Presence of SXT integrating conjugative element in marine bacteria isolated from the mucus of the coral Fungia echinata from Andaman Sea

Authors


Correspondence: Subrata K. Das, Department of Biotechnology, Institute of Life Sciences, Nalco Square, Bhubaneswar 751023, India. Tel.: +91 674 230 3342; fax: +91 674 230 0728; e-mail: subratkdas@hotmail.com; subrata@ils.res.in

Abstract

In this study, we characterize 18 cultivable bacteria associated within the mucus of the coral Fungia echinata from Andaman Sea, India. 16S rRNA gene sequence analysis showed that all the 18 strains isolated in this study from the coral mucus belong to the group Gammaproteobacteria and majority of them were identified as Vibrio core group. Our objective was to investigate the presence of the SXT/R391 integrating conjugative elements (ICEs) targeting integrase intSXT and SXT Hotspot IV genetic elements in these isolates. SXT/ICE initially reported in Vibrio cholerae contains many antibiotic and heavy metal resistance genes and acts as an effective tool for the horizontal transfer of resistance genes in other bacterial populations. Two of our strains, AN44 and AN60, were resistant to sulfamethoxazole, trimethoprim, chloramphenicol, and streptomycin, in addition to other antibiotics such as neomycin, ampicillin, rifampicin, and tetracycline. Using PCR followed by sequencing, we detected the SXT/ICE in these strains. The SXT integrase genes of AN44 and AN60 had a 99% and 100% identity with V. cholerae serogroup O139 strain SG24. This study provides the first evidence of the presence of SXT/R391 ICEs in Marinomonas sp. strain AN44 (JCM 18476T) and Vibrio fortis strain AN60 (DSM 26067T) isolated from the mucus of the coral F. echinata.

Introduction

Bacteria are known to be abundant in seawater around coral zones, in coral tissues, and within their surface microlayer (Lampert et al., 2006; Rosenberg et al., 2007), and each of these habitats supports the existence of different bacterial species (Koren & Rosenberg, 2006; Littman et al., 2009). Several studies documented that the bacterial population associated with corals are specific and any anthropogenic pressure and environmental effects could affect the health of the corals (Chimetto et al., 2009; Nithyanand & Pandian, 2009; Ceh et al., 2011). Intensive use of antimicrobial agents in aquaculture develops drug-resistant bacteria and transmits the resistance genes to other bacteria in the aquatic environment. Due to this practice, resistance genes may get disseminated among native bacterial flora of humans and aquatic animals by horizontal gene transfer (Kruse & Sorum, 1994; Akinbowale et al., 2006).

Integrating conjugative elements (ICEs) are mobile genetic elements that are increasingly recognized as important mediators of horizontal gene transfer among prokaryotes (Burrus et al., 2006). In the past decade, an increasing number of ICEs have been described in several bacterial groups. These ICEs play an important role in the dissemination of antimicrobial resistance genes in several pathogens and in commensal bacteria. Most of the studies on SXT/ICEs are carried out in clinical isolates of Vibrio cholerae. However, the presence of SXT/ICEs in other bacterial species from several ecosystems is less understood. One of such unexplored ecosystems is the marine environment where the presence of SXT/ICEs has been reported in Photobacterium damselae ssp. piscicida (Osorio et al., 2008) and other bacterial strains taxonomically related to Vibrio scophthalmi, Vibrio splendidus, Vibrio alginolyticus, Shewanella haliotis, and Enterovibrio nigricans (Rodríguez-Blanco et al., 2012). The increasing number of reports of antimicrobial resistance conferring the SXT-related ICEs in diverse pathogens and other environmental isolates presumably reflects the overuse of drugs that reaches several ecosystems supporting the selection of resistance gene transfer. Through screening and cataloging the SXT-related ICEs, we can detect diversity and accessory functions of ICEs and understand their roles in facilitating the rapid adaptation of prokaryotes to changing environments. The SXT/ICE was first reported from V. cholerae O139 conferring the resistance to four antimicrobials, namely trimethoprim, streptomycin, sulfamethoxazole, and chloramphenicol (Waldor et al., 1996). Later, Hochhut et al. (2001) described that SXT is genetically and functionally related to the IncJ element R391/ICE from Providencia rettgeri resistance to kanamycin and mercury. However, it is very likely that more comprehensive studies would detect SXT-related elements in many pathogenic and nonpathogenic bacterial species.

