The gene cluster aur1 for the angucycline antibiotic auricin is located on a large linear plasmid pSA3239 in Streptomyces aureofaciens CCM 3239

Authors


Correspondence: Jan Kormanec, Institute of Molecular Biology, Slovak Academy of Sciences, Dubravska cesta 21, 845 51 Bratislava, Slovak Republic. Tel.: +421 2 59307419; fax: +421 2 59307416;

e-mail: jan.kormanec@savba.sk

Abstract

We previously identified a polyketide synthase gene cluster, aur1, responsible for the production of the angucycline antibiotic auricin in Streptomyces aureofaciens CCM 3239. A sequence analysis of the aur1 flanking regions revealed the presence of several genes encoding proteins homologous to those for Streptomyces linear plasmid replication, partitioning and telomere-binding. Pulse-field gel electrophoresis detected the single, 240-kb linear plasmid, pSA3239, in S. aureofaciens CCM3239. The presence of the auricin cluster in pSA3239 was confirmed by several approaches. In addition to aur1, pSA3239 also carries a large number of regulatory genes, and two gene clusters involved in the production of secondary metabolites: the aur2 cluster for an unknown secondary metabolite and the bpsA cluster for the blue pigment indigoidine.

Introduction

Bacteria of the genus Streptomyces are one of the main producers of bioactive natural products. These Gram-positive soil bacteria undergo a complex process of morphological differentiation, which is accompanied by a so-called ‘physiological differentiation’ that involves the production of biologically active secondary metabolites. The biosynthetic genes of these secondary metabolites are physically clustered and are normally located in the large (8–10 Mbp) linear chromosomes characteristic of streptomycetes (Hopwood, 2007); however, in several cases, antibiotic biosynthesis clusters have been identified in large linear plasmids. This may ensure efficient spreading of these genes in the soil bacteria population via horizontal gene transfer (Kinashi, 2011). Like the Streptomyces chromosomes, these linear plasmids replicate bidirectionally from a centrally located replication origin towards both ends (Chang & Cohen, 1994). The terminal telomere regions of these plasmids contain long inverted repeats (TIR), which are capped by specific TIR-binding Tap/Tpg proteins. The distribution of linear plasmids in dividing cells usually involves a specific partitioning system encoded by parAB genes (Chater & Kinashi, 2007).

We previously identified a polyketide synthase gene cluster, aur1, responsible for the production of the angucycline antibiotic auricin in Streptomyces aureofaciens CCM 3239 (Novakova et al., 2002). Sequence analysis of this aur1 cluster revealed the presence of genes involved in the biosynthesis of auricin and its aminodeoxysugar moiety. The presence of a large number of regulatory genes indicated that auricin biosynthesis has a complex regulation; part of it has already been deciphered (Novakova et al., 2004, 2010a, b, 2011; Kutas et al., 2012). Sequence analysis of the aur1 upstream region revealed several genes encoding proteins homologous to those for the replication, partitioning and telomere-binding of Streptomyces linear plasmids. The aim of the present study was to identify and characterize this putative linear plasmid and to confirm the location of the aur1 cluster on it.

Materials and methods

Bacterial strains, plasmids and culture conditions

Streptomyces aureofaciens CCM 3239 wild type was from the Czechoslovak Collection of Microorganisms, Brno, Czech Republic. The Escherichia coli SURE strain (Stratagene) was used as a host, and the plasmid pBluescript II SK (Stratagene) was used for E. coli cloning experiments. The growth of S. aureofaciens CCM 3239 strains was carried out in Bennet medium (Horinouchi et al., 1983) as described in Novakova et al. (2010a). The conditions for E. coli growth and transformation were described by Ausubel et al. (1995).

