Inactivation of the petE gene encoding plastocyanin causes different photosynthetic responses in cyanobacterium Synechocystis PCC 6803 under light–dark photoperiod and continuous light conditions

Authors

  • Xiao-Qin Wang,

    1. College of Life Sciences, Central China Normal University, Wuhan, Hubei, China
    2. Hubei Key Laboratory of Genetic Regulation and Integrative Biology, Central China Normal University, Wuhan, Hubei, China
    Search for more papers by this author
  • Hai-Bo Jiang,

    1. College of Life Sciences, Central China Normal University, Wuhan, Hubei, China
    2. Hubei Key Laboratory of Genetic Regulation and Integrative Biology, Central China Normal University, Wuhan, Hubei, China
    Search for more papers by this author
  • Rui Zhang,

    1. College of Life Sciences, Central China Normal University, Wuhan, Hubei, China
    2. Hubei Key Laboratory of Genetic Regulation and Integrative Biology, Central China Normal University, Wuhan, Hubei, China
    Search for more papers by this author
  • Bao-Sheng Qiu

    Corresponding author
    1. Hubei Key Laboratory of Genetic Regulation and Integrative Biology, Central China Normal University, Wuhan, Hubei, China
    • College of Life Sciences, Central China Normal University, Wuhan, Hubei, China
    Search for more papers by this author

Correspondence: Bao-Sheng Qiu, College of Life Sciences, Central China Normal University, Wuhan 430079, Hubei, People's Republic of China. Tel.: 86-27-67862470; fax: 86-27-67861936; e-mail: bsqiu@mail.ccnu.edu.cn

Abstract

Plastocyanin, encoded by the petE gene, can transfer electrons to photosystem I (PSI) and cytochrome c oxidase during photosynthetic and respiratory metabolism in cyanobacteria. We constructed a petE mutant of Synechocystis sp. strain PCC 6803 and investigated its phenotypic properties under different light conditions. When cultured under continuous light, inactivation of petE accelerated the plastoquinone pool reoxidation, slowed the reoxidation rate of the primary quinone-type acceptor, and decreased the connectivity factor between the individual photosystem II (PSII) photosynthetic units. Compared with the wild-type control, the petE mutant showed a decrease in its PSI/PSII fluorescence ratio and an increase in its dark respiration rate. When cultured under a light–dark photoperiod, the petE mutation caused an increase in the phycocyanin to chlorophyll ratio. Consequently, the mutant line was a darker blue than its wild-type counterpart. Moreover, the petE mutation increased the efficiency of light capture, nonphotochemical quenching, and linear electron transport activity, but decreased the functional absorption cross section of PSII. These results suggest that plastocyanin is involved in regulating the redox state of the photosynthetic electron transfer chain, and the petE mutation can induce interesting phenotypic properties that are specific to the light–dark photoperiod.

Introduction

Plastocyanin, the product of the petE gene, is a small water-soluble copper protein located in the lumen of thylakoid membranes and has been widely considered to be the only effective electron carrier between cytochrome b6f and photosystem I (PSI) in higher plants (Hope, 2000; Molina-Heredia et al., 2003). However, cyanobacterial and certain eukaryotic algal species are able to synthesize both plastocyanin and cytochrome c6 (Binder, 1982; Zhang et al., 1992; Díaz-Quintana et al., 2003; Peers & Price, 2006). Cyanobacterial plastocyanin and cytochrome c6 can replace each other as redox carriers in the photosynthetic and respiratory electron transport chains, and their synthesis is regulated by the external copper concentration (Zhang et al., 1994; Durán et al., 2004). High concentrations of copper (such as 1 μM) inhibit expression of the petJ gene, which encodes cytochrome c6. When cultured under moderate copper concentrations (such as 0.3 μM), both plastocyanin and cytochrome c6 are found in Synechocystis sp. strain PCC 6803 (hereafter designated Synechocystis 6803) (Zhang et al., 1992; Tottey et al., 2001).

