Engineering of a functional thermostable kanamycin resistance marker for use in Moorella thermoacetica ATCC39073

Authors


Correspondence: Yutaka Nakashimada, 1-3-1 Kagamiyama, Higashi-Hiroshima, Hiroshima 739-8530, Japan. Tel.: +81 82 424 4443; fax: +81 82 424 4443; e-mail: nyutaka@hiroshima-u.ac.jp

Abstract

A transformation system for Moorella thermoacetica ATCC39073 was developed using thermostable kanamycin resistant gene (kanR) derived from the plasmid pJH1 that Streptococcus faecalis harbored. When kanR with its native promoter was introduced into uracil auxotrophic mutant of Mthermoacetica ATCC39073 together with a gene to complement the uracil auxotrophy as a selection marker, it did not give kanamycin resistance due to poor transcription level of kanR. However, the use of glyceraldehyde-3-phosphate dehydrogenase promoter cloned from M. thermoacetica ATCC39073 significantly improved transcription level of kanR and resulted in the cell growth in the presence of more than 150 μg mL−1 kanamycin. It was also demonstrated that kanR with G3PD promoter can be used as a selection marker for transformation of wild-type strain of Mthermoacetica ATCC39073.

Introduction

Syngas fermentation is a biological process to produce useful metabolites using chemolithotrophs that catabolize the mixed gas of H2, CO, and CO2 generated by gasification of various organic substances. The biological production of fuels and chemicals through syngas fermentation offers several advantages over conventional sugar fermentation technology. For example, in syngas fermentation, whole biomass including non-degradable components such as lignin and/or non-biological organic substances such as wastes plastics can be used as the substrates via gasification. The syngas fermentation also offers several advantages over chemical conversion with metal catalysts such as its high specificity, no requirement of a highly specific H2 plus CO or CO2 ratio, and no contamination by metal poisoning (Henstra et al., 2007; Abubackar et al., 2011).

A group of anaerobic bacteria known as acetogens that can grow autotrophically (Drake et al., 2008) have been investigated for syngas fermentation. In mesophilic acetogens such as Clostridium ljungdahlii (Klasson et al., 1993) and Clostridium autoethanogenum (Abrini et al., 1994), ethanol production from syngas has been reported. Also, thermophilic acetogens such as Moorella sp. HUC22-1 (Sakai et al., 2004, 2005), which is closely related to Moorella thermoacetica ATCC39073 (Pierce et al., 2008), have been investigated for ethanol production from H2-CO2. The use of thermophilic bacteria for syngas fermentation will facilitate the recovery of ethanol because aqueous ethanol will readily vaporize at temperatures over 50 °C, so that it will enable continuous distillation of ethanol. Furthermore, thermophilic bacteria have higher growth and metabolic rates than mesophilic bacteria, and there is low risk of microbial contamination (Payton, 1984; Taylor et al., 2009). In this context, thermophilic acetogens Moorella spp. should be more promising candidates for syngas fermentation than mesophilic bacteria.

To improve the production of biofuel and renewable materials from syngas by Moorella spp., molecular breeding will be indispensable. In previous research, therefore, we have developed genetic transformation and heterologous expression system for the type strain of M. thermoacetica ATCC39073 (Kita et al., 2013). The transformation system consists of an orotate monophosphate decarboxylase gene (pyrF) deletion mutant, strain dpyrF, as a transformation host and a pyrF gene as the positive marker to recover uracil auxotrophy. Using the developed transformation system, we successfully constructed a lactate-producing mutant of strain dpyrF that expressed lactate dehydrogenase gene from Thermoanaerobacter pseudethanolicus ATCC33233 (Kita et al., 2013). This clearly demonstrated that the developed system could be used as a genetic tool for improved production by thermophilic acetogens of target metabolites such as alcohols or fatty acids. However, as the selection marker that could be used in the developed system was only one, this constraint made multiple gene manipulations of the bacterium difficult. Furthermore, the selection of the auxotrophic mutant is time-consuming work if an alternative strain is used as the host strain. The use of antibiotic resistant gene as a selection marker was considered to be one solution to overcome such shortcomings of the present screening system, but such markers have not been reported for Moorella spp. so far. In this study, we report the functional expression of heterologous thermostable kanamycin resistance gene in Mthermoacetica, under control of the promoter of the native glyceraldehyde-3-phosphate dehydrogenase, and can be used as a genetic tool for gene manipulation of Mthermoacetica.

