SEARCH

SEARCH BY CITATION

Keywords:

  • glycoside hydrolase;
  • GH family 3;
  • chitobiase;
  • chitinase;
  • actinomycetes

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results and discussion
  6. Acknowledgements
  7. References

The dasD gene is located just downstream of the dasABC gene cluster, encoding components of an ABC transporter for uptake of a chitin-degradation product N,N′-diacetylchitobiose [(GlcNAc)2] in Streptomyces coelicolor A3(2). To clarify the roles of the DasD protein in the degradation and assimilation of chitin, we obtained and characterized a recombinant DasD protein and a dasD-null mutant of S. coelicolor A3(2). The recombinant DasD protein produced in Escherichia coli showed N-acetyl-β-d-glucosaminidase (GlcNAcase) activity and its optimum temperature and pH were 40 °C and 7, respectively. dasD transcription was strongly induced in the presence of chitin, weakly by chitosan, but not by cellulose or xylan in S. coelicolor A3(2). Immuno-blot analysis demonstrated that DasD is a cytoplasmic protein. The dasD-null mutant exhibited cellular GlcNAcase activity which was comparable with that of the parent strain M145. DasD, thus, did not seem to be a major GlcNAcase. Induced extracellular chitinase activity in the dasD-null mutant was, interestingly, higher than M145, in the presence of colloidal chitin or (GlcNAc)2. In contrast to M145, (GlcNAc)2 temporally accumulated in the culture supernatant of the dasD-null mutant in the presence of colloidal chitin.


Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results and discussion
  6. Acknowledgements
  7. References

Chitin, a polymer of N-acetyl-β-d-glucosamine (GlcNAc), is the second most abundant biopolymer in nature after cellulose. Chitin is degraded into shorter oligo-, di-, and mono-saccharides by extracellular glycoside hydrolases which are represented by chitinase (EC 3.2.1.14), N-acetyl-β-d-glucosaminidase (EC 3.2.1.30), and N-acetyl-β-d-hexosaminidase (EC 3.2.1.52). A number of microbial genera are characterized as chitin-degraders, among which Streptomyces species are well-known decomporsers of chitin in soil.

Chitin-degradation systems in some Streptomyces species (S. lividans, S. coelicolor A3(2), S. olivaceoviridis, S. griseus, S. thermoviolaceus, and S. plicatus) have been intensively studied, and these species produce multiple extracellular chitinases which cleave chitin mainly into N,N′-diacetylchitobiose [(GlcNAc)2] (Blaak et al., 1993; Fujii & Miyashita, 1993; Kawase et al., 2001, 2006; Li et al., 2000; Miyashita & Fujii, 1993; Miyashita et al., 1991, 1997; Ohno et al., 1996; Robbins et al., 1988; Saito et al., 1999, 2000, 2003; Tsujibo et al., 1993, 2000a; Tsujibo et al., 2000b). Extracellular N-acetyl-β-d-hexosaminidase and N-acetyl-β-d-glucosaminidase (GlcNAcase), which release GlcNAc from (GlcNAc)2 and higher oligomers, have also been characterized in S. plicatus and S. thermoviolaceus, respectively (Mark et al., 1998; Tsujibo et al., 1998). In S. thermoviolaceus, an intracellular GlcNAcase has been reported as well (Kubota et al., 2004).

Chitin-degradation products are taken up via ABC (ATP-binding cassette) transporters [NgcEFG for GlcNAc and (GlcNAc)2 in S. olivaceoviridis (Xiao et al., 2002; Saito & Schrempf, 2004) and DasABC-MsiK for (GlcNAc)2 in S. coelicolor A3(2) (Saito et al., 2007, 2008)] and a PTS (phosphoenolpyruvate phosphotransferase system) for GlcNAc uptake (Wang et al., 2002; Nothaft et al., 2010). The dasD gene, which encodes a putative sugar hydrolase belonging to the family 3 of glycoside hydrolase classification, is located just downstream of the dasABC gene cluster of S. coelicolor A3(2). The amino acid sequence of the DasD protein is 34.4% identical with N-acetyl-β-d-glucosaminidase A of Altermonas sp. O-7 (Tsujibo et al., 1994) and is supposed to exhibit N-acetyl-β-d-glucosaminidase activity. To elucidate the biological roles of the DasD protein, we produced and characterized a recombinant DasD protein. We additionally obtained a dasD-null mutant and analyzed its chitin-degradation activity, to genetically characterize the biological role.