In cyanobacteria, both plastocyanin and cytochrome c6 can transport electrons to PSI and cytochrome c oxidase (Díaz-Quintana et al., 2003; Navarro et al., 2005). Plastocyanin preferentially donates electrons to cytochrome c oxidase (Navarro et al., 2005), while cytochrome c6 donates electrons more efficiently to PSI (Durán et al., 2004). It has been reported that plastocyanin can affect the electron transport process. For example, overexpression of heterologous plastocyanin in Synechococcus PCC 7942 can increase the capacity of electron transport (Geerts et al., 1994). Similarly, loss of plastocyanin can lower the capacity for electron flux into PSI (Clarke & Campbell, 1996). However, it remains unclear how plastocyanin influences the redox state of the photosynthetic electron transfer chain.

Some studies have reported that cyanobacteria changed their growth rate, photosynthetic performance, and pigment content under a light–dark photoperiod compared with continuous light (Post et al., 1985; Austin et al., 1996). In addition, expression of many genes involved in photosynthesis and respiration, as well as expression of soluble electron carriers and redox component genes, also differs in cyanobacteria after a shift from a light–dark photoperiod to continuous light (Gill et al., 2002; Toepel et al., 2008). It has been reported that the Synechococcus PCC 7942 ΔpetE strain exhibits several phenotypic changes relative to the wild type under continuous light (Clarke & Campbell, 1996). However, few studies have investigated photosynthesis in the cyanobacterial ΔpetE strain under a light–dark photoperiod.

Hence, to investigate the role of plastocyanin in regulating the redox state of the photosynthetic electron transfer chain, Synechocystis 6803 ΔpetE and its wild-type control were cultured under continuous light and light–dark photoperiods. Interestingly, cultures of the ΔpetE strain appeared darker blue than their wild-type counterparts when grown in BG11 medium containing 0.3 μM copper under a light–dark photoperiod, but not when grown under continuous light.

Materials and methods

Strains and culture conditions

All of the Synechocystis 6803 strains described herein were grown photoautotrophically in liquid mineral BG11 medium under continuous light or a light/dark cycle (12/12 h) at 32 °C with white fluorescent illumination (40 μmol photons m−2 s−1). Irradiance was measured using a quantum sensor (QRT1, Hansatech Instruments, King's Lynn, Norfolk, UK). A kanamycin-resistant derivative of Synechocystis 6803 that displays no change in phenotype under different conditions (Williams, 1988) was used as a wild-type control. According to the culture requirements of the mutant and the complemented strain, kanamycin (25 μg mL−1) or both kanamycin and spectinomycin (25 μg mL−1) were added to BG11 medium. Cell growth was detected by their turbidity (optical density at 730 nm, OD730) with a Cary 300 UV-VIS spectrophotometer (Varian Australia Pty Ltd, Mulgrave, Vic., Australia).

Construction of the ΔpetE and complementation strains

A 1688-bp DNA fragment containing the sll0199 gene was generated by PCR using sll0199-F (5′-CTTGGTAATGCCCGCTTCGG-3′) and sll0199-R (5′-ACGGCACTCGGCCTCACTCC-3′) primers, cloned into pMD18-T, and confirmed by sequencing. The C.K2 fragment excised from pRL446 (Elhai & Wolk, 1988) using PvuII was inserted into the HpaI site of the same plasmid, resulting in pHS0291 for the inactivation of sll0199 gene. To construct the Synechocystis 6803 sll0199::C.K2 mutant, pHS0291 was introduced into wild-type Synechocystis 6803 by natural transformation according to the method described by Williams (1988). Homologous double-crossover recombinants were generated between the plasmid and genomic DNA under positive selection with kanamycin. Complete segregation of the mutant was confirmed by PCR using the primer pair sll0199-F/sll0199-R, and the wild-type Synechocystis 6803 DNA was used as a positive control (Fig. 1).

Figure 1.