Materials and methods

Strains and culture conditions

Moorella thermoacetica ATCC39073 (wild type) and its derivative strains were cultured in modified ATCC 1754 PETC medium (Tanner et al., 1993) without yeast extract as the basal medium. The basal medium contained 1.0 g of NH4Cl, 0.1 g of KCl, 0.2 g of MgSO4·7H2O, 0.8 g of NaCl, 0.1 g of KH2PO4, 0.02 g of CaCl2·2H2O, 2.0 g of NaHCO3, 10 mL of Trace elements (Tanner, 1989), 10 mL of Wolfe's vitamin solution (Tanner, 1989), and 1.0 mg of Resazurin per liter of deionized water. 125- and 50-mL serum bottles were used for cultivation. Moorella thermoacetica strains were anaerobically cultured at 55 °C with shaking in the medium with 6.5 of initial pH. Medium was generally supplemented with H2 plus CO2 or 60 mM fructose as the sole carbon source. To culture strains in H2 plus CO2, bottles were flushed with a filter-sterilized H2 plus CO2 mixture (80 : 20 v/v) after inoculation and adjusted to 0.15 MPa final pressures. In fructose culture, the gas phase of bottle was filled with CO2. When the pyrF deletion mutant of Mthermoacetica ATCC39073, strain dpyrF, was cultured, 10 μg mL−1 of uracil was supplemented into the medium. When kanR insertion mutants were cultured, 150 or 300 mg mL−1 of the kanamycin was added to the basal medium.

Construction of plasmids

pK18mob (Schäfer et al., 1994) was used as the backbone plasmid of pK18-pyz and pK18-ldh in our previous study (Kita et al., 2013). The plasmids derived from pK18mob did not replicate in Mthermoacetica ATCC39073 (Y. Iwasaki unpublished data). To construct plasmid pK18-kan1 (Fig. 1a), the kanamycin resistant gene (kanR) and its native promoter from pIKM1(Mai et al., 1997) were amplified using primer set of kanRpro-in-F/kanR-in-R (Table 1) and then cloned into pK18-pyz (Kita et al., 2013), which was amplified by inverse PCR using primer set of pK18-pyrF–F/pK18-pyrF-inv-R (Table 1) using the In-Fusion Advantage PCR Cloning Kit (Clontech Laboratories, Inc., Mountain View, CA). pK18-pyz was originally constructed to insert the pyrF gene with 500 bp of partial lacZ gene of Tpseudethanolicus ATCC33223 into the genome of strain dpyrF.

Table 1. Oligonucleotides used for PCR and qRT-PCR
PrimerSequence (5′ to 3′)
Primers for PCR
kanRpro-in-FGGTGAAATAATAACTCTACCAAGACGAAGAG
kanR-in-FAAGGAGGAGTACATAATGGCTAAAATGAGAATATCAC
kanR-in-RATGAAAGCAGGCCGACTAAAACAATTCATCCAGTAA
pK18F-pyrF–FTCGGCCTGCTTTCATGCTTG
pK18-pyrF-inv-RAGTTATTATTTCACCATCTCTATTTCC
pyrF-ldh-inv-FTCGGCCTGCTTTCATGC
pyrF-inv-RTATGTACTCCTCCTTATATTTATTG
pyrF-up-FTGACGTGGAAGATGAGGTACACC
pyrF-dn-RTGGCTCCACGCCAAGGATATC
pyrF-ed-FCTCCTACCTGGTCATCGG
pyrF-ed-RGTTCCATCGTGTCATCACCTG
Primers for qRT-PCR
For measurement of gyrB mRNA
gyrB-RT-FCAGATTCTAGAAGGTCTGGAAGC
gyrB-RT-RGTCGATGCTGTTGTCGACC
For measurement of kanR mRNA
kanr-RT-FAAGCCCGAAGAGGAACTTGTC
kanr-RT-RGCAGAAGGCAATGTCATACCAC
Figure 1.