Materials and methods

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results and discussion
  6. Acknowledgements
  7. References

Bacterial strains, plasmids, and media

Streptomyces coelicolor A3(2) strain M145 (Kieser et al., 2000) and its dasA mutant ASC2 (Saito et al., 2007) were used. Escherichia coli JM109 (Yanisch-Perron et al., 1985) was used as the host for gene manipulation. Escherichia coli ET12567 (dam dcm hsdS) (MacNeil et al., 1992) was used to prepare plasmids for S. coelicolor A3(2) transformation, to avoid the methylation-specific restriction system of the bacterium. Escherichia coli BL21(DE3)(Novagen) was used to overproduce DasD protein. Plasmid vectors used are listed in Table 1. Luria–Bertani (LB) medium (Sambrook & Russell, 2001) was used to culture S. coelicolor A3(2); E. coli transformants were grown in LB medium supplemented with 50 μg mL−1 ampicillin or 10 μg mL−1 gentamicin. A minimal medium [10 mM K2HPO4, 10 mM KH2PO4, 1 mM CaCl2, 0.5 mM MgCl2 supplemented with 0.1% (v/v) trace element solution] (Schlochtermeier et al., 1992) was used to investigate the responses of S. coelicolor A3(2) cells to various carbon sources. Soya flour – mannitol (SFM) agar medium (Kieser et al., 2000) was used to prepare spores of S. coelicolor A3(2) strains.

Table 1. Plasmids and primers used in this study
PLasmid vectors
NameDescriptionReference
pGEM-T EasyCloning vector for PCR products in Escherichia coliPromega (Madison, WI)
pGEX-4T-1Expression vector to overproduce recombinant proteins in Escherichia coliGE Healthcare UK Ltd (Buckinghamshire, UK)
pBlueScript SK+General cloning vector for Escherichia coliAlting-Mees & Short (1989)
pIJ2925pUC18-derived vector having BglII sites flanking modified multiple cloning sitesJanssen & Bibb (1993)
pAS100Derivative of the temperature-sensitive plasmid pGM160, whose HindIII fragment including the accC4 gene has been removedMuth et al. (1989) and Xiao et al. (2002)
Primers
NameSequence (5′-3′)Description
(i) For production of DasD
dasDBamHIfGGATCCATGACGACCCTCGCCAGBamHI site is attached (underlined).
dasDEcoRIrGAATTCTCAGACGCCCGCGATGGCCTCEcoRI site is attached (underlined)
(ii) For dasD disruption
dasDUfCTCGAGTCGTGCTCAAGCAAGAGGAGUsed to amplify the upstream region of dasD. XhoI and HindIII sites are attached, respectively (underlined)
dasDUrAAGCTTGTGACGTTGCGCCCGAACAG
dasDDfAAGCTTACACGGTCGTCGTCGAGATGUsed to amplify the downstream region of dasD. HindIII and EcoRI sites are attached, respectively (underlined)
dasDDrGAATTCCGTGGAAGTTGTCATCGTTC
TargetNameSequence (5′-3′)Product size (bp)Reference
(iii) For RT-PCR
dasD dasDRTfCGCGGGCGTCAACTTCAACTG444This study
dasDRTrGCGATGGCCTTCATCTCGATG
dasCD G4dasDRTfCTCGATGTTCGGCTTCATCAC663This study
G4dasDRTrGTTGTCCGGGTTGGAGTTCAC
chiC chiCRTfACATGCGCTTCAGACACAAAG533Saito et al. (2007)
chiCRTrCAGGACGTCGTAGTTCTTGAC
hrdB RThrdBfAAGGAAGACGGCGAGCTTCTC431Saito et al. (2007)
RThrdBrATGAGGTCCAGGAAGAGCATG

Manipulation of DNA

Plasmid preparation and restriction enzyme digestion were carried out as described by Sambrook & Russell (2001). DNA fragments were ligated using a DNA ligation kit (Takara Bio, Shiga, Japan) according to the manufacturer's instructions.

Production and purification of the recombinant DasD protein

The whole dasD gene was amplified by PCR using a primer set (dasDBamHIf and dasDEcoRIr. See Table 1) and cloned into the plasmid pGEM-T Easy (Table 1). After asserting the nucleotide sequence of the cloned gene, the BamHI-EcoRI fragment was integrated into the corresponding sites of the expression plasmid vector pGEX-4T-1 (Table 1) to obtain the plasmid pGEX-4T-1dasD. Escherichia coli BL21(DE3) carrying the constructed plasmid was cultivated in LB containing 100 μg mL−1 ampicillin. DasD production was induced by adding 1 mM IPTG to the culture. Escherichia coli cells were harvested by centrifugation and disrupted by sonication on ice. The cytoplasmically soluble fraction, which was obtained by centrifugation, was subjected to Glutathione Sepharose 4B to purify the GST-fused DasD protein, by following the manufacturer's instructions. To remove the GST tag, the recombinant DasD protein was treated with thrombin and subjected to an anion-exchange column (Resource Q, GE Healthcare). DasD protein without the GST tag was eluted by NaCl gradient (0–1 M) in 20 mM Tris-HCl buffer (pH 8.5). Purified DasD protein was subjected to anti-serum preparation as well as to enzymatic and biochemical characterization.