Construction and PCR analysis of the Synechocystis 6803 petE mutant and complementation strain. Strategy for disruption of petE in the Synechocystis 6803 genome (a). Strategy for complementation of the petE mutant (b). PCR analysis of genomic DNA from wild-type, ΔpetE, and complementation strains (c). Lanes 1–3 are PCR products from sll0199-F/sll0199-R primers. Lanes 4–6 are PCR products from psbAII-oe1 (GCGTGCAAGGCCCAGTGATC)/sll0199oe-2 primers. Lanes 1 and 4: wild-type DNA. Lanes 2 and 5: ΔpetE DNA. Lanes 3 and 6: complementation strain DNA. MW: molecular mass standard.

To complement the ΔpetE mutant strain, a vector carrying omega-P6803psbAII-sll0199 (pHS680) was constructed. A 381-bp sll0199 gene fragment was amplified using sll0199oe-1 (5′-TGTCTAAAAAGTTTTTAACAATCCTCGC-3′) and sll0199oe-2 (5′-TTACTCAACGACAACTTTGCCT-3′) primers and cloned into the NdeI site (blunt end) of the pHS298 plasmid (Jiang et al., 2012), thus resulting in pHS680. The pHS680 plasmid was introduced into the sll0199::C.K2 mutant to gain the complementation strain, which was confirmed by agarose gel electrophoresis of PCR products (Fig. 1).

Pigment measurements

Whole-cell absorption spectra were determined with a Cary 300 UV-VIS spectrophotometer (Varian Australia Pty Ltd). Cell numbers were counted using Epics Altra flow cytometry (Beckman Coulter, Cupertino, CA) as described by Zhang et al. (2012). Samples were harvested by centrifugation, resuspended in 95% ethanol, and incubated in the dark at 4 °C for 24 h. Homogenized solutions were centrifuged at 8000 g for 10 min, after which the absorbance of the supernatants was determined. The chlorophyll a (Chl a) and carotenoid (CAR) contents of the samples were calculated according to Lichtenthaler & Buschmann (2001). Samples were subjected to four rounds of freezing in liquid nitrogen and thawing at 4 °C in the presence of 0.1 M phosphate buffer (pH 6.8). The homogenized solutions were centrifuged at 8000 g for 10 min before the absorbance of each supernatant was determined. The phycocyanin (PC) concentration was calculated according to Lüder et al. (2001).

Chlorophyll fluorescence measurements

Cultures in exponential phase were dark-adapted for 20 min and used for rapid light response curve measurements with a WATER-PAM Chlorophyll Fluorometer (Walz GmbH, Effeltrich, Germany). The parameter YIELD was calculated as follows: YIELD = (Fm′ – F′)/Fm′ (Genty et al., 1989). The relative electron transport rate (rETR) at a given actinic irradiance was calculated by the formula: rETR = YIELD × PAR, where PAR is the actinic irradiance in μmol photons m−2 s−1 (Ralph et al., 2002). The maximal rate of rETR (rETRmax) and photosynthetic efficiency (α) were calculated by fitting the rapid light response curve to an exponential function modified from Jassby & Platt (1976): rETR = rETRmax × [1 – exp(−α × I/rETRmax)], where I represents irradiance. Fluorescence induction was measured under 71 μmol photons m−2 s−1 continuous actinic light. The maximal fluorescence yield for a light-adapted sample (Fm′) and the maximal fluorescence yield (Fm DCMU) were obtained as described by Liu & Qiu (2012). Nonphotochemical quenching (NPQ) was calculated according to the following equation: NPQ = (Fm DCMUFm′)/Fm′ (Campbell et al., 1998).

Photosynthetic performance of cultures in the exponential phase was assayed further with a Fluorescence Induction and Relaxation Fluorometer System (Satlantic Incorporated, Halifax, Nova Scotia, Canada) as described by Liu & Qiu (2012). The rate constant for relaxation of the primary quinone-type acceptor (QA) or plastoquinone (PQ) was the first one retrieved from a three-component exponential kinetic analysis (Kolber et al., 1998).