DNA manipulations

Standard DNA manipulations in E. coli were carried out as described in Ausubel et al. (1995). The sequence of the upstream part of the aur1 cluster was determined using a chromosome-walking procedure. The S. aureofaciens CCM 3239 cosmid library (comprising Sau3AI partially digested DNA fragments in the BamHI site of SuperCos-1; Novakova et al., 2010a) was hybridized with a digoxigenin (DIG)-labelled probe (Roche) comprising approximately 1-kb end DNA fragments from the successively identified cosmids. The representative recombinant cosmids, pCosSA25, pCosSA31 and pCosSA74, containing the largest region upstream of the aur1 cluster were used for sequencing. Employing internal restriction sites, the DNA fragments were subcloned into pBluescript II SK+, and both strands were sequenced. Nucleotide sequencing was carried out with the ABI PRISM™ Dye Terminator Cycle Sequencing Ready Reaction Kit (Applied Biosystems) and analysed using an Applied Biosystems model 373 DNA sequencer. The nucleotide sequences reported in this article have been deposited in GenBank under accession numbers HQ003813, AY033994, and KC152537.

Preparation of total DNA, pulse-field gel electrophoresis (PFGE) and Southern blot hybridization analysis

DNA was prepared from mycelium immobilized in agarose as previously described (Gravius et al., 1993) with some modifications. Streptomyces aureofaciens CCM3239 was grown in CGGM medium (Kormanec et al., 1992) for 19 h at 28 °C, washed and then resuspended in isolation buffer (20 mM HEPES, 100 mM NaCl, 200 mM EDTA pH 8.0). Cells were then mixed with an equal volume of 1.2% low-melting-point agarose (ThermoFisher) in the same buffer at 45 °C, and the mixture was gently inserted into an agarose plug former. The immobilized cells were lysed in a two-step process: first, the plugs were incubated in lysozyme buffer (10 mg mL−1 lysozyme in isolation buffer) for 6 h at 37 °C with horizontal shaking. The buffer was then replaced by EPS solution (0.5 M EDTA, 2% sodium lauroyl sarcosinate, 200 μg mL−1 proteinase K), and the agarose plugs were incubated at 50 °C for 24 h. The DNA released was subjected to PFGE on 0.8% agarose using a Rotaphor System (Biometra) under the following conditions: a 30–5 s logarithmic ramp time, an 180–120 V logarithmic voltage ramp in 0.25 × TAE buffer at 10 °C for 23 h. Ladders of linear lambda concatemers (Bio-Rad) were used as molecular weight markers, and gels were stained with ethidium bromide (Sigma).

Southern blot hybridization analysis (Ausubel et al., 1995) of the PFGE gel was carried out with DIG-labelled DNA probes. A 550-bp NcoI fragment comprising the aur1C gene (Novakova et al., 2002) was used as a probe for the aur1 cluster, and a 900-bp EcoRI-PstI fragment comprising the hrdD gene (Kormanec et al., 1992) was used as a probe for the homologue of the principal sigma factor gene of RNA polymerase. To verify the conformation of pSA3239, the pSA3239 plasmid DNA was isolated after PFGE by electroelution, and an aliquot of the plasmid (in TE buffer) was treated with 100 U of E. coli exonuclease III (Biolabs) or 10 U of bacteriophage λ exonuclease (Biolabs) at 37 °C for 1 h and electrophoresed by PFGE.

Deletion of the S. aureofaciens CCM 3239 aur1 gene cluster

The PCR-targeted REDIRECT procedure (Gust et al., 2003) was used to delete the 24.76-kb region in the aur1 cluster from sa22 to aur1V in S. aureofaciens CCM 3239 (Novakova et al., 2010a). In brief, the apramycin resistance cassette was PCR amplified using the primers SA22dDir (5′-GTGCGCCGATGCCCCGGCGGACGAGGAGAGAGGCAAGCCA TTCCGGGGATCCGTCGACC-3′) and Aur1TdRev (5′- ACGGCGTGGCGGCTCCGGAC GGCCCCGCGCGGTGACCGCTGTAGGCTGGAGCTGCTTC-3′) and the template plasmid pIJ773. The resulting PCR product was used to electroporate E. coli BW25113/pIJ790 containing cosmid pCosSA5 (Novakova et al., 2010a). The resulting verified recombinant cosmid pCosSA5-aur1::AmR was transformed into the nonmethylating E. coli ET12567/pUZ8002 strain and introduced into S. aureofaciens CCM 3239 by conjugation; mutants resistant to apramycin and sensitive to kanamycin were selected. Correct integration was verified by Southern blot hybridization. One representative strain, S. aureofaciens Δaur1, was chosen for further study.