Protein analysis

Proteins were separated on 12.5% polyacrylamide gels containing 0.1% sodium dodecyl sulfate (SDS) (Laemmli, 1970) and were visualized by staining SDS-polyacrylamide gels (SDS-PAGs) with Coomassie Brilliant Blue (CBB) R-250. For immuno-blot analysis, proteins separated on an SDS-PAG were blotted onto a polyvinylidene difluoride membrane (Immobilon-P; Millipore). Anti-DasD antiserum was prepared by injecting the purified recombinant DasD protein into a rabbit. Anti-DasA and anti-MsiK antisera were prepared as described previously (Saito et al., 2007, 2008).

Enzymatic analysis

To investigate the enzymatic activity of DasD, the purified DasD protein was incubated with 30 μM 4-methylumbelliferyl-N-acetyl-β-d-glucosamine (4MU-GlcNAc) or 4-methylumbelliferyl-N-acetyl-β-d-galactosamine (4MU-GalNAc) (Sigma, St. Louis, MO), and the activity was evaluated by measuring the concentration of liberated 4-methylumbelliferone (4-MU) based on its fluorescence. 50 mM Tris-HCl (pH 6.8) was routinely used, unless otherwise mentioned. To investigate the cleavage activity of DasD against (GlcNAc)2, (GlcNAc)3, and (GlcNAc)4, the purified DasD protein was incubated with 1.25 mg mL−1 of the di-, tri-, and tetra-saccharides and applied to a silica gel-60 plate (Merck), which was then developed four times with a 2 : 1 (by volume) mixture of 1-propanol/ammonia water. The spots were visualized by heating the plate with sulfuric acid. Chitinase activity was measured using 4-methylumbelliferyl-N,N′-diacetylchitobioside (Sigma, St. Louis, MO) according to a previously described method (Miyashita et al., 1991). One unit of chitinase activity was defined as the amount of enzyme that liberated 1 μmol of 4-MU from the substrate in 1 min at 37 °C.

Disruption of the dasD gene

Regions (approximately 1 kb) upstream and downstream of the dasD (SCO5235) gene were amplified by PCR using specific primers that we designed (Table 1). The products were cloned into pGEM-T Easy (Table 1), and the sequences of the cloned fragments were confirmed to be identical to those registered in the genome database (http://www.sanger.ac.uk/Projects/S_coelicolor/). The fragment corresponding to the dasD downstream region was isolated with HindIII and EcoRI and cloned into the corresponding sites of pBlueScript SK+ (Table 1) to obtain the plasmid pDDD03. The HindIII-XhoI fragment of the dasD upstream region was then inserted into pDDD03 to obtain pDDD04. The HindIII fragment of the aacC4 gene cassette (Blondelet-Rouault et al., 1997) was integrated into the corresponding site on pDDD04. A plasmid clone in which the aacC4 gene was oriented opposite to the residual dasD gene was selected and named pDDD06. pDDD06 was digested with XhoI and PstI, and the fragment containing the upstream and downstream fragments of dasD and the aacC4 gene cassette was inserted into the SalI–PstI-digested pIJ2925 (Table 1) to obtain pDDD07. The BglII fragment of pDDD07, which includes the entire XhoI–PstI fragment, was inserted into the BamHI site of the temperature-sensitive plasmid vector pAS100 (Table 1) to obtain the dasD-disruption plasmid pDDD08. Streptomyces coelicolor A3(2) M145 was transformed with pDDD08, which was prepared from E. coli ET12567, according to the method described by Kieser et al. (2000). After obtaining thiostrepton-resistant transformants at 30 °C, we selected strains that grew at 39 °C on SFM agar medium supplemented with 5 μg mL−1 gentamicin. After streaking the obtained colonies on SFM agar medium containing gentamicin and culturing at 30 °C, we obtained strains that were resistant to gentamicin but sensitive to thiostrepton. Disruption of dasD was verified by Southern blot analysis, using the labeled dasD and aacC4 genes as probes.

Growth conditions for S. coelicolor A3(2) M145 and its derivatives

To investigate cell response to various sugars, we cultivated S. coelicolor A3(2) strains according to a method described previously (Saito et al., 2000), with some modifications. Spores formed on SFM agar medium were inoculated into 30 mL LB medium in a 100-mL flask with a spring (Kieser et al., 2000) and grown for 18–20 h at 30 °C on a rotary shaker at 150 rpm. Mycelia were harvested by centrifugation (1000 g, 3 min), washed with minimal medium without carbon sources, suspended in 60 mL minimal medium, and divided into several aliquots. Each aliquot was supplemented with a different carbon source: 250 μM (GlcNAc)2 and 0.05%(w/v) colloidal chitin, colloidal chitosan, cellulose nanofiber, or xylan powder. After sugar supplementation, cultures were again grown at 30 °C on a rotary shaker at 150 rpm. The culture fluids were sampled periodically, centrifuged to separate the supernatant and mycelia, and stored at −80 °C. The sugar concentration and chitinase activity of the supernatants were measured, whereas the mycelia were used for protein analysis, GlcNAcase assay, or total RNA preparation.

