SEARCH

SEARCH BY CITATION

Keywords:

  • mobile genetic element;
  • zinc transport;
  • adcR operon;
  • peptidoglycan synthesis;
  • polyamine transport

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results and discussion
  6. Acknowledgements
  7. References
  8. Supporting Information

The prevalence of the insertion sequence IS1548 is strongly linked to clonal complex 19 Streptococcus agalactiae strains associated with neonatal meningitis and endocarditis. We previously reported that IS1548 insertion upstream of lmb is involved in stronger binding of a S. agalactiae meningitic strain to laminin. A few other IS1548 insertion sites were also identified by others. In this study, we analyzed IS1548 described target sites in Sagalactiae and showed that most of them are linked to zinc-responsive genes. Moreover, we identified two not yet described IS1548 insertion sites in the adcRCB operon encoding the main regulator of zinc homeostasis and subunits of a zinc ABC transporter. We also identified two conserved motifs of 8 and 10 bp close to IS1548 insertion sites. These motifs representing potential IS1548 targets were found upstream of several S. agalactiae ORFs. One of these predicted IS1548 targets was validated experimentally, allowing the identification of an IS1548 insertion site upstream of murB in all of the clonal complex 19 strains tested. The possible effects of these insertions on the virulence of the strains are discussed.


Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results and discussion
  6. Acknowledgements
  7. References
  8. Supporting Information

Streptococcus agalactiae is the main etiological agent of neonatal infectious diseases. It has also emerged in various infections in nonpregnant adults, such as endocarditis (Spellerberg, 2000; Farley, 2001). The genome of S. agalactiae harbors several mobile genetic elements including the group II intron GBSi1 and a few insertion sequences (IS) among which are IS1548, IS861, IS1381, and ISSa4 (Héry-Arnaud et al., 2005). We previously showed that the prevalence of these mobile genetic elements is linked to the phylogenetic classification of S. agalactiae. In particular, the presence of IS1548 strongly correlates with clonal complex (CC) 19 strains (Héry-Arnaud et al., 2005).

IS1548, a 1317-bp-element carrying terminal inverted repeats of 19 bp, is present in S. agalactiae and other Streptococcus species including S. pyogenes (Granlund et al., 1998). IS1548 belongs to the ISAS1 family, which includes several other IS and the ‘H-repeats’ that form part of some Escherichia coli rearrangement hot spot elements (Rhs). As with some other members of this family, IS1548 has been found to be associated with cell surface component genes (Chandler & Mahillon, 2002).

Among the S. agalactiae strains whose whole-genome sequence is available, one of them, 2603V/R, belongs to the CC19 (Tettelin et al., 2002; Haguenoer et al., 2011). We analyzed the published genome sequence of strain 2603V/R and found the presence of six IS1548 copies. Four of them are located in intergenic regions: (1) between glmS (sag0944) and phnA (sag0946) encoding a glucosamine–fructose-6-phosphate aminotransferase and a zinc-ribbon-containing protein involved in phosphonate metabolism, respectively; (2) between engA (sag1620) and sag1618 encoding a GTP-binding protein and a Snf2 family protein, respectively; (3) between clpP (sag1585) encoding an ATP-dependent Clp protease and the sag1577-sag1583 operon encoding a branched-chain amino acid ABC transporter; and (4) between ppc (sag0759) encoding a phosphoenolpyruvate carboxylase and the gene sag0761 encoding the cell cycle protein FtsW. The last two IS1548 copies of strain 2603V/R are integrated between sag0194 and sag0196, and between sag0692 and sag0694. blast searches in the sequenced genomes of S. agalactiae strains indicated that sag0194/sag0196 and sag0692/sag0694 are the 5′- and 3′-terminal parts of two IS1548-interrupted genes encoding a transcription antiterminator of the BglG family and a fructose-specific IIBC component of a PTS system, respectively (M. Fléchard, unpublished data).

In other clinical isolates of S. agalactiae, IS1548 has also been found in hylB, encoding a secreted hyaluronidase, particularly in strains isolated from human endocarditis cases, and in the cpsD gene belonging to the capsular gene cluster (Granlund et al., 1998; Sellin et al., 2000). Moreover, in numerous endocarditic and meningitic strains, IS1548 integrates between the C5a-peptidase and the laminin-binding protein Lmb genes, which represents the ‘X’ preferential insertion site (Granlund et al., 1998; Al Safadi et al., 2010). In a few cases, the consequences of IS1548 insertions have been determined. IS1548 insertion in the virulence genes hylB or cpsD leads to their inactivation, resulting in strains unable to produce the secreted hyaluronidase or defective for capsule production, respectively (Granlund et al., 1998; Sellin et al., 2000). Moreover, we previously showed that IS1548 integration upstream of the putative lmb-phtD operon in a strain responsible for a neonatal meningitis case leads to an increased expression of Lmb, resulting in stronger binding of the strain to laminin (Al Safadi et al., 2010). These results suggest that IS1548 could modulate the virulence of S. agalactiae.

