transferred to BHI broth for individual analysis.

Table 1. Serotype of Salmonella enterica ssp. I as determined by the KW scheme, DNAhyb, and dkgB-linked ISR
Accession NumberKW schemeDNAhybISRISR sizeSupplierSourceLocalityCategory
  1. a

    O-antigen immunoreactivity group of KW scheme did not match ISR results, but O-antigens D1 and D2 are cross-reactive.

  2. b

    Submissions with hyphenation with numerical extension (-1) were classified as potentially containing a mixture of at least two serotypes as evidenced by forward/reverse ISR sequences that did not match when first evaluated. If a second serotype was isolated, it has extension -2 and is listed elsewhere in the table.

  3. c

    Mixtures of serotypes were confirmed by processing at least 10 CFU.

(a) Submissions with agreement between DNA-based genomic methods DNAhyb and ISR, and with no conflict to serotype as reported using the KW scheme [115]
21027EnteritidisEnteritidis 2994.GEnteritidis499ESQRU, ARS, USDAMouse spleenNortheast USTP
21046EnteritidisEnteritidis 2994.GEnteritidis499ESQRU, ARS, USDAMouse spleenNortheast USTP
22079EnteritidisEnteritidis 2994.GEnteritidis499UCCreekCaliforniaTP
23023PullorumGallinarum Pullorum 2978.HPullorum361ESQRU, ARS, USDAUnknownUnknownTP
24018NewportNewport 12427Newport498NVSLUnknownUnknownTP
25001AgonaAgona 7205Agona498SGSCUnknownPeruTP
25006CholeraesuisCholeraesuis or Paratyphi C 13545Cholerasuis499SGSCUnknownThailandTP
25012DublinDublin (probability 99.92%) 2488Dublin499SGSCCattleIdahoTP
25013DublinDublin (probability 99.92%) 2488Dublin499SGSCBovineFranceTP
25021GallinarumGallinarum Gallinarum 2978Gallinarum498SGSCHumanConnecticutTP
25026InfantisInfantis 9381Infantis_2500SGSCHumanNorth CarolinaTN
25030MontevideoMontevideo 6690Montevideo_1362SGSCHumanGeorgiaTP
25031MontevideoMontevideo 6702Montevideo_2361SGSCHumanFloridaTP
25042Paratyphi AParatyphi A 14413Paratyphi A498SGSCUnknownUnknownTP
25049Paratyphi CCholeraesuis or Paratyphi C 13545Paratyphi C395SGSCHumanFranceTP
25052PullorumGallinarum Pullorum 2978.HPullorum361SGSCUnknownGermanyTP
25063TyphiTyphi 7241Typhi267SGSCUnknownDakarTP
25064TyphiTyphi 7241Typhi267SGSCUnknownDakarTP
26022CerroCerro 4237Cerro361EMSFL, ARS, USDAFecal (dairy cow)UnknownTP
26023CerroCerro 4237Cerro361EMSFL, ARS, USDALung (dairy cow)UnknownTP
26024CerroCerro 4237Cerro361EMSFL, ARS, USDAFecal (dairy cow)UnknownTP
26028OranienburgOranienburg 6717 rOranienburg365EMSFL, ARS, USDAFecal (dairy cow)UnknownTP
26029OranienburgOranienburg 6717Oranienburg365EMSFL, ARS, USDAFecal (dairy cow)UnknownTP
26030Typhimurium 5-Typhimurium 10909Typhimurium498EMSFL, ARS, USDAFecal (dairy cow)UnknownTP
26039MontevideoMontevideo 6702Montevideo_3362EMSFL, ARS, USDAMilkUnknownTN
26050AgonaAgona 7205Agona498EMSFL, ARS, USDAFecal (dairy cow)UnknownTP
26080AgonaAgona 7205Agona498EMSFL, ARS, USDAFecal (dairy cow)UnknownTP
29047TyphimuriumTyphimurium 10909Typhimurium498ESQRU, ARS, USDAUnknownUnknownTP
29054TyphimuriumTyphimurium 10909Typhimurium498ESQRU, ARS, USDAUnknownUnknownTP
29056TyphimuriumTyphimurium 10909Typhimurium498ESQRU, ARS, USDAUnknownUnknownTP