Reverse transcription (RT)-PCR

DNA-free total RNA was prepared from S. coelicolor A3(2) mycelia following the method of Saito et al. (2007), using an SV Total RNA Isolation System (Promega). To characterize transcripts, RT-PCR analysis was carried out using a PrimeScript RT-PCR Kit (Takara Bio Inc., Otsu, Japan). A primer set specific for the dasD gene transcript was designed (Table 1). Transcripts of the chitinase gene chiC were also investigated for comparison. For PCR, the number of cycles was set to 25 to avoid saturation.

Determination of (GlcNAc)2 concentration

To measure the concentrations of (GlcNAc)2, culture supernatant obtained by centrifugation was subjected to an HPLC with a refractive index detector RID-6A (Shimadzu, Kyoto, Japan) using a normal phase column Inertsil-NH2 (4.6 × 250 mm, GL Science Inc., Tokyo, Japan). (GlcNAc)2 was separated under isocratic conditions 85% (v/v) acetonitrile in water at a flow rate of 1.0 mL min−1 and identified by the retention time.

Results and discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results and discussion
  6. Acknowledgements
  7. References

DasD exhibits N-acetyl-β-d-glucosaminidase activity

DasD fused with GST at the C-terminus was successfully produced in the cytoplasmic fraction of E. coli in a soluble form. The purified recombinant DasD protein without the GST tag appeared to be homogeneous in an SDS-PAGE analysis (Fig. 1a). The purified DasD protein showed hydrolytic activity against 4MU-β-d-GlcNAc, whereas it did not against 4MU-β-d-GalNAc (Fig. 1b). The result suggests that DasD acts as N-acetyl-β-d-glucosaminidase β-d-GlcNAcase) (EC 3.2.1.30) or chitobiase (EC 3.2.1.19), but not as N-acetyl-β-d-hexosaminidase (EC 3.2.1.52). DasD liberated GlcNAc residue not only from (GlcNAc)2 but from (GlcNAc)3 and (GlcNAc)4 (Fig. 1c). It was thus demonstrated that DasD is a β-d-GlcNAcase. The purified DasD protein showed the highest hydrolyzing activity against 4MU-β-d-GlcNAc at pH 7 and at 40 °C (Fig. 1d ane e).

image

Figure 1. Characterization of the DasD protein. (a) Purified recombinant DasD protein without GST tag analyzed by SDS-PAGE. The sizes of the protein markers are indicated. The gel was stained with Coomassie Brilliant Blue R-250. (b) Release of 4-MU by the DasD protein from the synthetic substrate 4MU-β-d-GlcNAc (circles) and 4MU-β-d-GalNAc (triangles). pH 6.8, 37 °C. (c) TLC analysis of (GlcNAc)2 (G2), (GlcNAc)3 (G3), and (GlcNAc)4 (G4) which was incubated overnight at 37 °C with or without DasD. S, standards; G1, GlcNAc. (d) Effect of pH on enzymatic activity of DasD against 4MU-β-d-GlcNAc. 50 mM sodium phosphate and glycine-NaOH buffers were used for pH 4–9 and 9–12, respectively. The activity at 40 °C was set to 100%. (e) Effect of temperature on enzymatic activity of DasD against 4MU-β-d-GlcNAc. The activity at pH 7 was set to 100%. In b, d, and e, average values of at least two independent measurements are plotted. Error bars show the standard deviation of the data.

Download figure to PowerPoint

DasD is a cytoplasmic protein whose gene expression is induced by chitin

To investigate the localization of DasD, the mycelia of S. coelicolor A3(2), which were grown a liquid minimal medium supplemented with colloidal chitin, were disrupted by sonication and separated into cytoplasmic and envelope fractions using ultra centrifugation (100 000 g, 1 h, 4 °C). The MsiK protein, which is an ATP-binding component of ABC sugar transporters (Saito et al., 2008), was expectedly detected in the envelope fraction. In contrast, the DasD protein was detected in the cytoplasmic fraction. DasD composed of 496 amino acids (aa) shares 46% identical aa sequence with the GlcNAcase NagA (632 aa) of S. thermoviolaceus (Tsujibo et al., 1998), in 262 aa overlapping. NagA is the unique GH3 GlcNAcase from streptomycetes, which has been experimentally characterized so far, and is likely secreted via its N-terminal signal peptide (Tsujibo et al., 1998). In contrast, DasD does not possess an N-terminal hydrophobic amino acid sequence which would act as a Sec- or Tat-dependent signal peptide. Additionally, GlcNAcase activity was not detected in the culture supernatant of S. coelicolor A3(2), using 4MU-β-d-GlcNAc as a substrate (Saito et al., 2007). We, thus, concluded that DasD is a cytoplasmic protein.