Coral mucus is a rich substrate for microorganisms (Lampert et al., 2006). To date, very few systematic studies have been undertaken on abundance and diversity of microorganisms associated with the corals from Andaman Sea. In this study, we present our results on the identification of 18 heterotrophic culturable bacteria from the mucus of the coral Fungia echinata from Andaman Sea and Nicobar Islands, India, and detection of SXT/R391 ICEs targeting the integrase gene.

Materials and methods

Sample collection and bacteria isolation

Coral samples were collected in the Havelock Island, Andaman Sea (Coordinates: 11°59′54″N, 92°58′32″E), during November 2010 from a depth of about 5 m. Mucus samples of ca. 1 cm2 coral surface area from four individual species of F. echinata were taken using sterile cotton swabs (Guppy & Bythell, 2006) and transferred into a sterile tube with 1 mL of filter-sterilized seawater. All samples were transported to the laboratory for further analysis. The bacteria from the cotton swabs were suspended in seawater by vigorous vortexing and used as a master mix. An aliquot (100 μL) of the mixed samples was serially diluted using phosphate-buffered saline and plated onto Bacto Marine agar 2216 (Difco, Sparks Glencoe, MD). All plates were incubated at 25 °C, corresponding to the seawater temperature of the site for 4 days. Colonies appeared on marine agar plates were picked up, purified, and preserved in 15% glycerol at −80 °C.

Identification of bacteria by 16S rRNA gene sequence analysis

For the identification of the cultivable bacteria, 16S rRNA gene sequence analysis was performed. For this, genomic DNA was isolated using standard methods (Sambrook et al., 1989; Jyoti et al., 2010). PCR amplification of 16S rRNA gene was performed in a thermal cycler (PCT-200; MJ Research, Waltham, MA) using the universal bacterial primers, 27F (5′-GAGTTTGA TCCTGGCTCAG-3′) and 1525R (5′-AAAGGAGGTGATCCAGCC-3′) (Panday et al., 2011). Negative control was prepared with water replacing template DNA. PCR products of ∼ 1.5 kb length were purified from excised portion of the agarose gel with QIAquick gel Extraction Kit (Qiagen, Hilden, Germany). Purified PCR products were ligated with pGEM-TEasy vector (Promega, Madison, WI) and transformed into Escherichia coli DH5α (Sambrook et al., 1989). Transformed clones were checked for the appropriate size of insert by restriction digestion with EcoRI enzyme and sequencing of the insert which was cloned into a pGEM-TEasy vector. Sequencing was performed with SP6 and T7 primers using a CEQ Dye Terminator Cycle Sequencing Kit in an automated DNA sequencer (CEQ 8000; Beckman Coulter, Fullerton, CA).

Phylogenetic analysis

Nucleotide sequences were assembled using the sequence alignment editor program BioEdit (http://www.mbio.ncsu.edu/bioedit/bioedit.html). The 16S rRNA gene sequence thus obtained was compared with those in the GenBank after BLAST searches (Altschul et al., 1997) and using the EzTaxon server (Chun et al., 2007). The phylogenetic tree of the SXT gene was constructed by the method of Jukes & Cantor (1969) and the MEGA 4.0 software package (Tamura et al., 2007).