The 77 K fluorescence emission spectra of the samples were measured by a Hitachi F-4500 fluorescence spectrophotometer (Hitachi High-Technologies Co., Tokyo, Japan) as described by Volkmer et al. (2007). All samples were at a concentration of about 2 μg Chl a mL−1. Excitation and emission were carried out with a bandwidth of 10 and 5 nm, respectively. Upon chlorophyll excitation at 435 nm, the fluorescence emission spectra were recorded within 620–740 nm. According to Murakami (1997), the PSI/PSII fluorescence ratios in cyanobacteria correlate closely with their photosystem stoichiometry.

Photosynthetic oxygen exchange measurements

Samples were harvested by centrifugation, and dark respiration was determined at 32 °C with a Clark-type oxygen electrode (Chlorolab 2, Hansatech Instruments) as described by Liu et al. (2010). The PSII activity was determined at 550 μmol photons m−2 s−1 with H2O as the electron donor and p-benzoquinone (p-BQ) as the electron acceptor in the presence of 1 mM p-BQ and 1 mM potassium ferricyanide.

Results

A Synechocystis 6803 ΔpetE mutant was constructed by insertion of a kanamycin resistance marker. A map of the petE gene knockout and the PCR analysis of the mutant line are shown in Fig. 1a and c. These results confirmed that the petE gene had been completely knocked out. When cultured in BG11 medium under continuous light or a light–dark photoperiod, the specific growth rate of the mutant and wild type showed no statistically significant difference (t-test, > 0.05) (Table 1). This indicated that the mutant line could grow as well as the wild type and its basic cytochrome c6 level could perform normal electron transfer in photosynthetic and respiratory processes.

Table 1. Specific growth rate and pigment contents of wild-type and ΔpetE strains cultured under a light–dark photoperiod or continuous light
ParametersLight–dark photoperiodContinuous light
Wild typeΔpetEWild typeΔpetE
  1. *,†Those with different superscript symbols for the same growth condition are significantly different (t-test, < 0.05). Mean ± SD (= 4).

Specific growth rate (per days)0.90 ± 0.03*0.89 ± 0.01*1.13 ± 0.03*1.09 ± 0.03*
Chl a (μg per 108 cell)3.10 ± 0.21*2.63 ± 0.022.87 ± 0.09*3.01 ± 0.15*
CAR (μg per 108 cell)0.91 ± 0.05*0.76 ± 0.021.84 ± 0.24*2.02 ± 0.19*
PC (μg per 108 cell)1.48 ± 0.24*1.77 ± 0.49*1.72 ± 0.52*1.89 ± 0.54*
PC/Chl a0.47 ± 0.09*0.68 ± 0.170.60 ± 0.19*0.63 ± 0.19*

Although the ΔpetE and wild-type Synechocystis 6803 showed similar growth rates, the ΔpetE cultures were a more intense blue than those of the wild type under a light–dark photoperiod (Fig. 2a), but looked the same under continuous light (Fig. 2b). To exclude a second mutation site and a polar effect, a complementation strain was constructed whereby a ‘new’ petE gene was expressed in the slr0168 platform (Williams, 1988; Jiang et al., 2012) (Fig. 1b). As shown in Fig. 2a, the color of cultures was restored in the complementation strain at a similar level to that observed in the wild type, which confirmed that the phenotype was indeed caused by mutation of the petE gene.

Figure 2.

Color and absorption spectra of wild-type, ΔpetE, and complementation (Com) strains at the same OD730 value. Peaks at 440 and 682 nm are due to chlorophyll a, while the peak at 630 nm is due to phycocyanin. Spectra were normalized to phycocyanin absorption at 630 nm. Samples were grown under a light–dark photoperiod (a, c) or continuous light (b, d).

Under a light–dark photoperiod, the ΔpetE strain showed reduced Chl a and CAR contents per cell compared with the wild-type strain (t-test, < 0.05), while little difference in PC contents was observed between the two lines (t-test, > 0.05) (Table 1). Consequently, the PC to Chl a ratio significantly increased in ΔpetE, which could be the main reason that it was bluer than its wild-type counterpart. However, the pigment content of the ΔpetE and wild-type strains showed no significant difference when cultured under continuous light (t-test, > 0.05) (Table 1). While the absorption spectra of the ΔpetE and wild-type strains showed that the PC to Chl a ratio increased markedly in ΔpetE compared with the wild-type strain under a light–dark photoperiod (Fig. 2c), only a slight change was apparent under continuous light (Fig. 2d).