Transcripts of the dasD gene were detected in the presence of colloidal chitin, slightly in the presence of colloidal chitosan, but hardly detected with cellulose nanofiber or xylan powder (Fig. 2b). dasD was also induced by (GlcNAc)2 or (GlcNAc)3, but not by GlcNAc (Fig. 2c), as observed in some chitinase genes and the dasR and dasA genes (Saito et al., 2000, 2007). The polycistronic transcripts of dasCD were detected by RT-PCR analysis (Fig. 2d). The data suggested that the dasD gene was transcribed together with dasC, whose polycistronic transcripts with dasB were observed (Saito et al., 2007). It is thus assumed that dasB, dasC, and dasD were transcribed together as one polycistronic unit. We recently indicated that the dasR disruption upregulated the transcription of dasB, dasC, and dasD in the presence of chitin (Nazari et al., 2013), suggesting that DasR might act as a transcriptional repressor for the dasBCD transcription.

image

Figure 2. (a) Immuno-blot analysis of the DasD protein in Streptomyces coelicolor A3(2) M145. The mycelia grown in the presence of colloidal chitin were disrupted by sonication, divided into cytoplasmic (Cyt) and envelope (Env) fractions by ultracentrifugation, and subjected to immuno-blot analysis using the anti-DasD and anti-MsiK antisera. (b and c) RT-PCR analysis of the dasD transcripts in S. coelicolor A3(2) M145 in the presence of a series of polysaccharides (b) and chitin-degradation products (c). Mycelia grown in Luria-Bertani (LB) medium were suspended in minimal medium (MM) supplemented with 0.01% (w/v) of colloidal chitin (Chitin), colloidal chitosan (Chitosan), cellulose nanofiber (Cellulose), or xylan powder (Xylan), or 250 μM GlcNAc, (GlcNAc)2, or (GlcNAc)3. Mycelia were harvested at 4 h (b) or 2 h (c) and disrupted for RNA preparation. DNA-free total RNAs (25 μg) were subjected to RT-PCR. Size markers are indicated (in bp). The transcripts of the chitinase C gene (chiC) and the major sigma factor gene hrdB were also analyzed for comparison. (d) RT-PCR analysis of the dasC-D transcripts in the presence of colloidal chitin. Size markers are indicated (in bp). The dasD transcripts are shown for comparison. See the legend of the panel C for detailed experimental conditions. (e) Production of the DasD and DasA proteins in the wild type (WT), the dasD-null mutant (ΔdasD), and the dasA-null mutant (ΔdasA) strains of S. coelicolor A3(2). Mycelia of each strain grown in the presence of colloidal chitin were disrupted by sonication and subjected to immuno-blot analysis using anti-DasD and anti-DasA antisera.

Download figure to PowerPoint

DasD is not likely the main GlcNAcase in S. coelicolor A3(2)

To investigate the biological role of DasD by a genetic approach, we disrupted the dasD gene and obtained the dasD-null mutant MRC8. A cell-free extract of the dasD mutant, which was grown in the presence of colloidal chitin, still exhibited cleavage activity against 4MU-β-d-GlcNAc, which was comparable with the parent strain M145 (data not shown). The data suggest that S. coelicolor A3(2) possesses other protein(s) exhibiting GlcNAcase activity. Three genes (SCO2758, SCO2786, SCO2943) have been predicted to encode proteins possessing GlcNAcase activity (Świątek et al., 2012). Among them, SCO2758 encodes a protein whose aa sequence exhibits striking similarity with that of the intracellular GH20 GlcNAcase NagC of S. thermoviolaseus (Kubota et al., 2004); 69% identity and 87% similarity in 563 aa overlapping. Main GlcNAcases must remain to be elucidated in S. coelicolor A3(2).

dasD mutation enhances the chitinase production in S. coelicolor A3(2)