Amplification of SXT integrase gene by PCR

PCR was performed to detect SXT/R391 ICEs targeting integrase intSXT and SXT Hotspot IV genetic element using all the strains. The primers designated as ICEdetF (TCAGTTAGCTGGCTCGATGCCAGG), ICEdetR (GCAGTACAGACACTAGGCGCTCTG), SXTdetF (ACTTGTCGAATACAACCGATCATGAGG), and SXTdetR (CAGCATCGGAAAATTGAGCTTCAAACTCG) by Spagnoletti et al. (2012) were used in the multiplex PCR. The PCR mixture contained 2.5 U of GoTaq Flexi DNA polymerase (Promega), 1× GoTaq Flexi buffer, 3 mM MgCl2 solution, 0.4 mM PCR nucleotide mix, 0.5 μM of each primer (GCC Biotech, Kolkata, India), 1 μL of genomic DNA template, and Milli-Q water (Millipore, Bangalore, India) to a final volume of 50 μL. Vibrio cholerae serogroup O139 strain SG24 was used as positive control. This multiplex PCR was performed in a thermal cycler (MJ Research) with 35 cycles of denaturation at 94 °C for 1 min (4 min for the first cycle), annealing at 51 °C for 30 s, and polymerization at 72 °C for 30 s (5 min for the last cycle). Amplified PCR products were separated by agarose gel electrophoresis, purified, and sequenced as mentioned before.

Dot-blot hybridization

To confirm the presence of SXT Hotspot IV gene in the strains AN44 and AN60, dot-blot hybridization was carried out. DNA (1 μg) of each strain was transferred onto a positively charged nylon membrane (Hybond-N+; Amersham) using a dot-blot apparatus (Bio-Rad, Hercules, CA). The membrane was air-dried and cross-linked, and the gene probe used to detect the SXT Hotspot IV was a ~ 357-bp PCR fragment amplified from the V. cholerae strain SG24. The probe was labeled by random priming (Feinberg & Vogelstein, 1983) with [α-32P] dCTP (BRIT, Hyderabad, India) using a Decalabel™ DNA labeling kit (MBI, Fermentas, Opelstrasse, Germany). Hybridization was performed as described by Ezaki et al. (1989).

Antimicrobial susceptibility test

Susceptibility to nine antimicrobial agents was determined using E-test strips (Biomerieux, Marcy l'Etoile, France) on Bacto Marine agar 2216 (Difco) for all the isolates and on Muller–Hinton (BD Bioscience, San Diego, CA) agar plates for the control V. cholerae strain. For the E-test antibiotic diffusion assay, all the 18 isolates were grown for 6 h in the Bacto Marine broth 2216 or in the Muller–Hinton broth. The turbidity of the cell suspensions was adjusted to the optical density (OD) 0.5. One hundred microliters of the grown culture was spread onto the respective agar plates and incubated for 24 h at 28 °C (37 °C for the strain SG24). This assay was carried out in duplicate, and the resistance profiles were assigned after measuring average zone sizes using the break points.

Nucleotide sequence accession number

The partial 16S rRNA gene sequences determined in this study are available in the GenBank nucleotide sequence database under the accession numbers JQ409370JQ409387. The GenBank accession numbers for the SXT gene sequences of Marinomonas sp. strain AN44, Vibrio fortis strain AN60, and V. cholerae strain SG24, respectively, are JQ900625, JQ900626, and JQ970522.

Results and discussion

Identification of bacteria

Microbial communities associated with coral mucus are taxonomically and functionally diverse (Bourne & Munn, 2005; Ritchie, 2006). In this study, 18 bacterial strains were isolated from the coral F. echinata. Identification of the strains by 16S rRNA gene sequence analysis revealed that all the strains belong to the five taxa of the class Gammaproteobacteria. Among them, majority of the strains were assigned to the Vibrio core group. All the strains were closely related to previously described bacterial species, with a similarity of more than 97% with the first 1300 bp of the 16S rRNA gene (Table 1). Earlier studies revealed that the heterotrophic bacterial community of the mucus of the stony coral Fungia scutaria from the Red Sea is composed mainly of the bacterial groups Alphaproteobacteria, Gammaproteobacteria, and Actinobacteria (Lampert et al., 2006). Rohwer et al. (2002) reported that bacterial associations with the corals are species specific, even when the corals are physically close to one another. Moreover, bacterial community described in the tissue of reef coral Pocillopora damicornis was dominated by Gammaproteobacteria, while the mucus of the coral was dominated by Alphaproteobacteria (Bourne & Munn, 2005). In contrast, we compared the composition of bacteria of the coral F. echinata from Andaman Sea and detected only the members of the Gammaproteobacteria.