The functional absorption cross section of PSII (σPSII) in ΔpetE decreased significantly compared with the wild-type strain under a light–dark photoperiod (t-test, < 0.05) (Table 2). However, the efficiency of light capture (α) in ΔpetE was significantly higher than in the wild-type strain under a light–dark photoperiod (t-test, < 0.05) (Table 2); this indicates the efficiency of energy transfer from the light-harvesting antenna to the PSII reaction centers and the trapping efficiency of the PSII reaction centers (Qiu & Price, 2009). In addition, NPQ in the ΔpetE strain increased significantly compared with the wild type under a light–dark photoperiod (t-test, < 0.05) (Table 2), which involved the dissipation of excess excitation energy as heat (Karapetyan, 2008). However, under continuous light, all of these parameters showed little difference between the ΔpetE and wild-type strains (t-test, > 0.05) (Table 2). The connectivity factor between individual PSII photosynthetic units (ρ) is defined as the probability that an exciton hitting a closed reaction center will be transmitted to an open reaction center (Joliot & Joliot, 1964). Compared with the wild-type strain, the ρ value of the ΔpetE strain decreased significantly under a light–dark photoperiod and continuous light (t-test, < 0.05) (Table 2). This implies that the ΔpetE strain's ability to prevent overexcitation of reaction centers by promptly transmitting the excess excitations to other open reaction centers was depressed compared with the wild-type strain.

Table 2. Chlorophyll fluorescence parameters for wild-type and ΔpetE strains cultured under a light–dark photoperiod or continuous light
ParametersLight–dark photoperiodContinuous light
Wild typeΔpetEWild typeΔpetE
  1. *,†Those with different superscript symbols for the same growth condition are significantly different (t-test, < 0.05). Mean ± SD (= 6–17).

σPSII2 quanta−1)62.83 ± 13.38*54.16 ± 9.9058.81 ± 12.53*55.18 ± 9.19*
α0.157 ± 0.019*0.174 ± 0.0180.149 ± 0.010*0.159 ± 0.018*
NPQ0.257 ± 0.052*0.387 ± 0.0720.374 ± 0.087*0.411 ± 0.072*
ρ0.199 ± 0.101*0.101 ± 0.0360.167 ± 0.077*0.085 ± 0.016
rETRmax62.64 ± 10.45*74.40 ± 10.3366.41 ± 15.76*72.07 ± 17.18*
τQa (μs)31.1 ± 13.7*122.1 ± 66.131.0 ± 7.7*129.1 ± 44.8
τPQ (μs)733.2 ± 143.1*585.1 ± 156.9853.9 ± 108.9*573.0 ± 105.0

Under a light–dark photoperiod, the rETRmax of the ΔpetE strain was higher than that of the wild type (t-test, < 0.05) (Table 2). This result is indicative of the relative number of electrons passing through PSII during steady-state photosynthesis. The kinetics of chlorophyll fluorescence relaxation following single turnover or multiple turnover flashes were used to evaluate the time constant for electron transport on the PSII acceptor side (τQa) or between PSII and PSI (τPQ), respectively. Compared with the wild-type strain, the τQa value for ΔpetE was significantly higher, while its τPQ value was significantly lower, under light–dark photoperiod and continuous light conditions (t-test, < 0.05) (Table 2). These results indicate that QA reoxidation in ΔpetE was delayed, while its PQ pool reoxidation accelerated.

Under a light–dark photoperiod and continuous light, the PSII activity of ΔpetE was similar to that of the wild-type control (t-test, > 0.05) (Table 3). However, dark respiration in ΔpetE was significantly higher than in the wild-type control (t-test, < 0.05), which was restored to the level of the wild type in the complementation strain (Table 3).