(GlcNAc)2, which could be a substrate for the DasD protein, is a minimum unit that induces chitinase production in S. coelicolor A3(2) (Saito et al., 2000). We elucidated the chitin-degradation activity in the dasD-null mutant, because dasD disruption would affect the (GlcNAc)2 consumption rate. The dasD mutant formed a larger and clearer clearing zone, than its parent strain M145, around its colony on the minimal agar medium containing colloidal chitin as a carbon source (Fig. 3a), suggesting that the dasD mutation enhanced the induction level of chitinase production. The dasD mutant showed higher chitinase activity in the presence of colloidal chitin or (GlcNAc)2 than strain M145 (Fig. 3b and c). It was thus concluded that the dasD disruption increased the level of chitinase production in the presence of an inducer (GlcNAc)2 or colloidal chitin. In the presence of colloidal chitin, (GlcNAc)2 temporarily accumulated in the culture supernatant of the dasD mutant, but it was not detected in that of the parent strain M145 (Fig. 3d).

image

Figure 3. (a). Growth of the wild type (WT), the dasA-null mutant (ΔdasA), and the dasD-null mutant (ΔdasD) strains of Streptomyces coelicolor A3(2) on minimal agar medium containing colloidal chitin as a carbon source. The strains were cultivated for 14 days at 30 °C. (b) and (c). Chitinase activity in the wild type (WT, open circles), the dasA-null mutant (ΔdasA, triangles), and the dasD-null mutant (ΔdasD, closed circles) strains of S. coelicolor A3(2). At zero, mycelia grown in Luria-Bertani (LB) medium were suspended in minimal medium (MM) supplemented with 0.12% (w/v) colloidal chitin (b) or 250 μM (GlcNAc)2 (c). (d) (GlcNAc)2 concentration in the culture supernatant of the wild type (WT, open circles), the dasA-null mutant (ΔdasA, triangles), and the dasD-null mutant (ΔdasD, closed circles) strains of S. coelicolor A3(2). Mycelia grown in Luria-Bertani (LB) medium were suspended in minimal medium (MM) supplemented with 0.12% (w/v) colloidal chitin was added at day zero. In b, c, and d, average values of at least two independent measurements are plotted. Error bars show the standard deviation of the data.

Download figure to PowerPoint

Chitinase activity in the dasA mutant was also higher than that in the parent strain M145, as reported previously (Saito et al., 2007; Colson et al., 2008) and was much higher than that in the dasD mutant (Fig. 3a–c). The temporal accumulation level of (GlcNAc)2 was higher in the dasA mutant than in the dasD mutant (Fig. 3d). It has been reported that the (GlcNAc)2-consumption rate of the dasA mutant was about 40% of the parent strain (Saito et al., 2007). Immuno-blot analysis revealed that DasA was produced in the dasD mutant, but the amount of DasA was apparently lower than in the parent strain M145 (Fig. 2e). The lowered production of DasA in the dasD mutant may decrease the (GlcNAc)2-consumption rate and enhance chitinase production. It remains to be elucidated why DasA production was lowered by the dasD mutation.

GlcNAc is an important signaling molecule for streptomycetes and a major decision point toward the onset of development and antibiotic production (Rigali et al., 2006, 2008). In the dasD-null mutant, pigmentation was apparently enhanced in the liquid minimal medium supplemented with colloidal chitin (A. Saito, T. Fujii & K. Miyashita, unpublished data). Although DasD was unlikely the main enzyme cleaving (GlcNAc)2, DasD might be involved in controlling the intracellular GlcNAc/(GlcNAc)2 concentration. Streptomyces coelicolor A3(2) and probably other streptomycetes should have an elaborated chitin-assimilation system which can adjust the intracellular GlcNAc concentration to regulate primary and secondary metabolism.

Acknowledgements

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results and discussion
  6. Acknowledgements
  7. References

This work was partly supported by JSPS KAKENHI Grant Numbers 21380050 and 17780056, and by a grant from the Strategic Research Foundation Grant-aided Project for Private Universities from Ministry of Education, Culture, Sport, Science and Technology, Japan (MEXT), 2010-2014 (S1001032). The authors thank Shinsuke Ifuku at Tottori University and Ayano Masui at Yaizu Suisankagaku Industry for providing cellulose nanofiber and N,N′-diacetylchitobiose, respectively.