To better understand the influence of IS1548 on the virulence of S. agalactiae, we carried out a comparative analysis of the already known IS1548 insertion sites in CC19 strains with the aim of identifying putative common functional features of the neighboring genes and conserved motifs close to the integration sites. These data were used to predict several potential not yet identified insertion targets, which we tested experimentally on two chosen candidates.

Materials and methods

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results and discussion
  6. Acknowledgements
  7. References
  8. Supporting Information

Bacterial strains and growth conditions

Sixteen strains coming from a collection of 277 epidemiologically unrelated human isolates of S. agalactiae, and previously shown to harbor the insertion sequence IS1548 between scpB and lmb, were analyzed in this study (Table 1) (Quentin et al., 1995; Al Safadi et al., 2010). Streptococcus agalactiae strains were grown on chocolate agar + PolyViteX (PVX) plates (AES®) at 37 °C. Cells were then grown overnight in brain–heart infusion (BHI) broth, harvested, inoculated in BHI broth at an OD595 nm of 0.05, and grown with agitation to OD595 nm of 1.8.

Table 1. Strains used in this study
S. agalactiae strainsSequence typeClonal complexSerotypeOrigin
L91919IIICerebrospinal fluid of a neonate suffering from meningitis
L101919IIICerebrospinal fluid of a neonate suffering from meningitis
L141919IIICerebrospinal fluid of a neonate suffering from meningitis
L221919IIICerebrospinal fluid of a neonate suffering from meningitis
L291919IIICerebrospinal fluid of a neonate suffering from meningitis
L3119319IIICerebrospinal fluid of a neonate suffering from meningitis
L341919IIICerebrospinal fluid of a neonate suffering from meningitis
L351919IIICerebrospinal fluid of a neonate suffering from meningitis
L361919IIICerebrospinal fluid of a neonate suffering from meningitis
L3816419IIICerebrospinal fluid of a neonate suffering from meningitis
L554419IIICerebrospinal fluid of a neonate suffering from meningitis
G417810IIGastric fluid of an asymptomatic neonate
G47407SingletonIIGastric fluid of an asymptomatic neonate
G8246SingletonIIIGastric fluid of an asymptomatic neonate
V881010IIVaginal swab of an asymtomatic pregnant woman
V105404SingletonIIIVaginal swab of an asymtomatic pregnant woman

DNA extraction and PCR analysis

Primers were designed with the computer programs Primer3 and NetPrimer (Rozen & Skaletsky, 2000; http://www.premierbiosoft.com/netprimer/index.html) and were chosen in regions conserved among all the S. agalactiae genome sequences available (Supporting Information, Table S1). Bacterial genomic DNA extracted and purified by the phenol–chloroform extraction method was used as the template for PCR assays (Sambrook et al., 1989). PCRs were performed with an Applied Biosystems 2720 apparatus, using 0.5 U Ampli Taq DNA polymerase from AB Roche® in a 20-μL 1X PCR buffer II containing 1.5 mM MgCl2, 200 μM of each deoxynucleoside triphosphate, 0.2 μM of each primer (Eurogentec®), and 50 ng of chromosomal DNA. Cycling conditions were as follows: 1 cycle of 5 min at 94 °C; 30 cycles of 30 s at 94 °C, 30 s at 58 °C, and 1 min per kb at 72 °C; and a final extension of 7 min at 72 °C. PCR products were separated in 1.5% agarose gels for 1 h at 10 V per cm of gel.

DNA sequencing

PCR products purified with the QIAquick Gel extraction kit (Qiagen®) were sequenced on both strands using the BigDye® Terminator v3.1 cycle sequencing kit from Applied Biosystems® and the ABI PRISM® 310 Genetic Analyzer. Forward and reverse sequences were aligned using the CAP3 Sequence Assembly Program (Huang & Madan, 1999).