Table 1. 16S ribosomal RNA gene sequencing analysis, antibiotic resistance phenotype, and the detection of SXT/ICE genes of the bacteria isolated from the Andaman Sea coral Fungia echinata
Bacterial strainGenBank accession numberMost closely related hit in EzTaxon serverSimilarity with 1300 base pair (%)Bacterial groupResistance profileSXT/ICE gene
  1. TMP, trimethoprim; STR, streptomycin; TET, tetracycline; NAL, nalidixic acid; CHL, chloramphenicol; RIF, rifampicin; AMP, ampicillin; NEO, neomycin; SULF, sulfamethoxazole; +, positive; −, negative.

AN11 JQ409372 Vibrio azureus (AB428897)99 Gammaproteobacteria NEO, AMP, RIF, TMP, NAL, STR, TET, SULF
AN12 JQ409373 Vibrio tubiashii (X74725)98 Gammaproteobacteria NEO, AMP, NAL, STR, TET, SULF
AN14 JQ409374 Vibrio rotiferianus (AJ316187)99 Gammaproteobacteria NEO, AMP, RIF, TMP, NAL, STR, TET, SULF
AN30 JQ409375 Pseudoalteromonas flavipulchra (AF297958)99 Gammaproteobacteria NEO, AMP, TMP, STR, TET, CHL, SULF
AN32 JQ409376 Marinomonas communis (DQ011528)99 Gammaproteobacteria NEO, AMP, SULF
AN33 JQ409377 Alteromonas macleodii (Y18228)99 Gammaproteobacteria NEO, AMP, TMP, STR, TET, SULF
AN34 JQ409378 Pseudoalteromonas rubra (X82147)99 Gammaproteobacteria NEO, AMP, TMP, STR, TET, CHL, SULF
AN35 JQ409379 Alteromonas marina (AF529060)99 Gammaproteobacteria NEO, AMP, TMP, STR, TET, SULF
AN38 JQ409380 Vibrio nereis (X74716)99 Gammaproteobacteria NEO, AMP, STR, TET, SULF
AN40 JQ409381 Pseudoalteromonas phenolica (AF332880)98 Gammaproteobacteria NEO, AMP, STR, TET
AN43 JQ409382 Aliivibrio fischeri (X74702)99 Gammaproteobacteria NEO, AMP, RIF, NAL, STR, TET, SULF
AN44 JQ409370 Marinomonas ostreistagni (AB242868)97 Gammaproteobacteria NEO, AMP, RIF, TMP, NAL, STR, TET, SULF+
AN60 JQ409371 Vibrio fortis (AJ514916)99 Gammaproteobacteria NEO, AMP, RIF, TMP, NAL, STR, TET, SULF+
AN61 JQ409383 Vibrio communis (GU078672)99 Gammaproteobacteria NEO, AMP, RIF, TMP, NAL, STR, CHL, TET, SULF
AN62 JQ409384 Vibrio ponticus (AJ630103)99 Gammaproteobacteria NEO, AMP, RIF, TMP, NAL, STR, CHL, TET, SULF
AN72 JQ409385 Vibrio diabolicus (X99762)99 Gammaproteobacteria NEO, AMP, RIF, TMP, NAL, STR, CHL, TET, SULF
AN81 JQ409386 Vibrio owensii (GU018180)100 Gammaproteobacteria NEO, AMP, TMP, NAL, STR, CHL, TET, SULF
AN82 JQ409387 Vibrio mediterranei (X74710)99 Gammaproteobacteria NEO, AMP, RIF, TMP, NAL, STR, CHL, TET, SULF