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results and discussion
  6. Acknowledgements
  7. References
  • Alting-Mees MA & Short JM (1989) pBluescript II: gene mapping vectors. Nucleic Acids Res 17: 9494.
  • Blaak H, Schnellmann J, Walter S, Henrissat B & Schrempf H (1993) Characteristics of an exochitinase from Streptomyces olivaceoviridis, its corresponding gene, putative protein domains and relationship to other chitinases. Eur J Biochem 214: 659669.
  • Blondelet-Rouault MH, Weiser J, Lebrihi A, Branny P & Pernodet JL (1997) Antibiotic resistance gene cassettes derived from the omega interposon for use in E. coli and Streptomyces. Gene 190: 315317.
  • Colson S, van Wezel GP, Craig M, Noens EEE, Nothaft H, Mommaas AM, Titgemeyer F, Joris B & Rigali S (2008) The chitobiose-binding protein, DasA, acts as a link between chitin utilization and morphogenesis in Streptomyces coelicolor A3(2). Microbiology 154: 373382.
  • Fujii T & Miyashita K (1993) Multiple domain structure in a chitinase gene (chiC) of Streptomyces lividans. J Gen Microbiol 139: 677686.
  • Janssen GR & Bibb MJ (1993) Derivatives of pUC18 that have BglII sites flanking a modified multiple cloning site and that retain the ability to identify recombinant clones by visual screening of Escherichia coli colonies. Gene 124: 133134.
  • Kawase T, Kanai R, Ohno T, Tanabe T, Nikaidou N, Miyashita K, Mitsutomi M & Watanabe T (2001) Identification of three family 18 chitinase genes of Streptomyces griseus HUT6037. Chitin Chitosan Res 7: 241251.
  • Kawase T, Yokoyama S, Saito A, Fujii T, Nikaidou N, Miyashita K & Watanabe T (2006) Comparison of the enzymatic and antifungal properties between family 18 and 19 chitinases from Streptomyces coelicolor A3(2). Biosci Biotechnol Biochem 70: 988998.
  • Kieser T, Bibb MJ, Buttner MJ, Chater KF & Hopwood DA (2000) Practical Streptomyces Genetics. John Innes Foundation, Norwich.
  • Kubota T, Miyamoto K, Yasuda M, Inamori Y & Tsujibo H (2004) Molecular characterization of an intracellular β-N-acetylglucosaminidase involved in the chitin degradation system of Streptomyces thermoviolaceus OPC-520. Biosci Biotechnol Biochem 68: 13061314.
  • Laemmli UK (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227: 680685.
  • Li H, Plattner H, Schmz K-L, Kieß M, Diekmann H & Meens J (2000) Cloning, sequencing and heterologous expression of a new chitinase gene, chi92, from Streptomyces olivaceoviridis ATCC 11238. Biotechnol Lett 22: 12031209.
  • MacNeil DJ, Gewain KM, Ruby CL, Dezeny G, Gibbons PH & MacNeil T (1992) Analysis of Streptomyces avermitilis genes required for avermectin biosynthesis utilizing a novel integration vector. Gene 111: 6168.
  • Mark BL, Wasney GA, Salo TJS, Khan AR, Cao Z, Robbins PW, James MNG & Triggs-Raine BL (1998) Structural and functional characterization of Streptomyces plicatus β-N-acetylhexosaminidase by comparative molecular modeling and site-directed mutagenesis. J Biol Chem 273: 1961819624.
  • Miyashita K & Fujii T (1993) Nucleotide sequence and analysis of a gene (chiA) for chitinase from Streptomyces lividans 66. Biosci Biotechnol Biochem 57: 16911698.
  • Miyashita K, Fujii T & Sawada Y (1991) Molecular cloning and characterization of chitinase genes from Streptomyces lividans 66. J Gen Microbiol 137: 20652072.
  • Miyashita K, Fujii T, Watanabe A & Ueno H (1997) Nucleotide sequence and expression of a gene (chiB) for a chitinase from Streptomyces lividans. J Ferment Bioeng 83: 2631.
  • Muth G, Nußbaumer B, Wohlleben W & Pühler A (1989) A vector system with temperature-sensitive replication for gene disruption and mutational cloning in streptomycetes. Mol Gen Genet 219: 341348.
  • Nazari B, Kobayashi M, Saito A, Hassaninasab A, Miyashita K & Fujii T (2013) Chitin-induced gene expression involved in secondary metabolic pathways in Streptomyces coelicolor A3(2) grown in soil. Appl Environ Microbiol 79: 707713.
  • Nothaft H, Rigali S, Boomsma B, Swiatek M, McDowall KJ, van Wezel GP & Titgemayer F (2010) The permease gene nagE2 is the key to N-acetylglucosamine sensing and utilization in Streptomyces coelicolor and is subject to multi-level control. Mol Microbiol 75: 11331144.
  • Ohno T, Armand S, Hata T, Nikaidou N, Henrissat B, Mitsutomi M & Watanabe T (1996) A modular family 19 chitinase found in the prokaryotic organism Streptomyces griseus HUT 6037. J Bacteriol 178: 50655070.