Analysis of auricin production

Spores (5 × 108 CFU) of S. aureofaciens CCM 3239 and Δaur1 mutant strains were inoculated into 50 mL Bennet medium in 250-mL Erlenmeyer flasks and the cultures grown on an orbital shaker at 270 r.p.m. and 28 °C. 4-mL aliquots were taken from the cultures at various time points, and auricin was extracted and analysed by TLC and HPLC as described previously (Novakova et al., 2011).

Results and discussion

Cloning and sequence analysis of the region upstream of the auricin aur1 gene cluster

Previously, we cloned a 15.1-kb DNA fragment containing an incomplete aur1 gene cluster from S. aureofaciens CCM3239, which is responsible for the production of the antibiotic auricin (Novakova et al., 2002). To identify the entire aur1 cluster, a cosmid library of S. aureofaciens CCM3239 genomic DNA in SuperCos-1 was screened with a DIG-labelled probe covering the region at the beginning of this DNA fragment. Restriction and hybridization analyses of the identified positive cosmids revealed overlapping DNA fragments with the best representative, the pCosSA25 cosmid, containing the largest region upstream of the aur1 cluster. A similar chromosome-walking strategy was used twice to identify the successive overlapping representative cosmids pCosSA31 and pCosSA74 (Fig. 1); further chromosome-walking screening of the cosmid library with the labelled end DNA fragment from pCosSA74 failed to identify a larger DNA region than the one found in pCosSA74. This indicates that the DNA region cloned in pCosSA74 is near the end of the chromosome. Southern blot hybridization of S. aureofaciens CCM3239 chromosomal DNA, digested using several restriction enzymes, with the labelled end DNA fragment of pCosSA74, produced an identically hybridizing DNA fragment (data not shown). This indicates that the end of the chromosomal DNA is about 2 kb from the end of pCosSA74.

Figure 1.

Genetic organization of the upstream region of the Streptomyces aureofaciens CCM 3239 aur1 cluster. Each arrow indicates the direction of transcription and the relative size of the gene. The black arrows correspond to the aur1 cluster genes; the grey arrows, to the aur2 cluster genes; and the hatched arrows, to the genes similar to those for Streptomyces linear plasmid replication, partitioning and telomere-binding proteins. For details regarding individual genes and their products, see Table 1 and Novakova et al. (2004, 2011). The thick bars below the map indicate the overlapping DNA fragments of the corresponding cosmids used for sequencing.

The representative cosmids, pCosSA25, pCosSA31 and pCosSA74 (Fig. 1), were used for nucleotide sequencing. Analysis of the connected sequence (60 852 bp) with the CODON PREFERENCE program identified 55 new ORFs having codon usage typical for Streptomyces genes (Wright & Bibb, 1992). The possible functions of these genes were determined by searching GenBank using the sequences of the products of these genes. The results are presented graphically in Fig. 1 and summarized in Table 1.