29096SchwarzengrundSchwarzen. or Grumpensis 14909.BSchwarzengrund257PPSPR, ARS, USDAScalder tank waterGeorgiaTP
99113PullorumGallinarum Pullorum 2978.HPullorum361CFIAChicken HouseUnknownTP
99117GallinarumGallinarum Gallinarum 2978Gallinarum498CFIAChicken HouseUnknownTP
99163Typhimurium 5-Typhimurium 10909Typhimurium498USDA, ARS, TXPigeonUnknownTP
99164Typhimurium 5-Typhimurium 10909Typhimurium498ESQRU, ARS, USDAUnknownUnknownTP
99172Typhimurium 5-Typhimurium 10909Typhimurium498USDA, ARSPigeonUnknownTP
100304.05KentuckyKentucky 10299Kentucky492PPSPR, ARS, USDACarcass rinseGeorgiaTP
100304.07KentuckyKentucky 10299Kentucky492PPSPR, ARS, USDACarcass rinseGeorgiaTP
100304.08KentuckyKentucky 10299Kentucky492PPSPR, ARS, USDAScalder tank foamGeorgiaTP
100304.191,4,[5],12:i:-1,4,[5],12:i:- 27171,4,[5],12:i:-498PPSPR, ARS, USDACarcass rinseGeorgiaTP
100304.32Typhimurium 5-Typhimurium 10909Typhimurium498PPSPR, ARS, USDACarcass rinseGeorgiaTP
100304.43HeidelbergHeidelberg 15835Heidelberg498PPSPR, ARS, USDACarcass rinseGeorgiaTP
100304.48HeidelbergHeidelberg 15835Heidelberg498PPSPR, ARS, USDACarcass rinseGeorgiaTP
100304.52HeidelbergHeidelberg 15835Heidelberg498PPSPR, ARS, USDACarcass rinseGeorgiaTP
100304.57Typhimurium 5-Typhimurium 10909Typhimurium498PPSPR, ARS, USDACarcass rinseGeorgiaTP
100304.63Typhimurium 5-Typhimurium 10909Typhimurium498PPSPR, ARS, USDACarcass rinseGeorgiaTP
100304.69ThompsonThompson 14415Thompson259PPSPR, ARS, USDACarcass rinseGeorgiaTP
100304.74SenftenbergSenftenberg 2156Senftenberg362PPSPR, ARS, USDACarcass rinseGeorgiaTP
100304.75SenftenbergSchwarzen. or Grumpensis 14909.BSchwarzengrund257PPSPR, ARS, USDACarcass rinseGeorgiaTP
100304.76SenftenbergSchwarzen. or Grumpensis 14909.BSchwarzengrund257PPSPR, ARS, USDACarcass rinseGeorgiaTP
100304.78ThompsonThompson 14415Thompson259PPSPR, ARS, USDACarcass rinseGeorgiaTP
100304.79ThompsonThompson 14415Thompson259PPSPR, ARS, USDACarcass rinseGeorgiaTP
100616.101KentuckyKentucky 10299Kentucky492PPSPR, ARS, USDACarcass rinseGeorgiaTP
100616.871,4,[5],12:i:-1,4,[5],12:i:- 27171,4,[5],12:i:-498PPSPR, ARS, USDAScalder tank foamGeorgiaTP
100616.89TyphimuriumTyphimurium 10909Typhimurium498PPSPR, ARS, USDACarcass rinseGeorgiaTP
100616.9Typhimurium 5-Typhimurium 10909Typhimurium498PPSPR, ARS, USDACarcass rinseGeorgiaTP
100616.91TyphimuriumTyphimurium 10909Typhimurium498PPSPR, ARS, USDACarcass rinseGeorgiaTP
100709.01KentuckyKentucky 10299Kentucky492PPSPR, ARS, USDACarcass rinseGeorgiaTP
100709.02KentuckyKentucky 10299Kentucky492PPSPR, ARS, USDACarcass rinseGeorgiaTP
100709.03KentuckyKentucky 10299Kentucky492PPSPR, ARS, USDACarcass rinseGeorgiaTP
100709.04KentuckyKentucky 10299Kentucky492PPSPR, ARS, USDACarcass rinseGeorgiaTP
100709.05SenftenbergSenftenberg 2156Senftenberg362PPSPR, ARS, USDACarcass rinseGeorgiaTP
100709.09HeidelbergHeidelberg 15835Heidelberg498PPSPR, ARS, USDAScalder tank foamGeorgiaTP
100721.01-21,4,[5],12:i:-1,4,[5],12:i:- 27171,4,[5],12:i:-498PPSPR, ARS, USDAScalder tank waterGeorgiaTP
100721.02InfantisInfantis 9381Infantis_1500PPSPR, ARS, USDACarcass rinseGeorgiaTP
100721.05TyphimuriumTyphimurium 10909Typhimurium498PPSPR, ARS, USDACarcass rinseGeorgiaTP