Table 3. PSII activity and dark respiration in wild-type, ΔpetE, and complementation (Com) strains cultured under a light–dark photoperiod or continuous light
ParametersLight–dark photoperiodContinuous light
Wild typeΔpetEComWild typeΔpetE
  1. *,†Those with different superscript symbols for the same growth condition are significantly different (t-test, < 0.05). Mean ± SD (= 3–4).

PSII activity (μmol O2 mg−1 Chl a h−1)207.3 ± 21.1*212.6 ± 25.8*190.4 ± 14.9*135.5 ± 13.8*150.92 ± 7.9*
Dark respiration (μmol O2 mg−1 Chl a h−1)29.15 ± 3.40*44.26 ± 3.8229.41 ± 5.28*17.10 ± 3.45*28.20 ± 1.10

The fluorescence emission spectra of the Synechocystis 6803 wild-type and ΔpetE strains are shown in Fig. 3. After normalization of the PSII peak at 685 nm, it was evident that ΔpetE had a relatively decreased PSI peak, which is indicative of a significantly decreased PSI/PSII ratio in the mutant compared with the wild-type strain under a light–dark photoperiod or continuous light (t-test, < 0.05) (Fig. 3).

Figure 3.

The 77 K fluorescence emission spectra of Synechocystis 6803 with 435 nm excitation. Wild-type and ΔpetE strains were grown under a light–dark photoperiod (a) or continuous light (b). For better comparability between these two strains, the spectra were normalized at 685 nm.

Discussion

Many studies have investigated the physiological functions of plastocyanin under continuous light (Clarke & Campbell, 1996; Díaz-Quintana et al., 2003; Durán et al., 2004; Navarro et al., 2005). Clarke & Campbell (1996) observed a slight increase in the PC/Chl a ratio of the Synechococcus PCC 7942 ΔpetE strain under continuous light. In the present study, little difference in the PC/Chl a ratio between the Synechocystis 6803 ΔpetE strain and its wild-type counterpart under continuous light was observed. However, a significant increase in this ratio was noted in ΔpetE under a light–dark photoperiod (Table 1). As a result, ΔpetE cultures were a darker blue than those of the wild-type control under a light–dark photoperiod, but looked identical under continuous light (Fig. 2a and b). From Fig. 2a, it is clear that the color of the ΔpetE strain can be complemented after introduction of the petE gene into the ΔpetE mutant. This confirms that the phenotypes described herein are caused by the petE mutation, thus excluding the possibility of a second mutation site and a polar effect.

A previous study in Synechococcus PCC 7942 showed that the PSI/PSII ratio in the ΔpetE mutant decreased under continuous light, which was consistent with a slight increase in the PC/Chl a ratio (Clarke & Campbell, 1996). In the present study, the PSI/PSII ratio decreased in the Synechocystis 6803 ΔpetE strain not only under continuous light but also under a light–dark photoperiod (Fig. 3). This could result from a decrease in PSI content or an increase in PSII content. According to the PSII activity recorded for the ΔpetE and wild-type strains (Table 3), it can be concluded that the PSII content was constant in these two strains. Thus, the reduced PSI/PSII ratio in ΔpetE was mainly caused by a decrease in PSI content. Fujita & Murakami (1987) hypothesized that PSI variation is induced in response to the redox state of the electron pool between the two photosystems. Furthermore, the cytochrome b6f redox state was considered a key factor for regulating the formation of PSI in Synechocystis PCC 6714 (Murakami & Fujita, 1991a, b, 1993). Additionally, some studies showed that PSI reduction is usually observed when the photosynthetic electron transfer chain is altered (Schneider et al., 2001; Volkmer et al., 2007; Fuhrmann et al., 2009). In the present study, the petE deletion slowed the QA reoxidation rate, but accelerated reoxidation of the PQ pool (Table 2). Thus, in the ΔpetE strain, QA was in a more reduced state, while the PQ pool was in a more oxidative state than in the wild-type control. There is a competitive relationship between the electron flow to O2 and that to PSI in cyanobacteria where the respiratory electron flow and photosynthetic electron transport share the same PQ pool and cytochrome b6f in the thylakoid membrane (Campbell et al., 1998). We noted that dark respiration in ΔpetE increased significantly compared with the wild-type strain (Table 3). This finding could explain the more oxidized PQ pool in ΔpetE although its PSI content was lower than that in the wild-type control. Furthermore, several studies show that when the PQ pool becomes more oxidized, PSI gene transcription is repressed in chloroplasts (Pfannschmidt et al., 1999a, b; Puthiyaveetil et al., 2012). Therefore, it was suggested that the more oxidative state of the PQ pool in the ΔpetE strain inactivated PSI gene transcription and subsequently decreased the PSI content.