Construction of plasmids and detection of kanR in transformants using PCR. pyrF, pyrF 5′, and pyrF 3′ represent pyrF gene, 5′ – flanking region and 3′ – flanking region of pyrF gene, respectively. (a) Plasmid pK18-kan1 has kanR with its native promoter downstream of pyrF gene. Plasmid pK18-kan2 has kanR with G3PD promoter derived from Moorella thermoacetica ATCC39073 on downstream of pyrF gene. Plasmids were introduced into the strain dpyrF or WT (Mthermoacetica ATCC39073) by electroporation, and kanR was inserted on target region of the genome by homologous recombination. Left and right arrows indicate forward (pyrF-up-F) and reverse (pyrF-dn-R) primers, respectively, for PCR analysis. (b) PCR analysis for checking the insertion of a fragment of the size of pyrF-kanR from the microbial genome. Lane M: DNA ladder marker; Lane 1: 4.5-kb PCR fragment from Mthermoacetica ATCC39073; Lane 2: 3.7-kb PCR fragment from strain dpyrF; Lane 3: 5.7-kb PCR fragment from strain DPK1; Lane 4: 5.5-kb PCR fragment from strain DPK2. (c) PCR analysis for checking kanR insertion of a fragment of the size of pyrF-kanR into Mthermoacetica ATCC39073. Lane M: DNA ladder marker; Lane 1: 4.5-kb PCR fragment form Mthermoacetica ATCC39073; Lane 2: 5.5-kb PCR fragment from strain MTK2.

To construct a plasmid pk18-kan2 (Fig. 1a), kanR from pIKM1 were amplified using primer set of kanR-in-F/kanR-in-R (Table 1). The plasmid pk18-ldh (Kita et al., 2013) was amplified to obtain the backbone plasmid harboring the pyrF and the promoter of glyceraldehyde-3-phosphate dehydrogenase (G3PD) gene including its SD sequence from M. thermoacetica ATCC39073 by inverse PCR using the primer set pyrF-ldh-inv-F/pyrF-inv-R (Table 1). pK18-ldh was originally constructed to insert the pyrF with lactate dehydrogenase gene (T-ldh) of Tpseudethanolicus ATCC33223 fused with the G3PD promoter and its SD sequence region of Mthermoacetica ATCC39073 into the genome of strain dpyrF. The pk18-kan2 was obtained by cloning kanR into the backbone plasmid using the In-Fusion Advantage PCR Cloning Kit (Clontech Laboratories).

Transformation and selection of mutants

All procedures were performed under aerobic condition except that cells were grown in anaerobic condition. Moorella thermoacetica ATCC39073 and strain dpyrF were cultured in the basal medium supplemented with H2 plus CO2 and harvested by centrifugation (5,800 g for 10 min at 4 °C) at OD600 nm = 0.1–0.15. The cells were then washed twice and resuspended in 272 mM sucrose buffer. Plasmids were introduced into Mthermoacetica ATCC39073 or strain dpyrF by electroporation using an Electro Cell Manipulator 620 (BTX, San Diego, CA). Plasmid DNA (1–2 μg) was added to 400 μL cell suspensions in an electroporation cuvette with 2 mm gap. Cells were pulsed at 1.5 kV, 500 Ω, and 50 μF and immediately inoculated into 5-mL basal medium with 2 g L−1 fructose and 10 μg mL−1 uracil. The cell suspension was incubated at 55 °C for 48 h. The cell suspension was then inoculated into 125-mL serum bottle containing 15 mL of basal medium and 2% of agarose, and the roll-tube method (Hungate, 1969) was used for colony formation. Colonies were obtained after 5–6 days incubated at 55 °C. Isolated colonies were inoculated into 5-mL of basal medium with 2 g L−1 fructose and anaerobically cultured at 55 °C in 50-mL serum bottles. Uracil (10 μg mL−1) or kanamycin (150 or 300 mg L−1) was added to the medium as needed.