Bioinformatic analysis

Sequences of the analyzed genes were retrieved from the database at http://www.ncbi.nlm.nih.gov/gene. Searches for homology between sequences were accomplished using the blastn program (http://www.ncbi.nlm.nih.gov/blast). Conserved motifs in sequences surrounding described IS1548 insertion sites were identified with the MEME software at http://meme.ebi.edu.au/meme/cgi-bin/meme.cgi (Bailey & Elkan, 1994) and then searched in the 5′-end and in the intergenic region upstream of S. agalactiae 2603V/R ORFs [database Streptococcus_agalactiae_2603_upstream] using the MAST software at http://meme.nbcr.net/meme/cgi-bin/mast.cgi (Bailey & Gribskov, 1998).

Nucleotide sequence accession number

Sequences reported in this article have been deposited in the EMBL database under accession numbers HF548337, HF548338, HF548339, HF548340, HF548341, HF548342, and HF548343.

Results and discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results and discussion
  6. Acknowledgements
  7. References
  8. Supporting Information

Most of the known IS1548 insertion sites in S. agalactiae are associated with potentially zinc-regulated genes

IS1548 insertion upstream of the putative lmb-phtD operon is responsible for an increased expression of the laminin-binding protein Lmb (Al Safadi et al., 2010). Lmb has also been characterized as a zinc-binding protein involved in zinc transport in other Streptococcus species (Linke et al., 2009; Weston et al., 2009; Bayle et al., 2011). Furthermore, the lipoprotein PhtD has been proposed to be a zinc scavenger in S. pneumoniae (Rioux et al., 2011). We thus hypothesized that IS1548 insertions could be linked to zinc homeostasis and investigated whether other IS1548 insertion sites could be associated with zinc-related genes.

Feng et al. reported that S. suis exposed to a high Zn2+ concentration or deleted from the zinc-responsive Zur regulator gene (SSU05_0310) modifies the expression of several of its genes (Feng et al., 2008). We thus searched the S. agalactiae 2603V/R genome for homologues of these genes (blastn searches) and found that four of them [glmS, sag1579, sag0197 (encoding a IIB subunit of a PTS transporter), and ftsW] are very close to IS1548 insertion sites previously described in S. agalactiae. With the site located upstream of lmb, five of the nine identified IS1548 insertion sites are thus very close to genes potentially linked to zinc homeostasis.

In most of the Streptococcus species, zinc homeostasis is also regulated by the transcriptional repressor AdcR (Brenot et al., 2007; Aranda et al., 2009; Reyes-Caballero et al., 2010). In S. agalactiae 2603V/R, adcR (sag0154) is found in a putative operon along with adcC and adcB encoding subunits of a putative high-affinity zinc ABC transporter. In the presence of high zinc concentrations, AdcR binds upstream of its own operon and a few other targets [genes encoding the laminin-binding protein Lmb, pneumococcal histidine triad (Pht) family proteins, or a ribosomal protein], which have been identified in S. pyogenes, S. suis, and S. pneumoniae (Brenot et al., 2007; Aranda et al., 2008, 2009; Reyes-Caballero et al., 2010). An AdcR-binding motif (TTAACNRGTTAA) has been predicted in silico and confirmed experimentally in S. suis (Aranda et al., 2008, 2009). We found that in the S. agalactiae strain 97-3, harboring the IS1548 preferential ‘X’ site (Dmitriev et al., 2004), twenty-three bases comprising AdcR-binding motifs are present between the IS and the lmb-phtD operon (ttaactggttaataactggttaa), which suggests an AdcR-dependent regulation of the lmb gene of S. agalactiae and again a link between IS1548 insertion sites and zinc homeostasis.

IS1548 inserts into the adcRCB operon

Because AdcR is a major regulator of zinc homeostasis in the Streptococcus genus, and on the grounds that we identified a putative link between IS1548 insertion and zinc homeostasis, we searched for the presence of IS1548 insertions in the adcRCB region of sixteen S. agalactiae strains previously identified to possess this IS (Table 1). To that aim, we sought to amplify by PCR putative downstream junctions between IS1548 and the adcRCB region using a forward primer in IS1548 (primer B, Fig. 1) and reverse primers (primers F, G, H, and I, Fig. 1) located at different positions on the operon (Table S1).

image

Figure 1. Schematic representation of IS1548 insertion sites into the adcRCB operon of Streptococcus agalactiae.