Identification of SXT integrase gene

The PCR results showed the presence of SXT integrase-encoding gene in two strains identified as Marinomonas sp. (strain AN44) and V. fortis (strain AN60), with an expected amplicon size of ∼ 500 bp, whereas the SXT Hotspot IV-encoding gene was absent in both the strains (Fig. 1a). This might be due to the lack of primer specificity or a mutation in that specific gene. Sequencing of the PCR-amplified SXT integrase from the strains AN44 and AN60 identified open reading frames with identities to genes that encode SXT integrase reported from other bacteria. Moreover, strain AN44 was positive in dot-blot hybridization, suggesting that it carried SXT Hotspot IV gene. Interestingly, strain AN60 was negative (Fig. 1b). Based on these results, we investigated relationships, if any, in the SXT integrase gene sequences and constructed a neighbor-joining phylogenetic tree (Fig. 2) using SXT gene sequences of different organisms. Phylogenetic tree exhibited clustering with the members of Gammaproteobacteria. Comparison of the derivative amino acid sequence of these genes with those in the databases revealed high degree of similarity with SXT integrase reported from different bacteria. This may be due to the acquisition of mobile genes from unrelated organisms under particular environmental condition (Hacker & Carniel, 2001; Frost & Koraimann, 2010). As a result, many bacteria have acquired a considerable proportion of their genetic diversity from distantly related organisms by horizontal gene transfer (Ochman et al., 2000). The deduced amino acid sequences of the SXT genes shared 97–100% identity with that of V. cholerae Ind4, V. fluvialis, Proteus mirabilis, Shewanella putrefacians, P. rettgeri, and Proteus vulgaris.

Figure 1.

(a) Ethidium bromide–stained agarose gel electrophoresis of multiplex PCR products. Lanes M, 1-kb DNA ladder; lane 1, Vibrio cholerae strain SG24; lane 2, Vibrio fortis strain AN60, and lane 3, Marinomonas sp. strain AN44. (b) Dot-blot hybridization of genomic DNA with ~ 357-bp PCR-amplified SXT Hotspot IV element. Lane 1, V. cholerae strain SG24; lane 2, Marinomonas sp. strain AN44; lane 3, V. fortis strain AN60; and lane 4, Escherichia coli strain HB101 as negative control.

Figure 2.

Neighbor-joining tree based on SXT gene sequences, built with reference sequences from GenBank and those obtained in this study (bold-faced). GenBank accession numbers are indicated within brackets. The tree topologies and statistical significance of branch points of the distance were tested by 1000 bootstrap resamplings of the data.

Antimicrobial test

We observed that the strains AN44 and AN60 were resistant to streptomycin, nalidixic acid, trimethoprim, and sulfamethoxazole, which phenotypically confirms the presence of SXT integrase. This study allowed the identification of two new species harboring ICEs (Marinomonas sp. strain AN44 and V. fortis strain AN60) in aquatic environment. The remaining strains tested in this study lacked SXT/R391 ICEs gene (Table 1). Majority of the isolates displayed resistance to neomycin, ampicillin, tetracycline, streptomycin, and sulfamethoxazole (94–100%). Seven strains displayed resistance to chloramphenicol that indicates less abundance of genes coding for chloramphenicol acyltransferase (41%). Resistance to other antibiotics was found in 72% (trimethoprim), 61% (nalidixic acid), and 50% (rifampicin). Antibiotic resistance pattern found in these bacterial strains suggests that some of the antibiotic resistance could be encoded in the SXT/ICEs or in other mobile genetic elements. The presence of diversity in antibiotic resistance in these strains might constitute a pool of genes capable of moving among bacteria in the aquatic environment (Jacobs & Chenia, 2007).

Recently, it has been demonstrated that in several vibrios, the mobile genetic elements such as SXT ICEs can contribute to the dissemination of antimicrobial and heavy metal resistance determinants in closed aquaculture environments (Rodríguez-Blanco et al., 2012). However, there has been no report on the presence of SXT integrase in V. fortis and Marinomonas strains isolated from any ecological niche. Our findings showed that SXT element–bearing drug resistance markers are present in Marinomonas species and V. fortis isolated from the coral mucus F. echinata. These results provide another example of the spread of resistance genes in remote natural bacterial population.

Acknowledgements

We are grateful to the Ministry of Environment and Forest, Wildlife Division, Government of India, and The Chief Conservator of Forests (Wildlife), Andaman and Nicobar Islands, Port Blair, for officially allowing us to collect coral samples from the Andaman Sea. This work was supported in part by the funding received from the Ministry of Earth Sciences, Government of India (MoES/11-MRDF/1/59/P/08). The authors, JB and PK, acknowledge the Department of Biotechnology, and University Grant Commission, Government of India, New Delhi, respectively, for providing the junior research fellowship.

Ancillary