In cyanobacteria, chlorophylls are generally bound to PSI (Shen et al., 1993; Jordan et al., 2001), and reduced cellular chlorophyll content has frequently been linked with the PSI content of the cell (Wilde et al., 2004; Fuhrmann et al., 2009). In this study, the PSI content decrease in the ΔpetE strain was observed not only under a light–dark photoperiod but also under continuous light. Under continuous light, the chlorophyll content of the ΔpetE strain did not decrease. However, the σPSII value decreased significantly in ΔpetE compared with the wild-type control under a light–dark photoperiod only (Table 2). The crystal structure of cyanobacterial PSII has been well studied, and the core antenna subunits (CP43 and CP47) bind 13 and 16 chlorophylls, respectively (Zouni et al., 2001; Umena et al., 2011). Thus, decreased σPSII may result from the reduced chlorophyll content of the ΔpetE strain under a light–dark photoperiod.

The rETRmax in Synechococcus PCC 7942 ΔpetE was significantly reduced relative to the wild type (Clarke & Campbell, 1996). In the present study, there was little difference between Synechocystis 6803 ΔpetE and wild-type strains under continuous light. However, the rETRmax in ΔpetE was significantly higher than that in the wild-type strain under a light–dark photoperiod (Table 2). In cyanobacteria, NPQ mainly reflects the state transition mechanism, and the absolute value of NPQ is influenced by the underlying phycobiliprotein fluorescence, which contributes to both Fm and Fm′ (Campbell et al., 1998). NPQ in the Synechococcus PCC 7942 ΔpetE increased significantly under continuous light (Clarke & Campbell, 1996). In our study, NPQ in the Synechocystis 6803 ΔpetE strain was significantly higher than in the control under a light–dark photoperiod, but only slightly higher than that in the control under continuous light (Table 2). Recent studies have shown that the soluble orange CAR protein plays an essential role in the blue light–induced NPQ mechanism (Rakhimberdieva et al., 2004; Wilson et al., 2007), which can be explained by the enhanced energy dissipation from allophycocyanin in the phycobilisome core (Rakhimberdieva et al., 2007). Nevertheless, the CAR content decreased significantly in ΔpetE under light–dark conditions (Table 1). Thus, the reason why NPQ in the ΔpetE strain increased significantly under a light–dark photoperiod needs further study.

Cyanobacteria can use several redox-active components in thylakoids for both photosynthesis and respiration, including the PQ pool, the cytochrome b6f complex, and plastocyanin or cytochrome c6 (Binder, 1982; Vermaas, 2001). A previous study in Synechococcus PCC 7942 showed that the ΔpetE strain exhibited no significant increase in dark respiration when compared with the wild type (Clarke & Campbell, 1996). However, in this study, the rate of dark respiration in the Synechocystis 6803 ΔpetE strain increased significantly compared with its wild-type counterpart, and the phenotype could be complemented (Table 3). It is clear that PSI and cytochrome oxidase are in direct competition for electrons passing through the PQ pool (Dominy & Williams, 1987; Scherer et al., 1988). The PSI content in the Synechocystis 6803 ΔpetE strain decreased significantly, thus allowing cytochrome oxidase to obtain more electrons from the PQ pool. Therefore, the rate of dark respiration in ΔpetE increased significantly under a light–dark photoperiod and continuous light.

Acknowledgements

This study was funded by the National Natural Science Foundation of China (No. 31170309 and No. 31100184).

Ancillary