Table 1. Deduced functions for the gene products of the S. aureofaciens CCM 3239 pSA3239 plasmid
Geneaa residues Putative functionClosest protein homolog, strain (plasmid)Identity/similarity (%)Acc. number
sa21349Cyclase/dehydrataseFarE, S. lavendulae FRI-564/73BAG74712
sa2289Acyl carrier proteinRocC, S. rochei 7434AN4 (pSLA2-L)50/65BAC76525
sa23268SARP family regulatorFarR3, S. lavendulae FRI-591/95BAG74713
sa24 272SARP family regulatorFarR4, S. lavendulae FRI-587/90 BAG74714
sagA 289Gamma-butyrolactone biosynthetic proteinFarX, S. lavendulae FRI-567/80 BAG74715
sa25 282Nucleoside diphosphate sugar epimeraseSCO6267, S. coelicolor A3(2)61/71 CAB60186
sagR 224Gamma-butyrolactone receptor proteinFarA, S. levendulae FRI-569/82 BAG74716
sa26 516OxygenaseSM8_01566, Streptomyces sp. SM863/72 EKC95639
sa27 157AcetyltranferaseFarB, S. lavendulae FRI-582/87 BAG74717
sa28 330AraC family regulatorFarR5, S. lavendulae FRI-579/84 BAG74718
sa29 270EpimeraseFarC, S. lavendulae FRI-575/82 BAG74719
sa30 266HydrolaseSSNG_03400, Streptomyces sp. C63/73 EFL16148
sa31 167Hypothetical proteinSSNG_07293, Streptomyces sp. C88/94 EFL20041
sa32 181FlavoproteinSSNG_07292, Streptomyces sp. C90/94 EFL20040
sa33 169Hypothetical proteinSSNG_07291, Streptomyces sp. C86/92 EFL20039
sa34 394Epoxide hydrolaseSSNG_07289, Streptomyces sp. C89/92 EFL20037
sa35 273SARP family regulatorFarR3, S. lavendulae FRI-591/95 BAG74713
sa36 241TetR family regulatorSSNG_07286, Streptomyces sp. C75/79 EFL20034
sa37 292SARP family regulatorFarR4, S. lavendulae FRI-581/87 BAG74714
sa38 200TetR family regulatorPapR5, S. pristinaespiralis Pr1153/63 CBW45767
sa39 408TransporterSSNG_05405, Streptomyces sp. C56/72 EFL18153
sa40 264TetR family regulatorSSAG_03566, Streptomyces sp. Mg170/78 EDX23881
sa41 412OxidoreductaseSSAG_03565, Streptomyces sp. Mg172/79 EDX23880
sa42 227Gamma-butyrolactone receptor proteinSSMG_05915, Streptomyces sp. AA453/67 EFL10244
sa43 419Plasmid partitioning protein ParAParA, S. rochei 7434AN4 (pSLA2-L)70/82 BAC76556
sa44 272Plasmid partitioning protein ParBParB, S. rochei 7434AN4 (pSLA2-L)47/65 BAC76555
sa45 156CyclasePokC1, S. diastatochromogenes Tu602847/56 ACN64848
sa46 384GlycosyltranferaseSlgG, S. ludicus NRRL 243338/51 CBA11567
sa47 350Hypothetical proteinFrancci3_4152, Frankia sp. CcI347/58 ABD13500
sa48 316Cyclase/dehydrataseSimA5, S. antibioticus Tu604035/55 AAK06788
sa49 304OxidoreductasePaelaDRAFT_0431, Paenibacillus lactis 15466/77 EHB68305
sa50 310Glucose-1-phosphate thymidyltranferaseSSMG_00319, Streptomyces sp. AA472/85 EFL04648
sa51 495Drug resistance transporterFrancci3_2014, Frankia sp. CcI344/63 ABD11388
sa52 239NDP-aminohexose N-dimethyltransferaseSrm9c, S. ambofaciens ATCC 2387768/79 CAM96588
sa53 384GlycosyltranferaseBN159_2509, S. davawensis JCM 491351/67 CCK26888
sa54 403S-adenosylmethionine synthaseSSNG_01323, Streptomyces sp. C92/97 EFL14071
sa55 327Carbohydrate kinaseSSQG_00979, S. viridochromogenes76/85 EFL30461
sa56 1163Methionine synthaseSSNG_01499, Streptomyces sp. C92/96 EFL14247
sa57 3015,10-methylene- tetrahydrofolate reductaseMetF, S. tendae Tu102886/91 AFS18584
sa58 478S-adenosyl-l-homocysteine hydrolaseSSNG_05648, Streptomyces sp. C94/97 EFL18396
sa59 385NDP-hexose aminotransferaseSrm8, S. ambofaciens ATCC 2387777/86 CAM96587
aur2I 484OxidoreductaseSVEN_6003, S. venezuelaee ATCC 1071249/63 CCA59289
aur2D 305CyclaseSSNG_07334, Streptomyces sp. C66/77 EFL20082
tapSa 838Telomere associated proteinTapRM, S. rochei 7434AN4 (pSLA2-M)50/65 BAK19818
tpgSa 184Terminal proteinTpgRM, S. rochei 7434AN4 (pSLA2-M)62/77 BAK19817
sa74 210NTP pyrophosphohydrolaseSSFG_07395, S. ghanaensis ATCC 1467287/92 EFE72160
sa75 157Hypothetical proteinpSLA2-M.02, S. rochei 7434AN4(pSLA2-M)66/78 BAK19796
sa76 169Replication initiation proteinpSLA2-M.01, S. rochei 7434AN4(pSLA2-M)74/87 BAK19795