100723.09EnteritidisEnteritidis 2994.GEnteritidis499PPSPR, ARS, USDACarcass rinseGeorgiaTP
100304.101,4,[5],12:i:-1,4,[5],12:i:- 27171,4,[5],12:i:-498PPSPR, ARS, USDACarcass rinseGeorgiaTP
100304.50HeidelbergHeidelberg 15835Heidelberg498PPSPR, ARS, USDACarcass rinseGeorgiaTP
100709.10ThompsonThompson 14415Thompson259PPSPR, ARS, USDAScalder dip tank foamGeorgiaTP
100723.10EnteritidisEnteritidis 2994.GEnteritidis499PPSPR, ARS, USDAScalder dip tank foamGeorgiaTP
100304.58-2KentuckyKentucky 10299Kentucky492PPSPR, ARS, USDAScalder tank foamGeorgiaTP
100304.62-2Typhimurium 5-Typhimurium 10909Typhimurium498PPSPR, ARS, USDAScalder dip tank foamGeorgiaTP
100616.86-2TyphimuriumTyphimurium 10909Typhimurium498PPSPR, ARS, USDACarcass rinseGeorgiaTP
100723.01-2KentuckyKentucky 10299Kentucky492PPSPR, ARS, USDACarcass rinseGeorgiaTP
100723.14-2SchwarzengrundSchwarzen. or Grumpensis 14909.BSchwarzengrund257PPSPR, ARS, USDACarcass rinseGeorgiaTP
100723.02-2HeidelbergHeidelberg 15835Heidelberg498PPSPR, ARS, USDAScalder tank foamGeorgiaTP
25010DerbyDerby 50Derby498SGSCSwineMinnesotaTP
25032MuenchenMuenchen 11942Muenchen404SGSCUnknownUnknownTP
25039PanamaPanama 14909Panama362SGSCUnknownItalyTP
26063MbandakaMbandaka 11813.CMbandaka499EMSFL, ARS, USDAFecal (dairy cow)UnknownTP
26066MbandakaMbandaka 11813.CMbandaka499EMSFL, ARS, USDAFecal (dairy cow)UnknownTP
100616.100RoughInfantis 9381Infantis_1500PPSPR, ARS, USDACarcass rinseGeorgiaTP
100616.102RoughEnteritidis 2866.GEnteritidis499PPSPR, ARS, USDAScalder tank waterGeorgiaTP
100616.84RoughTyphimurium 10909Typhimurium498PPSPR, ARS, USDACarcass rinseGeorgiaTP
100616.97RoughTyphimurium 10909Typhimurium498PPSPR, ARS, USDACarcass rinseGeorgiaTP
100616.99RoughTyphimurium 10909Typhimurium498PPSPR, ARS, USDACarcass rinseGeorgiaTP
100709.06RoughSenftenberg 2156Senftenberg362PPSPR, ARS, USDACarcass rinseGeorgiaTP
100709.07Rough1,4,[5],12:i:- 27171,4,[5],12:i:-498PPSPR, ARS, USDACarcass rinseGeorgiaTP
100709.12RoughInfantis 9381Infantis_1500PPSPR, ARS, USDACarcass rinseGeorgiaTP
100723.04RoughKentucky 10299Kentucky492PPSPR, ARS, USDACarcass rinseGeorgiaTP
100723.08Auto agglutinatorHeidelberg 15835Heidelberg498PPSPR, ARS, USDAScalder tank foamGeorgiaTP
100723.12RoughSenftenberg 2156 rSenftenberg362PPSPR, ARS, USDACarcass rinseGeorgiaTP
100723.15RoughSchwarzen. or Grumpensis 14909.BSchwarzengrund257PPSPR, ARS, USDAScalder tank waterGeorgiaTP
25046Salmonella (B)Abony 5325Abony498SGSCWaterUnited KingdomTP
25050Salmonella (C1)Oranienburg 6717 rOranienburg361SGSCHumanFranceTP
29063Salmonella (C1)Newport 13444Newport_1499ESQRU, ARS, USDAUnknownUnknownTP
29065Salmonella (C1)Oranienburg 6717 rOranienburg365ESQRU, ARS, USDAUnknownUnknownTP
29066Salmonella (B)Typhimurium 10909Typhimurium498ESQRU, ARS, USDAUnknownUnknownTP
29067Salmonella (D)Enteritidis 2994.GEnteritidis499ESQRU, ARS, USDAUnknownUnknownTP
25004No O or H antigenAnatum 15087Anatum499SGSCSwineMinnesotaTP
25037NewportNewport 13519Newport_2395SGSCHumanMexicoTP
25038NewportNewport 14539Newport_3498SGSCSnakeMassachusettsTP
101116-10aFresno (D2)Genovar 5216UN0019 (D1)258Breeder farmChickensAlabama or TennesseeTP