  • Rigali S, Nothaft H, Noens EEE et al. (2006) The sugar phosphotransferase system of Streptomyces coelicolor is regulated by the GntR-family regulator DasR and links N-acetylglucosamine metabolism to the control of development. Mol Microbiol 61: 12371251.
  • Rigali S, Titgemeyer F, Barends S, Mulder S, Thomae AW, Hopwood DA & van Wezel GP (2008) Feast or famine: the global regulator DasR links nutrient stress to antibiotic production by Streptomyces. EMBO Rep 9: 670675.
  • Robbins PW, Albright C & Benfield B (1988) Cloning and expression of a Streptomyces licatus chitinase (chitinase-63) in Escherichia coli. J Biol Chem 263: 443447.
  • Saito A & Schrempf H (2004) Mutational analysis of the binding affinity and transport activity for N-acetylglucosamine mediated by the novel ABC transporter Ngc within the chitin-degrader Streptomyces olivaceoviridis. Mol Genet Genomics 271: 545553.
  • Saito A, Fujii T, Yoneyama T, Redenbach M, Ohno T, Watanabe T & Miyashita K (1999) High-multiplicity of chitinase genes in Streptomyces coelicolor A3(2). Biosci Biotechnol Biochem 62: 701709.
  • Saito A, Ishizaka M, Francisco PB Jr, Fujii T & Miyashita K (2000) Transcriptional co-regulation of five chitinase genes scattered on the Streptomyces coelicolor A3(2) chromosome. Microbiology 146: 29372946.
  • Saito A, Fujii T & Miyashita K (2003) Distribution and evolution of chitinase genes in Streptomyces species: involvement of gene-duplication and domain-deletion. Anton van Leeuwen 84: 715.
  • Saito A, Shinya T, Miyamoto K et al. (2007) The dasABC gene cluster, adjacent to dasR, encodes a novel ABC transporter for the uptake of N, N′-diacetylchitobiose in Streptomyces coelicolor A3(2). Appl Environ Microbiol 73: 30003008.
  • Saito A, Fujii T, Shinya T, Shibuya N, Ando A & Miyashita K (2008) The msiK gene, encoding the ATP-hydrolyzing component of N,N′-diacetylchitobiose ABC transporters, is essential for induction of chitinase production in Streptomyces coelicolor A3(2). Microbiology 154: 33583365.
  • Sambrook J & Russell DW (2001) Molecular Cloning: A Laboratory Manual, 3rd edn. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY.
  • Schlochtermeier A, Walter S, Schröder J, Moorman M & Schrempf H (1992) The gene encoding the cellulase (Avicelase) cel1 from Streptomyces reticuli and analysis of protein domains. Mol Microbiol 6: 36113621.
  • Świątek MA, Tenconi E, Rigali S & van Wezel GP (2012) Functional analysis of the N-acetylglucosamine metabolic genes of Streptomyces coelicolor and role in control of development and antibiotic production. J Bacteriol 194: 11361144.
  • Tsujibo H, Endo H, Minoura K, Miyamoto K & Inamori Y (1993) Cloning and sequence analysis of the gene encoding a thermostable chitinase from Streptomyces thermoviolaceus OPC-520. Gene 134: 113117.
  • Tsujibo H, Fujimoto K, Tanno H, Miyamoto K, Imada C, Okami Y & Inamori Y (1994) Gene sequence, purification and characterization of N-acetyl-beta-glucosaminidase from a marine bacterium, Alteromonas sp. strain O-7. Gene 146: 111115.
  • Tsujibo H, Hatano N, Mikami T, Hrasawa A, Miyamoto K & Inamori Y (1998) A novel β-N-acetylglucosaminidase from Streptomyces thermoviolaceus OPC-520: gene cloning, expression, and assignment to family 3 of the glycosyl hydrolases. Appl Environ Microbiol 64: 29202924.
  • Tsujibo H, Hatano N, Endo H, Miyamoto K & Inamori Y (2000a) Purification and characterization of a thermostable chitinase from Streptomyces thermoviolaceus OPC-520 and cloning of the encoding gene. Biosci Biotechnol Biochem 64: 96102.
  • Tsujibo H, Okamoto T, Hatano N, Miyamoto K, Watanabe T, Mitsutomi M & Inamori Y (2000b) Family 19 chitinases from Streptomyces thermoviolaceus OPC-520: molecular cloning and characterization. Biosci Biotechnol Biochem 64: 24452453.
  • Wang F, Xiao X, Saito A & Schrempf H (2002) Streptomyces olivaceoviridis possesses a phosphotransferase system that mediates specific, phosphoenolpyruvate-dependent uptake of N-acetylglucosamine. Mol Genet Genomics 268: 344351.
  • Xiao X, Wang F, Saito A, Majaka J, Schlösser A & Schrempf H (2002) The novel Streptomyces olivaceoviridis ABC transporter Ngc mediates uptake of N-acetylglucosamine and N, N′-diacetylchitobiose. Mol Genet Genomics 267: 429439.
  • Yanisch-Perron C, Vieira J & Messing J (1985) Improved M13 phage cloning vectors and host strains: nucleotide sequences of the M13mp18 and pUC19 vectors. Gene 33: 103119.