Several genes upstream of the aur1R (auricin-specific negative regulator) gene (Novakova et al., 2010a) were similar to genes from other polyketide clusters, but they were scattered across a rather large region (Fig. 1, Table 1). Disruption of several of them (sa46, sa52, sa53 and sa59) affected auricin production, thus indicating that they play a role in auricin biosynthesis; however, disruption of others (sa22) had no effect on auricin production (J. Kormanec, unpublished data). Therefore, it is difficult to find the boundary of the aur1 cluster in this region. Interestingly, a sequence analysis of the most upstream region revealed the previously identified type II polyketide synthase gene cluster aur2 (aur2D-aur2I, Fig. 1), which is involved in the production of an unknown secondary metabolite (Novakova et al., 2004). This aur2 cluster lacks a gene encoding the acyl carrier protein (ACP); therefore, it is likely that the sa22 gene, which encodes a homologue of ACP (Table 1) and has no role in auricin biosynthesis, might belong to this aur2 cluster.

The region between the aur1 and aur2 clusters is rich in genes encoding regulatory proteins from several families (Fig. 1, Table 1). There were four genes encoding homologues of the SARP family of Streptomyces antibiotic regulatory proteins (Wietzorreck & Bibb, 1997) and five genes encoding homologues of the TetR family of transcriptional repressors (Ramos et al., 2005), including two genes with high similarity to the receptor proteins of the gamma-butyrolactone autoregulator–receptor system (Takano, 2006). In addition, there was a gene encoding a homologue of the AraC family (Gallegos et al., 1997). One of the SARP family genes, aur1PR3, was previously shown to regulate auricin biosynthesis (Novakova et al., 2011); however, disruption of three other SARP genes had no effect on auricin production (J. Kormanec, unpublished data). It is possible they have a role in the regulation of the upstream aur2 cluster. In addition, the region between aur1 and aur2 also contains several primary metabolic genes (sa54-sa58) for methionine and S-adenosylmethionine biosynthesis.

Conserved genes of Streptomyces linear replicons

A sequence analysis of the aur1 upstream region revealed several genes encoding proteins homologous to those for Streptomyces linear plasmid replication, partitioning and telomere-binding (Fig. 1, Table 1). Two adjacent genes that are transcribed in the same direction and separated by a 128-bp intergenic region, sa43 and sa44, encode, respectively, proteins very similar to ParA and ParB of the Streptomyces linear plasmid partitioning system (Supporting Information, Fig. S1). These genes are essential for the efficient segregation of plasmids and chromosomes during cell division (Gerdes et al., 2000). Their highest similarity was to the ParAB system from the S. rochei linear plasmid pSLA2-L (Mochizuki et al., 2003).