101116-12aFresno (D2)Genovar 5216UN0019 (D1)258Breeder farmChickensAlabama or TennesseeTP
25005CholeraesuisGenovar 14861UN0009 (C1)361SGSCUnknownSwitzerlandTP
25007CholeraesuisGenovar 11439 NUN0010 (C1)498SGSCUnknownAustraliaTP
25017EnteritidisGenovar 6660UN0002 (D1)360SGSCUnknownBrazilTP
25019aEnteritidisGenovar 2370UN0003 (-)498SGSCUnknownSwitzerlandTP
25009DerbyGenovar 6176UN0022 (B)498SGSCAvianOklahomaTP
25014DublinGenovar 5324UN0012 (D1)498SGSCUnknownThailandTP
25027InfantisGenovar 14892UN0023 (C1)499SGSCUnknownSenegalTP
25034MuenchenGenovar 13646UN0036 (C2C3)258SGSCHumanFranceTP
99167Typhimurium 5-Typhimurium 10909Typhimurium 5-395USDA, ARSPigeonUnknownTN
99168Typhimurium 5-Typhimurium 10909Typhimurium 5-395USDA, ARSPigeonUnknownTN
(b) Submissions with agreement between DNAhyb and ISR, but disagreeing with serotype as reported using the KW scheme [13]
25040Panama (D1)Javiana 12917Javiana (D1)367SGSCHumanNorth CarolinaTP
25041Panama (D1)Javiana 12917Javiana (D1)367SGSCHumanNorth CarolinaTP
25035Muenchen (C2)Manhattan 11706Manhattan (C2)396SGSCHumanNorth CarolinaTP
25051-1bcPullorum (D1)Oranienburg 6717 rOranienburg (-)361SGSCUnknownUnknownTP
26026Mbandaka (C1)Tennessee 2108Tennessee (C1)258EMSFL, ARS, USDAFecal (dairy cow)UnknownTP
100304.58-1bcKentucky (C2C3)Typhimurium 10909Typhimurium (B)498PPSPR, ARS, USDAScalder tank foamGeorgiaTP
100304.62-1bcTyphimurium 5- (B)Schwarzen. or Grumpensis 14909.BSchwarzengrund (B)257PPSPR, ARS, USDAScalder dip tank foamGeorgiaTP
100616.86-1bcTyphimurium (B)Infantis 9381Infantis_1 (C1)500PPSPR, ARS, USDACarcass rinseGeorgiaTP
100616.98-1bTyphimurium 5- (B)Kentucky 10299Kentucky (C2C3)492PPSPR, ARS, USDACarcass rinseGeorgiaTP
100721.01-1bc1,4,[5],12:i:- (B)Kentucky 10299Kentucky (C2C3)492PPSPR, ARS, USDAScalder tank waterGeorgiaTP
100304.53Senftenberg (B)Typhimurium 10909Typhimurium (B)498PPSPR, ARS, USDAScalder tank waterGeorgiaTP
25011aDerby (B)Genovar 5160UN0025 (C2C3)498SGSCTurkeyPennsylvaniaTP
25048aParatyphi C (C1)Genovar 14375UN0024 (B)499SGSCUnknownFranceTP
(c) Submissions with disagreement between DNAhyb and ISR, but with DNAhyb in agreement with serotype as reported by the KW scheme [11]
25036NewportNewport 13444UN0034498SGSCHumanNorth CarolinaFP
25043-2Paratyphi B (B)Paratyphi B (possibly Java) 13383UN0015498SGSCUnknownUnknownFP
25044Paratyphi B (B)Paratyphi B (possibly Java) 13383UN0011499SGSCFoodMiddle EastFP
25051-2Pullorum (D1)Gallinarum Pullorum 2978.HUN0008530SGSCUnknownUnknownFP
25057SchwarzengrundSchwarzen. or Grumpensis 14909.BUN0006365SGSCUnknownScotlandFP
26078KentuckyKentucky (10791) 6UN0028499EMSFL, ARS, USDAFecal (dairy cow)UnknownFP
101116-14JavianaJaviana 12917UN0007361Breeder farmChickensAlabama or TennesseeFP
25043-1bcParatyphi B (B)Paratyphi B (possibly Java) 13383Javiana (D1)367SGSCUnknownUnknownTN
100723.01-1bcHeidelberg (B)Heidelberg 15835Kentucky (C2C3)498PPSPR, ARS, USDACarcass rinseGeorgiaTN
100723.02-1bcHeidelberg (B)Heidelberg 15835Kentucky (C2C3)492PPSPR, ARS, USDAScalder tank foamGeorgiaTN
100723.14-1bcKentucky (C2C3)Kentucky 10299Schwarzengrund (B)492PPSPR, ARS, USDACarcass rinseGeorgiaTN