Download figure to PowerPoint

Sequencing of the amplified fragments allowed the identification of a new IS1548 insertion site 75 bp upstream of adcR in the V88 strain isolated from the vagina of a healthy carrier (site 1, Fig. 1; EMBL accession no. HF548338). Nevertheless, in the same strain culture, IS-carrying and IS-free ipk-adcR intergenic regions coexist as we could both amplify and sequence the IS1548-ipk and IS1548-adcR junctions (primers C/A and B/G) as well as the empty ipk-adcR intergenic region (primers C/D) (Fig. 1; EMBL accession nos. HF548337, HF548338, and HF548339). We identified another IS1548 insertion site in adcR in the L9 meningitic strain (site 2, Fig. 1). Again, in the same strain culture, IS-carrying and IS-free adcR genes coexist as we could both amplify and sequence the junction between IS1548 and adcR (primers B/G, Fig. 1; EMBL accession no. HF548340) and a fragment corresponding to the gene without the IS (primers E/F, Fig. 1; EMBL accession no. HF548343).

Maintenance of bacterial zinc homeostasis is a great challenge during the infectious process, and adcR was found to be required for full virulence of S. suis (Aranda et al., 2010). Zinc homeostasis is essential for bacteria because this element is indispensable for growth but becomes toxic at high concentrations. During neonatal meningitis, S. agalactiae has to cross subsequently several anatomic sites, which present very variable zinc concentrations: about 1.5 μM in the amniotic fluid, more than 14 μM in the blood, and 2.3 μM in the cerebrospinal fluid (Meret & Henkin, 1971; Tamura et al., 1994). Moreover, during infections, the host organisms react by increasing free zinc concentration, especially in their mucous membranes (McDevitt et al., 2011). It is thus primordial for S. agalactiae to be able to quickly adjust zinc transport in response to zinc-fluctuated concentrations. Due to the presence of a putative σ70 transcriptional promoter at the end of IS1548 (our unpublished results), its insertion into two sites of the adcRCB region might have an impact on zinc transport by modulating the expression of the Adc transporter and/or other proteins involved in zinc transport. As this insertion affects only a part of the bacterial population, this phenomenon may increase the genetic variability of the whole population, allowing it to better cope with adverse conditions occurring during the infectious process. Such phenomenon, called adaptive mutation, has been described for IS1 or IS5 insertions upstream of the cryptic bgl operon of E. coli, or IS4Bsu1 insertion in the comXP operon of Bacillus subtilis (Hall, 1998; Nagai et al., 2000). Interestingly, sag0194-sag0196, encoding a transcription antiterminator of the BglG family, and comX. 1 are also IS1548 targets in S. agalactiae and in S. pyogenes, respectively (Beres et al., 2002; Tettelin et al., 2002).

Two motifs of 8 and 10 base pairs are present in IS1548 insertion regions

To further characterize the genomic regions targeted by IS1548 in S. agalactiae, we searched whether the identified insertion regions possess common characteristic motifs. We submitted to the MEME software the DNA sequences from 100 bp upstream to 100 bp downstream of the direct repeats generated after IS1548 integration. These sequences included the six IS1548 regions of strain 2603V/R, the region between scpB and lmb of strain 97-3, and the two adcR regions identified in strains V88 and L9. A slightly degenerate 10-bp motif (motif 1, Fig. 2) is present three times between glmS and phnA, where it almost totally overlaps the direct repeat (GAAAATAGGC), and once between sag0194 and sag0196, between engA and sag1618, or between sag0692 and sag0694. A more degenerate 8-bp motif (motif 2, Fig. 2) was also identified once between sag0194 and sag0196, between ipk and adcR, between engA and sag1618, between ppc and ftsW, between glmS and phnA, between sag0692 and sag0694, or between scpB and lmb.

image

Figure 2. Conserved motifs identified in the neighboring of IS1548 insertion sites.