Two translationally coupled genes, tapSa and tpgSa, are highly similar to the tap and tpg genes that encode proteins necessary for telomere replication of Streptomyces chromosomes and plasmids (Bao & Cohen, 2001, 2003). These two genes are usually adjacent and form an operon in Streptomyces. The tpg gene encodes a terminal protein (TP) that is covalently bound to the 5′ end of the linear DNA. Most TPs are highly conserved in sequence and size (184–185 aa) (Bao & Cohen, 2001; Yang et al., 2002). The tap gene encodes a telomere-associated protein (TAP) that has been shown to be essential for plasmid and chromosomal replication in a linear form (Bao & Cohen, 2003).The tpgSa gene encodes a putative TP of S. aureofaciens CCM3239 and is highly conserved in sequence and size. The TapSa and TpgSa proteins showed the highest similarity to the TPs and TAPs from several Streptomyces linear plasmids (Fig. S2).

Two other genes, sa75 and sa76, showed high similarity (Fig. S3) to the replication initiation genes pFRL2.1 and pFRL2.2, respectively, of the linear plasmid pFRL2 from Streptomyces sp. FR1 (Zhang et al., 2009) and to the replication initiation genes pSLA2-M.02 and pSLA2-M.01, respectively, of the linear plasmid pSLA2-M from S. rochei (Yang et al., 2011). Although most linear plasmids are replicated from a centrally located origin and proceeds bidirectionally towards the telomeres (Chang & Cohen, 1994), both of the pFRL2.1 and pFRL2.2 genes, together with an adjacent noncoding sequence, function as a replication origin (Zhang et al., 2009). This unusual end location has been reported only for pFRL2 and pSLA2-M. The similar location of putative replication genes in Saureofaciens CCM3239 indicates a similar unusual replication mechanism and suggests various replication mechanisms of linear plasmids, as described previously (Zhang et al., 2009).

Identification of the linear plasmid pSA3239 in S. aureofaciens CCM3239

The sequence analysis results indicated that the aur1 cluster should be located in a large linear plasmid. PFGE analysis of undigested S. aureofaciens CCM3239 DNA revealed the presence of such a plasmid. In addition to chromosomal DNA from S. aureofaciens CCM3239, 10 independent colonies of the strain after sporulation on solid Bennet medium were used for preparation of DNA insert plugs for PFGE. The experiment revealed the presence of a single, 240-kb linear plasmid, designated pSA3239, in all samples of Saureofaciens CCM3239 (Fig. 2). In addition, all the colonies produced similar levels of the yellow antibiotic auricin (data not shown). To verify the conformation of pSA3239, the plasmid was isolated after PFGE by electroelution, treated with E. coli exonuclease III and bacteriophage λ exonuclease and subsequently electrophoresed by PFGE. As shown in Fig. 3, the pSA3239 DNA was sensitive to E. coli exonuclease III but resistant to bacteriophage λ exonuclease, suggesting that the plasmid DNA was linear, with a free 3′ end and a blocked 5′ end.

Figure 2.

PFGE analysis of Streptomyces aureofaciens CCM3239 DNA (lane T) and DNA from 10 independent colonies of the strain (lanes 1–10). The S lanes denote lambda ladders.

Figure 3.

Exonuclease analysis of pSA3239. The plasmid DNA isolated after PFGE by electroelution (lane 3) was treated with 100 U of Escherichia coli exonuclease III (lane 1) or 10 U of bacteriophage λ exonuclease (lane 2), as described in the Material and Methods section and analysed by PFGE. Lane S denotes a lambda ladder.

The aur1 cluster is located on pSA3239

To confirm the location of the auricin cluster on pSA3239, Southern blot hybridization studies using a labelled probe from the auricin cluster were performed. As shown in Fig. 4, only pSA3239 hybridized with the aur1C probe, containing a DNA fragment comprising the aur1C gene (Novakova et al., 2002), while the control probe containing the chromosomally encoded hrdD gene, which encodes a homologue of the principal sigma factor of RNA polymerase (Kormanec et al., 1992), hybridized only with chromosomal DNA.