Determination of ISR

The locations where primers hybridize the reference genome in S. enterica ssp. I Enteritidis strain P125109 are shown in Fig. 1. Forward (ISR-F1) and reverse (ISR-R1) primers incorporate the rRNA-23S ribosomal ribose nucleic acid (RNA) region neighboring dkgB (previously known as yafB). Reference genomes and primers used in these analyses are listed in Tables 2 and 3. Primers ISR-F1 and ISR-R1 replaced previously published primers ISRH-1 and ISRH-2 (Morales et al., 2006).

Table 2. Reference ISR sequences available in public databases for Salmonella enterica ssp. I
Serotype designationISR size (bp)RefseqGenBank accession
  1. a

    Not available due to incomplete annotation.

  2. b

    Serotype names replace the unique accession number following multiple confirmations and agreement between methods.

(a) Genome sequences used to obtain ISRs for Salmonella enterica ssp. I at The National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov/)
4,[5],12:i:- str. CVM23701498NZ_ABAO00000000ABAO00000000
Agona str. SL483498NZ_ABEK00000000 ABEK00000000
Choleraesuis str. SC-B67499NC_006905 AE017220
Dublin str. CT_02021853499NZ_ABAP00000000 ABAP00000000
Heidelberg str. SL476498NC_011083 CP001120
Heidelberg str. SL486498NZ_ABEL00000000 ABEL00000000
Javiana str. GA_MM04042433367NZ_ABEH00000000 ABEH00000000
Kentucky str. CDC 191492NZ_ABEI00000000 ABEI00000000
Kentucky str. CVM29188492NZ_ABAK00000000 ABAK00000000
Newport str. SL254492NC_011080 CP000604
Newport str. SL317492NZ_ABEW00000000 ABEW00000000
Paratyphi A str. ATCC 9150498NC_006511 CP000026
Paratyphi B SPB7498NC_010102.1 CP000886
Paratyphi C RKS4594395NC_012125.1 CP000857
Saintpaul str. SARA23498NZ_ABAM00000000 ABAM00000000
Saintpaul str. SARA29498NZ_ABAN00000000 ABAN00000000
Schwarzengrund str. CVM19633267NC_011094 CP001127
Schwarzengrund str. SL480267NZ_ABEJ00000000 ABEJ00000000
Typhi Ty2267NC_004631 AE014613
Typhi str. CT18267NC_003198 AL513382
Typhimurium LT2498NC_003197 AE006468
Virchow str. SL491499Not yet completedna
(b) Genome sequences used to obtain ISRs for Salmonella enterica ssp. I available at The Sanger Institute (http://www.sanger.ac.uk/Projects/Salmonella/)
Enteritidis PT4 NCTC 13349499NC_011294.1 AM933172.1
Gallinarum 287/91 NCTC 13346498NC_011274.1 AM933173.1
Hadar498NAaNA
Infantis500NANA
Typhimurium DT104 NCTC 13348498NANA
Typhimurium DT2498NANA
Typhimurium SL1344 NCTC 13347498NANA
Typhimurium D23580498NANA
(c) ISR sequences for Salmonella enterica ssp. I submitted to the National Center for Biotechnology Informationb
Schwarzengrund_2257In processIn process
Cerro361In process JN105120
Infantis_1500In process JN105121
Oranienburg365In process JN105122
Pullorum361In process JN105123
Senftenberg362In process JN105124
Thompson259In process JN105125
Tennessee258BankIt1458394 SEQ_018 JN092310
Mbandaka499BankIt1458394 SEQ_030 JN092322
Montevideo_1362BankIt1458394 SEQ_031 JN092323
Montevideo_2361BankIt1458394 SEQ_032 JN092324
Montevideo_3362BankIt1458394 SEQ_033 JN092325
Manhatten258BankIt1458394 SEQ_036 JN092328
UN0001404BankIt1458394 SEQ_001 JN092293
UN0002360BankIt1458394 SEQ_002 JN092294
UN0003498BankIt1458394 SEQ_003 JN092295
UN0004362BankIt1458394 SEQ_004 JN092296
UN0005361BankIt1458394 SEQ_005 JN092297
UN0006365BankIt1458394 SEQ_006 JN092298
UN0007361BankIt1458394 SEQ_007 JN092299
UN0008530BankIt1458394 SEQ_008 JN092300
UN0009361BankIt1458394 SEQ_009 JN092301
UN0010498BankIt1458394 SEQ_010 JN092302
UN0011499BankIt1458394 SEQ_011 JN092303
UN0012498BankIt1458394 SEQ_012 JN092304
UN0013498BankIt1458394 SEQ_013 JN092305
UN0014395BankIt1458394 SEQ_014 JN092306
UN0015489BankIt1458394 SEQ_015 JN092307
UN0016396BankIt1458394 SEQ_016 JN092308
UN0017395BankIt1458394 SEQ_017 JN092309
UN0019258BankIt1458394 SEQ_019 JN092311
UN0021499BankIt1458394 SEQ_021 JN092313
UN0022498BankIt1458394 SEQ_022 JN092314
UN0023499BankIt1458394 SEQ_023 JN092315
UN0024499BankIt1458394 SEQ_024 JN092316
UN0025498BankIt1458394 SEQ_025 JN092317
UN0026498BankIt1458394 SEQ_026 JN092318
UN0027499BankIt1458394 SEQ_027 JN092319
UN0028499BankIt1458394 SEQ_028 JN092320
UN0034498BankIt1458394 SEQ_034 JN092326
UN0035498BankIt1458394 SEQ_035 JN092327
Table 3. Primers used to correlate genotype to serotype of Salmonella enterica by ISR
Primer nameOrientationPrimer sequence (5′–3′)ReferenceAmplicon size (bp)a
  1. a

    Amplicon size in S. Typhimurium str. LT2 genome (GenBank AE006468).