Download figure to PowerPoint

We then used the two motifs identified by MEME to identify potential IS1548 targets in the S. agalactiae genome. Due to our interest in IS1548 integration having a potential impact on the expression of downstream genes, we focused our search in the 5′-end (first 200 nucleotides) and in the intergenic region upstream of strain 2603V/R ORFs. Using the MAST software, we searched for the best matches of motif 1 (E-value < 10). Using this criterion, we found it in twenty-six regions, comprising all regions used to generate the motif with the exception of the one between sag0692 and sag0694 (Table 2). Interestingly, this motif is present in the intergenic region upstream of ipk, a gene located just upstream of adcR, indicating that this part of the genome is a particular target for IS1548 insertion. In addition, it is also found in the 5′-end of csrS, a known target of IS1548 in S. pyogenes (Engleberg et al., 2001). Because of its shortness, motif 2 is found very frequently in the S. agalactiae genome. We thus only report the results corresponding to the best matched sequence (AGGTTGTT, P-value = 1.9 10−5; E-value < 50). Using this severe criterion, thirty-six regions were found to possess this sequence (Table 3). The csrS region was the only one found to possess both motif 1 and the AGGTTGTT sequence. It is worth noting that the AGGTTGTT sequence is present upstream of sag1938, which encodes a lmb homologue. The murB region seems to be another particular target for IS1548 insertions. Indeed, the AGGTTGTT sequence is present upstream of murB and in the 5′-end of folC, a gene belonging to an operon located just upstream of murB. Interestingly, in strain 2603V/R, IS1548 is integrated in the intergenic region upstream of sag1618, which belongs to a putative operon including murC (sag1615) (Fig. 3). As Mur B (UDP-N-acetylpyruvoylglucosamine reductase) and MurC (UDP-N-acetylmuramate:L-alanine ligase) are both involved in peptidoglycan synthesis, this suggests that IS1548 may have an impact on this cellular process (El Zoeiby et al., 2003).

Table 2. Identification of motif 1 in the 5′-end and in the intergenic region upstream of Streptococcus agalactiae 2603V/R open reading frames
GeneStrandPositionaMAST resultsb
Motif P-valueSequence E-value
  1. a

    Nucleotide position from the predicted translation start site.

  2. b

    Motif P-value, probability of a random sequence of the same length to contain some match with a score as good or better; sequence E-value, expected number of sequences in a random database of the same size (2225 sequences) that would match the motif as well as the sequence does.

NP_688765.1|SAG177593–842.1 10−61.8
+100–1098.8 10−5
NP_688360.1|SAG136232–232.1 10−62.3
NP_687957.1|SAG0945+−164 to −1559.5 10−63.5
−111 to −1202.1 10−6
+−104 to −958.8 10−5
NP_687958.1|phnA+−90 to −812.1 10−63.5
NP_687703.1|SAG0687+−85 to −762.1 10−63.8
NP_687704.1|SAG0688−132 to −1412.1 10−63.8
+18–275.9 10−5
NP_689121.1|SAG2136−212 to −2212.1 10−64.1
NP_687385.1|fabZ130–1215.3 10−64.5
NP_688683.1|scrR+73–825.3 10−64.5
NP_688078.1|SAG1069+5–145.3 10−64.8
NP_688279.1|SAG1279+−69 to −605.3 10−66.2
NP_687335.1|SAG0300+84–935.3 10−66.3
NP_688615.1|csrS93–847.4 10−66.3
NP_688755.1|SAG1765+76–853.2 10−66.4
NP_687535.1|hup−69 to −785.3 10−66.9
NP_687492.1|trpG−54 to −635.3 10−67.5
109–1002.9 10−5
NP_687189.1|ipk−104 to −1135.3 10−67.8
NP_687835.1|nrdH+−159 to −1503.2 10−68.1
NP_687836.1|ptsH−224 to −2333.2 10−68.1
NP_688390.1|SAG1392+−68 to −595.3 10−68.2
NP_687146.1|radA−108 to −1175.3 10−68.3
NP_688610.1|SAG1619−130 to −1395.3 10−68.8
NP_687450.1|SAG0416+18–275.3 10−68.9
NP_688549.1|brnQ-1+7–165.3 10−69.1
NP_687231.1|SAG019617–87.4 10−69.4
NP_688441.1|SAG1444+−177 to −1685.3 10−69.9
Table 3. Identification of the best matched sequence of motif 2 (AGGTTGTT) in the 5′-end and in the intergenic region upstream of Streptococcus agalactiae 2603V/R open reading frames
GeneaStrandPositionb
  1. a

    The AGGTTGTT sequence was identified by MAST with a motif P-value = 1.9 10−5 and a sequence E-value < 50 (Motif P-value, probability of a random sequence of the same length to contain some match with a score as good or better; sequence E-value, expected number of sequences in a random database of the same size (2225 sequences) that would match the motif as well as the sequence does).

  2. b

    Nucleotide position from the predicted translation start site.