DNA sequence

Genomic DNA was extracted using NucleoSpin Tissue (Macherey-Nagel, Düren, Germany). To check if DNA fragments integrated into the genome were correct, the pyrF including the flanking region DNA was amplified using polymerase chain reaction (PCR) using KOD FX Neo (Toyobo, Tokyo, Japan) and primer set pyrF-up-F/pyrF-dn-R (Table 1). The DNA sequences of PCR fragments were analyzed using primer set pyrF-ed-F/pyrF-ed-R by Hokkaido System Science (Sapporo, Japan). Nucleotide sequence similarities were analyzed using Genetyx software (Genetyx, Tokyo, Japan).

Quantitative reverse transcription PCR (qRT-PCR)

Cells were cultured in media supplemented with fructose. Cells were harvested by centrifugation when OD600 nm reached 0.1–0.15. Total RNA was extracted from Mthermoacetica cells using NucleoSpin RNA II kit (Macherey-Nagel) with RNAprotect bacterial reagent (QIAGEN, Valencia, CA) to stabilize RNA. A One Step SYBR PrimeScript PLUS RT-PCR Kit (Takara Bio) was used for cDNA generation and for qRT-PCR. qRT-PCR was performed using a LightCycler system (Roche Diagnostics, Basel, Switzerland) with reverse transcription at 42 °C for 5 min followed by 40 cycles of denaturation (95 °C for 5 s), primer annealing (55 °C for 30 s), and extension (72 °C for 30 s). The primer sets listed in Table 1 were used for the qRT-PCR. gyrB mRNA was used as an internal standard.

Results and discussion

A kanamycin resistant gene (kanR) derived from the plasmid pJH1 that Streptococcus faecalis JH2-15 harbored (Trieu-Cuot & Courvalin, 1983) was selected as a candidate of an antibiotic marker for M. thermoacetica because it has been used for transformation of several anaerobic thermophiles such as Thermoanaerobacterium sp. strain JW/SL-YS485 (Mai et al., 1997) and Clostridium thermocellum (Tyurin et al., 2004), which are relatives of Moorella spp.

To investigate whether kanR is expressed in M. thermoacetica under the control of its native promoter used in pIKM1, pK18-kan1 was constructed to introduce kanR with the native promoter into M. thermoacetica genome by means of homologous recombination (Fig. 1a). pK18-kan1 was introduced into strain dpyrF derived from Mthermoacetica ATCC39073 by electroporation. Then, uracil auxotrophs were isolated by roll-tube method. PCR analysis using primer set pyrF-up-F/pyrF-dn-R (Table 1) confirmed the insertion of a fragment of the size of pyrF- kanR with its native promoter in to the target locus on the genome in all of randomly picked 20 integrants, respectively, as shown in lane 3 of Fig. 1b. One strain was chosen among the 20 integrans and designated strain DPK1. Then, the PCR fragment of strain DPK1 were sequenced, and confirmed that fragment of pyrF-kanR derived from pK18-kan1 was certainly inserted into target region (data not shown) on the genome of strain DPK1. However, the integrants including strain DPK1 could not be grown on basal medium supplemented with 150 or 300 μg mL−1 of kanamycin.

Two plausible reasons for lack of kanamycin resistance of strain DPK1 were that in Mthermoacetica ATCC39073 the native promoter of kanR did not work or the kanamycin resistant protein did not function. Therefore, the transcriptional level of kanR was measured by qRT-PCR analysis. Fig. 2 shows the transcriptional levels of kanR in strains cultured in the basal medium with fructose as the sole carbon source. The kanR transcriptional level of DPK1 was only c. 1% of gyrB mRNA. This suggested poor transcriptional level of the native promoter of kanR in Mthermoacetica ATCC39073.

Figure 2.