ISR-F1ForwardGCCAATGGCACTGCCCGGTAThis study14641
ISR-R1ReverseTACCGTGCGCTTTCGCCCAG
ISRH-1ForwardGATGCGTTGAGCTAACCGGTACTAMorales et al. (2006)Does not apply
ISRH-2ReverseATTCTTCGACAGACACGGCATCAC
ISRHfsForwardGTGGAGCGGTAGTTCAGTTGGTTAMorales et al. (2006)Does not apply
ISRHrsReverseTAACCAACTGAACTACCGCTCCAC

For primer amplification, DNA was extracted from 1 mL of pelleted cells using the PureLink Genomic DNA Mini Kit (Invitrogen Life Technologies, Grand Island, NY). One microliter of DNA was added to 2× Gene Amp Fast PCR Master Mix (Applied Biosystems, Foster City, CA) and 200 nM forward (ISR-F1) and reverse (ISR-R1) primers in a final volume of 30 μL. The PCR was performed on a Veriti 96 well Fast Thermal cycler (Applied Biosystems) as follows: 95 °C for 10 s, 35 cycles at 94 °C, 40 s at 64 °C, and 10 s at 72 °C. After confirmation of the predicted amplicon of approximately 1400 bp by gel electrophoresis, PCR products were purified using the QIAquick PCR purification kit (Qiagen, Valencia, CA). DNA concentrations were measured (NanoDrop, Wilmington, DE) prior to submitting PCR products for Sanger sequencing (Retrogen Inc., San Diego, CA) on an Applied Biosystems, Incorporated (ABI) Prism® 3730 DNA Analyzer using primers ISRHfs and ISRHfr.

Analysis and naming of ISR sequences

ISR sequences were aligned using SeqMan Pro of the Lasergene 8 software (DNASTAR, Madison, WI). Parameters were set to 100% minimum match percentage and a match size of at least 50 bp. Primers were designed to assure linkage to dkgB, which is required to assure that the correct region is under investigation. Serotype names were assigned to an ISR sequence when a 100% match was made to a reference sequence or when DNAhyb and KW serotyping agreed. Otherwise, ISR sequences are identified as ‘UN’ followed by four-digit numbers. The initial (5′ ATGTTTTGGCG 3′) and final (5′ CGGTGGAGCGG 3′) eleven nucleotides should be similar for ISRs, with the exception that the first nucleotide in the ISR sequence can sometimes be a cytosine rather than an adenine nucleotide.

DNAhyb assay

The DNAhyb protocol was performed as directed (Check & Trace) on single Salmonella colonies grown for 24–48 h on BG agar at 37 °C. Large colonies are recommended to reach the recommended DNA concentration. Images of products were obtained on a single-channel ATR03 reader and processed by the Salmonella Check-Points software which indicates a serotype name, or alternatively, a genovar number. Images of spot patterns were discussed with the manufacturer in unusual situations, such as finding genetic variants of Salmonella Kentucky. In this case, three isolates were submitted to the source of the kit for independent verification that new variants were being identified and that all positive and negative controls worked.

Results

ISR and DNAhyb assign serotype to Senterica similarly

Details from analysis of S. enterica by ISR and DNAhyb are shown in Table 1. Of the 139 submissions, 115 (82.7%) had substantial agreement between DNAhyb and ISR, as well as the reported KW serotype (Table 1a). Some genetic variation was noted in ISRs in this grouping, but serotype association was maintained in comparison with both DNAhyb and the KW scheme and thus these were counted as agreements. Further analysis of ISR variation showed that 15 named serotypes had at least three independent submissions. Of this group, 10 (66.7%) had uniform ISRs with no variation. Five (5) serotypes had multiple ISRs, namely Salmonella Infantis (two variants), Salmonella Typhimurium (two variants), S. Kentucky (two variants), Salmonella Newport (four variants), and Salmonella Montevideo (three variants). For the purpose of determining specificity and sensitivity in this study, results with disagreement about how much variation is accounted for by DNAhyb vs. ISR were counted as true negatives (TN), because the ISR method produced information somewhat different, but not necessarily in disagreement, to DNAhyb. In summary, 128 of the 139 isolates (92.1%) had agreement between DNAhyb and ISR (Table 1b + 1a). Detail about ISR variation within a single named serotype will be discussed in following text.

For 10 submissions, the forward/reverse (F/R) sequences did not match. Individually processing multiple colonies for nine of these submissions in this category recovered a second serotype. The frequency with which a second serotype accounted for disagreement between genomic methods and KW serotype suggests that minority subpopulations are common. In addition, techniques appear to vary in their ability to detect multiple serotypes. Seven other submissions (25011, 25048, 25040, 25041, 25035, 26026, and 100304.53) had KW serotypes with O-antigens that did not match what was received for analysis but there was no disagreement in F/R sequences. In these cases, misinterpretation of the second cell-surface molecule flagella could have contributed to misinterpretation of serotype. Alternatively, these submissions could have also been mixed when initially examined for KW serotype and undergone separation of serotypes prior to analysis during the current study. For submissions 101116-10 and 101116-12, which were classified as Salmonella Fresno and ISR UN0019, O-antigen D2 epitopes would be expected to cross-react with factor 9 antisera used to detect D1 epitopes (Curd et al., 1998).