NP_687772.1|SAG0757+160–167
NP_688615.1|csrS41–34
NP_688126.1|folC116–109
NP_688571.1|SAG1580+168–175
NP_688727.1|SAG1737+119–126
NP_688367.1|SAG1369160–153
NP_687588.1|SAG0559170–163
NP_688489.1|SAG1495+−12 to −5
NP_688903.1|SAG1914163–156
NP_687693.1|SAG0675145–138
NP_687644.1|SAG0620+140–147
NP_687661.1|SAG06391 to −7
NP_688689.1|SAG1698+185–192
NP_688593.1|SAG1602+−36 to −29
NP_688747.1|SAG1757181–174
NP_687850.1|SAG0835+−39 to −32
NP_688679.1|manA+168–175
NP_689083.1|mutL+62–69
NP_688304.1|SAG1306+−8 to −1
NP_688504.1|msrA+24–31
NP_687433.1|SAG0399+18–25
NP_687163.1|fba83–76
NP_688121.1|murB−84 to −91
NP_688879.1|pepO−140 to −147
NP_688880.1|SAG1891+−8 to −1
NP_688502.1|SAG1508+−9 to −2
NP_688784.1|SAG1794+−83 to −76
NP_688785.1|SAG1795−149 to −156
NP_688926.1|SAG1938+−140 to −133
NP_688095.1|xpt+158–165
NP_688928.1|SAG1940+32–39
NP_688330.1|SAG1332+−48 to −41
NP_688331.1|SAG1333−226 to −233
NP_688245.1|SAG1243−271 to −278
NP_687632.1|SAG060511–4
NP_687918.1|SAG0904+39–46
image

Figure 3. Schematic representation of IS1548 insertion sites upstream of the operons containing murB and murC in Streptococcus agalactiae.

Download figure to PowerPoint

IS1548 insertion upstream of murB is widespread within the clonal complex 19

We tested experimentally our prediction on one of the identified IS1548 potential targets. The presence of IS1548 in the murB and murC regions was searched in our collection of strains. The presence of IS1548 in the folK-murB intergenic region was searched by amplifying using PCR the putative junctions between IS1548 and the folK or murB genes (primers J/A and B/K, Table S1 and Fig. 3). All of the 11 strains belonging to the CC19 tested were positive for the two PCRs, along with the strains V105 (ST-404) and G82 (ST-46). For all these strains, the amplicons had lengths of about 350 and 480 bp for the upstream and downstream junctions, respectively. By sequencing them in strain L9, we determined that IS1548 was inserted 116 bp upstream of the murB coding sequence, giving 10-bp direct repeats (Fig. 3, EMBL accession nos. HF548341 and HF548342). In the other three strains tested, the absence of IS1548 was confirmed by amplification of a fragment of about 420 bp corresponding to the empty intergenic region (primers L/M; Table S1 and Fig. 3). We also searched for the presence of IS1548 in the intergenic region between engA and the murC operon by PCRs amplifying the junctions between IS1548 and engA or sag1618 (primers N/A and B/O; Table S1 and Fig. 3). All these PCRs were negative for all strains, whereas we could amplify a fragment of about 500 bp corresponding to the empty intergenic region (primers P/Q; Table S1 and Fig. 3). So, IS1548 is integrated only in the site located upstream of murB in the analyzed strains, and this integration is very prevalent in particular among meningitic strains of the CC19.

In S. agalactiae, murB is organized into a putative operon along with the potABCD genes encoding a polyamine ABC transporter and sag1107 encoding a voltage-gated chloride channel (Tettelin et al., 2002). In S. pneumoniae, co-transcription of murB with the potABCD genes was shown experimentally (Ware et al., 2005). In this latter species, these genes are induced by environmental stresses and involved in fitness and pathogenesis via the regulation of expression of some virulence factors (Shah et al., 2011). So, IS1548 insertion into the intergenic region upstream of murB could have some effects on virulence via an upregulation of the downstream genes.

In conclusion, our analysis allowed the identification of S. agalactiae fitness/virulence genes potentially regulated by an IS1548 integration mechanism. The importance of the impact of IS1548 insertion on the physiology of S. agalactiae deserves further investigations that will be carried out in our laboratory.

Acknowledgements

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results and discussion
  6. Acknowledgements
  7. References
  8. Supporting Information

We thank Céline Lucchetti-Miganeh (Genostar, Montbonnot, France) for her advises on in silico genome analysis. We also thank Daniel Niquet, Rose-Anne Thépault, Catherine Cherpi-Antar, and Olivier Gast for technical assistance.