Transcriptional analysis of the kanR gene. Strains were cultured in the basal medium with fructose. The mRNA transcriptional levels of kanR was normalized to that of the DNA gyrase subunit B gene (gyrB). The mean ± standard deviations (error bars) for three independent replicates are shown. WT, DPK1 and DPK2 represent Moorella thermoacetica ATCC39073, strain DPK1 and strain DPK2, respectively.

Previously, we found that promoter and SD sequence regulating the glyceraldehyde-3-phosphate dehydrogenase (G3PD) gene could be used as an effective promoter for heterologous expression of lactate dehydrogenase gene (T-ldh) from Tpseudethanolicus ATCC33223 to produce lactate in Mthermoacetica (Kita et al., 2013). Therefore, the G3PD promoter from Mthermoacetica ATCC39073 was used to replace the native kanR promoter to construct pK18-kan2.

Strain dpyrF was successfully transformed by electroporation with pK18-kan2 as mentioned above and selection by recovery of uracil auxotrophs. PCR analysis using primer set of pyrF-up-F/pyrF-dn-R confirmed the insertion of a fragment of the size of pyrF - kanR into the target region of the integrants genome in all of 20 randomly picked integrants as shown in lane 4 of Fig. 1b. One strain among the 20 integrants was chosen and designated strain DPK2. The PCR fragment derived from the strain DPK2 was sequenced, and confirmed that fragment of pyrF-kanR derived from pK18-kan2 was certainly inserted into target region (data not shown). The integrants could be grown on basal medium supplemented 150 and 300 μg mL−1 of kanamycin. The qRT-PCR analysis revealed that the transcription level of the kanR in strain DPK2 was 50-fold higher than strain DPK1 (Fig. 2). The results demonstrated that the translation product of kanR under the control of G3PD promoter resulted in kanamycin resistance of Mthermoacetica ATCC 39073.

To investigate the effect of kanamycin concentration on the growth of the integrants, Mthermoacetica ATCC39073 (wild strain), strains DPK1 and DPK2 were grown in basal medium supplemented with 150 and 300 μg mL−1 kanamycin. The growth of the strains DPK1 and DPK2 were similar to those of wild strain in the basal medium without kanamycin (Fig. 3a). Moorella thermoacetica ATCC39073 and strain DPK1 could not grow in the basal medium supplemented with more than 150 μg mL−1 kanamycin (Fig. 3b and c). On the other hand, only strain DPK2 could grow in the basal medium supplemented with more than 150 μg mL−1 kanamycin (Fig. 3b and c).

Figure 3.

Growth of Moorella thermoacetica ATCC39073, strain DPK1 and DPK2 in the presence of kanamycin. Error bars represent data from triplicate samples. Basal medium with fructose as a sole carbon source was used for growth medium. (a) Growth in the absence of kanamycin, (b) growth in the presence of 150 μg mL−1 kanamycin, (c) growth in the presence of 300 μg mL−1 kanamycin. Square, Mthermoacetica ATCC39073; circle, strain DPK1; triangle, strain DPK2.

We examined whether kanR with G3PD promoter can be used as the selection marker for transformation of Mthermoacetica ATCC39073. Moorella thermoacetica ATCC39073 was transformed with pK18-kan2 by electroporation. The integrants were isolated using a roll-tube technique with supplementation of 300 μg mL−1 kanamycin. In ten randomly selected candidates of pyrF - kanR integrants, the insertion of kanR into the region downstream of pyrF was confirmed by PCR analysis using primers pyrF-up-F and pyrF-dn-R (Fig. 1c). One of ten integrants was chosen and designated strain MTK2. The PCR fragment of the strain MTK2 was sequenced, and confirmed that fragment of pyrF-kanR derived from pK18-kan2 was certainly inserted into target region on the genome of strain MTK2 (data not shown). This result demonstrated that kanR with G3PD promoter can be used as a selection marker for transformation of wild-type strain of Mthermoacetica ATCC39073.

Authors′ contribution

Y.I. and A.K. contributed equally to this work.

Ancillary