Table 1c shows paired samples with disagreement between DNAhyb and ISR. Four of these submissions yielded mixed serotypes, namely 25043-1, 100723.01-1, 100723.02-1, and 100723-14.1. They are included in Table 1c to reflect the incidence with which disagreement was encountered. However, disagreements between DNAhyb and ISR and KW were resolved for these four isolates. The other seven submissions in Table 1c had a unique (UN) ISR sequence that was identified by DNAhyb as a genovar with an available reference sequence. However, slight differences in the ISR suggested genetic variants could be present as observed for the first group in Table 1a. These submissions were grouped in Table 1c because the serovar they might be associated with could not be further verified at this time. Acquisition of more isolates is needed to resolve the relationship between KW serotype, DNAhyb and ISR sequence in these cases.

ISR appears more sensitive than DNAhyb for the detection of genetic variation within serotype

ISR appears to give a more sensitive assessment of serotype than DNAhyb. To explain further, some specific examples are cited. These are as follows:

  1. ISR sometimes detected two types of S. Typhimurium, namely Typhimurium and Typhimurium 5-, whereas DNAhyb did not (Table 1, accession numbers 100304.57, 100304.74, 100304.32, 100304.62-2, 100616.9, 99163, 99164 and 99172). Thus, DNAhyb is not currently capable of detecting the 5- variant. ISR indicated that UN0014 was linked to the Typhimurium 5- KW serotype, but this correlation was not observed for all examples (see 100304.62-2). Thus, variation in expression of cell-surface epitopes may account for the 5- variant in addition to genetic variation as observed by ISR.
  2. Only one publicly available reference sequence out of 27 disagreed with assignment of serotyping by the three methods. The ISRs for the reference sequences of S. Schwarzengrund NC_011094 and NZ_ABEJ00000000 were 267 bp and no SNP differences were present. The strains of S. Schwarzengrund analyzed here had ISRs of 257 bp regardless of method used to assign serotype. Further analysis is required to explain this discrepancy, which could be due to strain variation or some discrepancy with annotation in the reference strain.
  3. Five submissions of S. Newport had different ISR sequences and four DNAhyb patterns despite having a single serotype assigned by the KW scheme. Alignment of the sequence of five ISRs from submissions that serotyped as S. Newport showed that ISR UN0017 had a deletion within the intergenic region between the end of the 23S and 5S rRNA genes (Fig. 2, Top).
  4. O-antigen group D submissions had an even more complex ISR outcome than did S. Newport (Fig. 2, Bottom). Alignment showed that, in comparison with S. Enteritidis, ISR UN0002 had a somewhat similar deletion as that seen occurring within Salmonella Pullorum in the intergenic region between the 5S rRNA and tRNA aspU. In this same region, ISR UN0008 has an insertion that was 100% similar to a region from S. Newport found in a different ribosomal region. The insert accounted for the exceptional length of the ISR. Specifically, there was a 146 bp insert in ISR UN0008 that was the same as base pairs 4165975-4166120 in the genome of S. Newport strain SL254 (NC_011080). Other serotypes that had ISR variants within a serotype included S. Kentucky, S. Montevideo, and S. Infantis.
Figure 2.

Alignment of ISR sequences to evaluate variation within serotype. (Top) Alignment of ISRs from Salmonella enterica serovar Newport. The shortest ISR shown is UN0017, which had a deletion occurring before the 5S ribosomal gene. The 5S ribosomal gene of Salmonella Enteritidis was included for reference purposes. (Bottom) Alignment of ISRs from the O-antigen group D serotypes of S. enterica. The submission with ISR UN0002 was S. Enteritidis by the KW scheme and Genovar 6660 by DNAhyb. ISR UN0008 was Salmonella Pullorum by the KW scheme and Genovar Gallinarum Pullorum 2978H by DNAhyb. Alignment of ISR sequences from Group D serotypes indicated that UN0002 is more like S. Pullorum. ISR UN0008 is more like S. Gallinarum or S. Enteritidis, except that it has a 146 bp insertion also found in S. Newport.

ISR and DNAhyb are limited to assignment of serotype to S. enterica

The limit of detection of ISR was found by analysis of S. Enteritidis submissions 22079, 21027, and 21046, which were included to as control strains because they were previously characterized by whole-genome analysis (Guard et al., 2011). Strains 21027 and 21046 are clonally related and are within the same phage type lineage 13a/8, whereas 22079 is phage type 4. Despite belonging to the same phage type, strains 21027 and 21046 are phenotypically distinct and are known to have 16 genes with altered open reading frames as well as other SNPs. All three subpopulations of S. Enteritidis had the same KW serotype, DNAhyb genovar, and ISR. Thus, the two DNA methods were equivalent in regards to determining serotype only.