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results and discussion
  6. Acknowledgements
  7. References
  8. Supporting Information
  • Al Safadi R, Amor S, Hery-Arnaud G, Spellerberg B, Lanotte P, Mereghetti L, Gannier F, Quentin R & Rosenau A (2010) Enhanced expression of lmb gene encoding laminin-binding protein in Streptococcus agalactiae strains harboring IS1548 in scpB-lmb intergenic region. PLoS ONE 5: e10794.
  • Aranda J, Garrido ME, Cortés P, Llagostera M & Barbé J (2008) Analysis of the protective capacity of three Streptococcus suis proteins induced under divalent-cation-limited conditions. Infect Immun 76: 15901598.
  • Aranda J, Garrido ME, Fittipaldi N, Cortés P, Llagostera M, Gottschalk M & Barbé J (2009) Protective capacities of cell surface-associated proteins of Streptococcus suis mutants deficient in divalent cation-uptake regulators. Microbiology 155: 15801587.
  • Aranda J, Garrido ME, Fittipaldi N, Cortés P, Llagostera M, Gottschalk M & Barbé J (2010) The cation-uptake regulators AdcR and Fur are necessary for full virulence of Streptococcus suis. Vet Microbiol 144: 246249.
  • Bailey TL & Elkan C (1994) Fitting a mixture model by expectation maximization to discover motifs in biopolymers. Proc Int Conf Intell Syst Mol Biol 2: 2836.
  • Bailey TL & Gribskov M (1998) Combining evidence using p-values: application to sequence homology searches. Bioinformatics 14: 4854.
  • Bayle L, Chimalapati S, Schoehn G, Brown J, Vernet T & Durmort C (2011) Zinc uptake by Streptococcus pneumoniae depends on both AdcA and AdcAII and is essential for normal bacterial morphology and virulence. Mol Microbiol 82: 904916.
  • Beres SB, Sylva GL, Barbian KD, Lei B, Hoff JS, Mammarella ND, Liu MY, Smoot JC, Porcella SF, Parkins LD et al. (2002) Genome sequence of a serotype M3 strain of group A Streptococcus: phage-encoded toxins, the high-virulence phenotype, and clone emergence. P Natl Acad Sci USA 99: 1007810083.
  • Brenot A, Weston BF & Caparon MG (2007) A PerR-regulated metal transporter (PmtA) is an interface between oxidative stress and metal homeostasis in Streptococcus pyogenes. Mol Microbiol 63: 11851196.
  • Chandler M & Mahillon J (2002) Insertion sequences revisited. Mobile DNA, Vol. 2 (Craig NL, Craigie R, Gellert M & Lambowitz AM, eds), pp. 305366. ASM Press, WA.
  • Dmitriev A, Shen AD, Tkacikova L, Mikula I & Yang YH (2004) Structure of scpB-lmb intergenic region as criterion for additional classification of human and bovine group B Streptococci. Acta Vet Brno 73: 215220.
  • El Zoeiby A, Sanschagrin F & Levesque RC (2003) Structure and function of the Mur enzymes: development of novel inhibitors. Mol Microbiol 47: 112.
  • Engleberg NC, Heath A, Miller A, Rivera C & DiRita VJ (2001) Spontaneous mutations in the CsrRS two-component regulatory system of Streptococcus pyogenes result in enhanced virulence in a murine model of skin and soft tissue infection. J Infect Dis 183: 10431054.
  • Farley MM (2001) Group B streptococcal disease in nonpregnant adults. Clin Infect Dis 33: 556561.
  • Feng Y, Li M, Zhang H, Zheng B, Han H, Wang C, Yan J, Tang J & Gao GF (2008) Functional definition and global regulation of Zur, a zinc uptake regulator in a Streptococcus suis serotype 2 strain causing streptococcal toxic shock syndrome. J Bacteriol 190: 75677578.
  • Granlund M, Oberg L, Sellin M & Norgren M (1998) Identification of a novel insertion element, IS1548, in group B streptococci, predominantly in strains causing endocarditis. J Infect Dis 177: 967976.
  • Haguenoer E, Baty G, Pourcel C, Lartigue MF, Domelier AS, Rosenau A, Quentin R, Mereghetti L & Lanotte P (2011) A multi locus variable number of tandem repeat analysis (MLVA) scheme for Streptococcus agalactiae genotyping. BMC Microbiol 11: 171.
  • Hall BG (1998) Activation of the bgl operon by adaptive mutation. Mol Biol Evol 15: 15.