Figure 4.

PFGE analysis of Streptomyces aureofaciens CCM3239 DNA followed by Southern blot hybridization with an aur1C gene probe from the auricin cluster (Novakova et al., 2002) and a hrdD gene probe containing the chromosomally encoded hrdD gene, which encodes a homologue of the principal sigma factor of RNA polymerase (Kormanec et al., 1992). The S lanes denote lambda ladders.

To investigate the stability of pSA3239 after segregation during sporulation, a S. aureofaciens ΔbpsA1 mutant, prepared by replacing the bpsA gene (normally present on the pSA3239 plasmid) with the apramycin resistance gene aac(3)IV (Novakova et al., 2010b), was used to prepare a spore stock. The stock was produced by two rounds of sporulation on solid Bennet medium under nonselective conditions. An analysis of 300 independent colonies on parallel Bennet plates with and without apramycin revealed that all the colonies also grew on apramycin plates, thus indicating that the plasmid is quite stable during segregation.

Deletion of the aur1 cluster in S. aureofaciens CCM 3239

To corroborate the result above, an aur1 cluster deletion mutant was prepared in Saureofaciens CCM3239 using a PCR-targeting system for disrupting Streptomyces genes (Gust et al., 2003); DNA from the S. aureofaciens Δaur1 strain, containing a 24.76-kb deletion in the aur1 cluster, was analysed by PFGE. As shown in Fig. 5, the DNA prepared from the mutant strain clearly indicates that about 25 kb in the pSA3239 plasmid has been deleted; this additionally confirmed the presence of the auricin cluster in the plasmid. This deletion did not affect growth in either rich Bennet or minimal NMP media or differentiation on solid Bennet medium. As expected, the mutant strain could not produce auricin (data not shown).

Figure 5.

PFGE analysis of the Streptomyces aureofaciens CCM3239 DNA (lane WT) and the DNA from the S. aureofaciens Δaur1 mutant strain (lane Δaur1) containing a 24.76-kb deletion in the auricin cluster. Lane S denotes a lambda ladder.

In conclusion, we identified a new, 240-kb large linear plasmid, pSA3239, in the S. aureofaciens CCM3239 strain and confirmed its linearity. Several lines of evidence confirmed the presence of the auricin cluster, aur1, which is responsible for the production of the angucycline antibiotic auricin, in pSA3239. In addition to aur1, the plasmid also carries additional genes likely involved in the production of secondary metabolites, like the aur2 cluster for an unknown secondary metabolite (Novakova et al., 2004) and the bpsA gene cluster for blue pigment indigoidine (Novakova et al., 2010b). A sequence analysis of the partial nucleotide sequence of pSA3239 revealed a large amount of regulatory genes and the presence of four genes encoding proteins similar to those of the ParAB partitioning system and the TP/TAP telomere-binding proteins for streptomycetes linear plasmids. Like the two linear plasmids pFRL2 from Streptomyces sp. FR1 (Zhang et al., 2009) and pSLA2-M from S. rochei (Yang et al., 2011), pSA3239 also appears to contain an unusual replication origin with two specific replication initiation genes located at its extreme end. The pSA3239 plasmid is therefore another example of linear plasmids involved in the production of secondary metabolites in streptomycetes. Completion of the sequencing of pSA3239 and experiments to investigate its replication and telomere structures are in progress.

Acknowledgements

We are grateful to Dr Bertold Gust for providing the PCR-targeting system; the system was supplied by Plant Bioscience Ltd. (Norwich, UK). This work was supported by the Slovak Research and Development Agency under contract no. APVV-0203-11. This contribution is also a result of the TRANSMED (ITMS: 26240120008) and TRANSMED 2 (ITMS: 26240120030) projects, supported by the Research & Development Operational Programme funded by the ERDF.

Ancillary