Determination of sensitivity and specificity of ISR in comparison with DNAhyb

Table 1 includes the category of each ISR for the purposes of determining sensitivity and specificity in comparison with DNAhyb. True positives (TP) were defined as submissions assigned a serotype by ISR in complete agreement with DNAhyb, TN indicated ISR was different for the serotype assigned by DNAhyb due to the presence of genetic variation (including mixtures of serotypes), false positives (FP) were assigned a serotype by ISR but not by DNAhyb, and false negatives (FN) should have returned an ISR sequence but did not. As all submissions were S. enterica ssp. I and produced an ISR and a DNAhyb genovar, the FN value is 0. Calculating sensitivity from the values 124/124 + 0 (TP/TP + FN) suggests unity (similar performance) of the two methods. Calculating specificity from the values 8/7 + 8 = 0.53 (TN/FP + TN) suggests that DNAhyb is more specific, or in other words, it detects less genetic variation than does ISR. Removing submissions with mixtures did not change the finding that ISR appears to give more specific information than DNAhyb. Given that detection of new serotypes is a continuous process for S. enterica ssp. I, application of ISR has the potential to expand knowledge about diversity of serotypes. In these analyses, we used S. enterica serovar Enteritidis to provide a crucial control that shows ISR does not provide fine-scale differentiation achieved with whole-genome sequencing.

Discussion

A limit of detection of ISR is that it targets a single region of the bacterial chromosome. Homologous recombination and other genomic events that mobilize DNA could generate a hybrid strain with potential to alter the correlation between an ISR region and the rest of the chromosome (Porwollik & McClelland, 2003). Methods that target multiple regions around the bacterial chromosome, such as DNAhyb and whole-genome sequencing, will thus still be required for critical stages of analysis. The primary use proposed for ISR is to facilitate routine and inexpensive serotyping of S. enterica. The method has been applied to processing DNA samples from South America in cooperation with the United States, and further development of software that incorporates a validated database will streamline analysis for users (Pulido-Landinez et al., 2012). SNP analysis by ISR complements methods such as DNAhyb that evaluate the whole genome, and each genome method can be used to check the quality of results from the other.

Disagreement between the KW scheme and genotyping by either DNA method could be attributed to at least four causes with a biological or molecular explanation.

  1. Flagella H-antigen immunoreactivity may contribute disproportionately to interpretive differences between investigators;
  2. A genetic variant may have a unique ISR or DNAhyb genovar that, in consensus with previous knowledge, is a genetic variant of an existing serotype;
  3. Mixtures of serotypes could be present within cultures, which can be detected by some methods but not others.
  4. The most troublesome group was new variants with undefined relationships to named serotypes. ISR UN0002 (ISR 360 bp) and UN0008 (ISR 530 bp) were associated with submissions serotyped by the KW scheme as S. Enteritidis and S. Pullorum, respectively, despite their unique ISR sequences. Classifying them by the KW scheme as S. Enteritidis or S. Pullorum could have unintended consequences, because the biological impact of these strains on susceptible hosts is not known. For example, S. Pullorum on-farm can initiate depopulation of chickens in order to protect poultry health (http://www.aphis.usda.gov/animal_health/animal_dis_spec/poultry/), whereas S. Enteritidis in people and foods can initiate control measures to protect human health (http://www.fda.gov/Food/FoodSafety/Product-SpecificInformation/EggSafety/EggSafetyActionPlan/ucm170746.htm). No information is available on the comparative virulence properties of UN0002 (ISR 360 bp) and UN0008 (530 bp) to S. Pullorum (ISR 361 bp) or S. Enteritidis (ISR 499 bp). Further research using biological assays is needed to characterize the virulence of strains identified by ISR as being potentially new strains of concern to either human or animal health.

Assay costs were from $10 to $12 per sample for ISR, $35 to $185 for KW serotyping and $50 for the method of DNAhyb used here. The point of comparison begins when a colony is identified on agar that is suspected of being Salmonella. The low cost and simplicity of conducting ISR make it a method that supports public health laboratories and food producers with in-house laboratories in their efforts to monitor S. enterica. Other efficiencies such as submission of DNA to centralized facilities and applying robotics for sample preparation may lower the cost of conducting ISR further. If a simple method for serotyping S. enterica is available, farm management and plant processors may test samples and monitor environments more frequently. The ability of ISR to detect a mixture of serotypes, its independence of cell-surface epitopes, cost, and simple software requirements are relative strengths. We suggest that it will a useful addition for assigning serotype at minimal cost rather than being another typing method with no clear advantage (Achtman, 1996; Achtman et al., 2012).

Acknowledgements

Authors have no conflict of interest, financial or otherwise. Use of commercially available products by the United States Department of Agriculture (USDA) does not constitute endorsement. This manuscript was primarily supported by USDA-ARS Project Number 6612-32000-007-00 “Genetic Analysis of Poultry-Associated Salmonella enterica (abbr).” Submissions were collected in association with USDA-ARS Project Numbers 1265-32000-078-00, 6612-41420-017-00 and 6612-32420-001-00.

Ancillary