  • Héry-Arnaud G, Bruant G, Lanotte P, Brun S, Rosenau A, van der Mee-Marquet N, Quentin R & Mereghetti L (2005) Acquisition of insertion sequences and the GBSi1 intron by Streptococcus agalactiae isolates correlates with the evolution of the species. J Bacteriol 187: 62486252.
  • Huang X & Madan A (1999) CAP3: a DNA sequence assembly program. Genome Res 9: 868877.
  • Linke C, Caradoc-Davies TT, Young PG, Proft T & Baker EN (2009) The laminin-binding protein Lbp from Streptococcus pyogenes is a zinc receptor. J Bacteriol 191: 58145823.
  • McDevitt CA, Ogunniyi AD, Valkov E, Lawrence MC, Kobe B, McEwan AG & Paton JC (2011) A molecular mechanism for bacterial susceptibility to zinc. PLoS Pathog 7: e1002357.
  • Meret S & Henkin RI (1971) Simultaneous direct estimation by atomic absorption spectrophotometry of copper and zinc in serum, urine, and cerebrospinal fluid. Clin Chem 17: 369373.
  • Nagai T, Tran LS, Inatsu Y & Itoh Y (2000) A new IS4 family insertion sequence, IS4Bsu1, responsible for genetic instability of poly-gamma-glutamic acid production in Bacillus subtilis. J Bacteriol 182: 23872392.
  • Quentin R, Huet H, Wang FS, Geslin P, Goudeau A & Selander RK (1995) Characterization of Streptococcus agalactiae strains by multilocus enzyme genotype and serotype: identification of multiple virulent clone families that cause invasive neonatal disease. J Clin Microbiol 33: 25762581.
  • Reyes-Caballero H, Guerra AJ, Jacobsen FE, Kazmierczak KM, Cowart D, Koppolu UM, Scott RA, Winkler ME & Giedroc DP (2010) The metalloregulatory zinc site in Streptococcus pneumoniae AdcR, a zinc-activated MarR family repressor. J Mol Biol 403: 197216.
  • Rioux S, Neyt C, Di Paolo E, Turpin L, Charland N, Labbé S, Mortier MC, Mitchell TJ, Feron C, Martin D et al. (2011) Transcriptional regulation, occurrence and putative role of the Pht family of Streptococcus pneumoniae. Microbiology 157: 336348.
  • Rozen S & Skaletsky HJ (2000) Primer3 on the WWW for general users and for biologist programmers. Bioinformatics Methods and Protocols: Methods in Molecular Biology (Krawetz S & Misener S, eds), pp. 365386. Humana Press, Totowa, NJ.
  • Sambrook J, Fritsch EF & Maniatis J (1989) Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, New York.
  • Sellin M, Olofsson C, Håkansson S & Norgren M (2000) Genotyping of the capsule gene cluster (cps) in nontypeable group B streptococci reveals two major cps allelic variants of serotypes III and VII. J Clin Microbiol 38: 34203428.
  • Shah P, Nanduri B, Swiatlo E, Ma Y & Pendarvis K (2011) Polyamine biosynthesis and transport mechanisms are crucial for fitness and pathogenesis of Streptococcus pneumoniae. Microbiology 157: 504515.
  • Spellerberg B (2000) Pathogenesis of neonatal Streptococcus agalactiae infections. Microbes Infect 2: 17331742.
  • Tamura T, Weekes EW, Birch R, Franklin JC, Cosper P, Davis RO, Finley SC & Finley WH (1994) Relationship between amniotic fluid and maternal blood nutrient levels. J Perinat Med 22: 227234.
  • Tettelin H, Masignani V, Cieslewicz MJ, Eisen JA, Peterson S, Wessels MR, Paulsen IT, Nelson KE, Margarit I, Read TD et al. (2002) Complete genome sequence and comparative genomic analysis of an emerging human pathogen, serotype V Streptococcus agalactiae. P Natl Acad Sci USA 99: 1239112396.
  • Ware D, Watt J & Swiatlo E (2005) Utilization of putrescine by Streptococcus pneumoniae during growth in choline-limited medium. J Microbiol 43: 398405.
  • Weston BF, Brenot A & Caparon MG (2009) The metal homeostasis protein, Lsp, of Streptococcus pyogenes is necessary for acquisition of zinc and virulence. Infect Immun 77: 28402848.

Supporting Information

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results and discussion
  6. Acknowledgements
  7. References
  8. Supporting Information
FilenameFormatSizeDescription
fml12076-sup-0001-Table-S1.docWord document27KTable S1. Primers used in this study.

Please note: Wiley Blackwell is not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing content) should be directed to the corresponding author for the article.