Identification of a molecular signature unique to metal-reducing Gammaproteobacteria

Authors


Abstract

Functional genes required for microbial (dissimilatory) metal reduction display high sequence divergence, which limits their utility as molecular biomarkers for tracking the presence and activity of metal-reducing bacteria in natural and engineered systems. In the present study, homologs of the outer membrane beta-barrel protein MtrB of metal-reducing Gammaproteobacteria were found to contain a unique N-terminal CXXC motif that was missing from MtrB homologs of nonmetal-reducing Gammaproteobacteria and metal- and nonmetal-reducing bacteria outside the Gammaproteobacteria. To determine whether the N-terminal CXXC motif of MtrB was required for dissimilatory metal reduction, each cysteine in the CXXC motif of the representative metal-reducing gammaproteobacterium Shewanella oneidensis was replaced with alanine, and the resulting site-directed mutants were tested for metal reduction activity. Anaerobic growth experiments demonstrated that the first, but not the second, conserved cysteine was required for metal reduction by S. oneidensis. The ability to predict metal reduction by Gammaproteobacteria with unknown metal reduction capability was confirmed with Vibrio parahaemolyticus, a pathogen whose genome encodes an MtrB homolog with an N-terminal CXXC motif. MtrB homologs with an N-terminal CXXC motif may thus represent a molecular signature unique to metal-reducing members of the Gammaproteobacteria.

Introduction

Dissimilatory metal-reducing bacteria occupy a central position in a variety of environmentally important processes, including the biogeochemical cycling of carbon and metals, the bioremediation of radionuclides and organohalides, and the generation of electricity in microbial fuel cells (Lovley & Coates, 1997; Thamdrup, 2000; Lovley et al., 2004; Logan, 2009). Metal-reducing bacteria are scattered and deeply rooted throughout both prokaryotic domains (Lonergan et al., 1996; Vargas et al., 1998). Functional genes required for microbial metal reduction display high sequence divergence, which limits their use as molecular biomarkers to examine fundamental ecological principles and environmental parameters controlling metal reduction in both natural and engineered systems. A variety of c-type cytochromes, for example, are key components of the electron transport systems of many metal-reducing bacteria (Weber et al., 2006; Richter et al., 2012), yet their widespread occurrence in nonmetal-reducing bacteria and high sequence divergence limit their utility as molecular biomarkers for tracking the presence and activity of metal-reducing bacteria as a functional group. The gene encoding the eukaryotic-like citrate synthase (gltA) in the Geobacteraceae family has received attention as a molecular biomarker for tracking the presence and activity of metal-reducing Geobacteraceae in subsurface environments (Bond et al., 2005; Wilkins et al., 2011). However, gltA is found only in members of the Geobacteraceae family, thus limiting its application as a molecular biomarker for metal-reducing bacteria outside the Geobacteraceae family.

The large γ-proteobacteria class within the phylum Proteobacteria (Williams et al., 2010) was selected as a bacterial group to search for molecular signatures unique to metal-reducing bacteria outside the Geobacteraceae family. The large number of genera (over 250) and complete or nearly complete genomes (over 200) in the γ-proteobacteria class (Williams et al., 2010) facilitates nucleotide sequence comparisons of genes in both metal- and nonmetal-reducing bacteria, potentially aiding in the identification of molecular signatures unique to metal-reducing γ-proteobacteria. The γ-proteobacteria class includes Shewanella oneidensis, a gram-negative, facultative anaerobe that reduces a wide range of metals, including Fe(III) and Mn(IV) as terminal electron acceptor (Myers & Nealson, 1988; Venkateswaran et al., 1999). Shewanella oneidensis employs a number of novel respiratory strategies for dissimilatory metal reduction, including (1) localization of c-type cytochromes on the cell surface (or along extracellular nanowires) where they may deliver electrons to external metals (Myers & Myers, 1992; DiChristina et al., 2002; Gorby et al., 2006); (2) nonreductive dissolution of metal oxides to form more readily reducible organic metal complexes (Taillefert et al., 2007; Fennessey et al., 2010; Jones et al., 2010); and (3) delivery of electrons to external metals via endogenous or exogenous electron shuttles (Hernandez et al., 2004; Marsili et al., 2008; Roden et al., 2010).

Shewanella oneidensis contains an electron transport chain that consists of IM-localized primary dehydrogenases, menaquinone, and CymA, a menaquinol-oxidizing c-type cytochrome that functions as a central branch point in electron transport to Fe(III), Mn(IV), nitrate (inline image), nitrite (inline image), dimethyl sulfoxide (DMSO), and fumarate (Myers & Myers, 1997). CymA transfers electrons to the periplasmic c-type cytochrome MtrA (Schuetz et al., 2009), which interacts with outer membrane (OM)-localized protein complexes composed of transmembrane β-barrel protein MtrB (Beliaev & Saffarini, 1998; Myers & Myers, 2002) and decaheme c-type cytochrome MtrC (Shi et al., 2006; Ross et al., 2007). Purified MtrC reduces Fe(III) (Hartshorne et al., 2007; Eggleston et al., 2008), and in proteoliposomes, purified MtrB, MtrC, and MtrA form a lipid-embedded ‘porin–cytochrome’ complex (Richardson et al., 2012) that transfers electrons from internal reduced methyl viologen to external Fe(III) substrates (Hartshorne et al., 2009; White et al., 2013).

Previous nucleotide sequence analyses indicated that the N-terminus of S. oneidensis MtrB contained a unique CXXC motif (Beliaev & Saffarini, 1998). The identification of a CXXC motif in S. oneidensis MtrB was unusual because CXXC motifs are generally not found in OM β-barrel proteins, most likely to avoid protein-folding problems caused by redox-reactive cysteines during passage across the intermembrane space in eukaryotes or the periplasmic space in bacteria (Tamm et al., 2004; Schleiff & Soll, 2005; Denoncin et al., 2010). The identification of an unusual CXXC motif in the N-terminus of MtrB led us to hypothesize that this motif may represent a molecular signature unique to metal-reducing γ-proteobacteria. To test this hypothesis, nucleotide sequence analyses were carried out to correlate dissimilatory metal reduction capability with the presence of MtrB homologs containing an N-terminal CXXC motif. Site-directed mutational analyses were performed to determine whether the N-terminal CXXC motif of MtrB was required for metal reduction by the representative metal-reducing γ-proteobacterium S. oneidensis. The ability to predict dissimilatory metal reduction by a γ-proteobacterium with unknown metal reduction capability was then tested with Vibrio parahaemolyticus, a human pathogen whose genome encodes an MtrB homolog with an N-terminal CXXC motif.

Materials and methods

Bacterial strains and cultivation conditions

Bacterial strains and plasmids used in this study are listed in Table 1. For genetic manipulations, all Escherichia coli and S. oneidensis strains were cultured at 30 °C in Luria–Bertani medium (10 g L−1 NaCl, 5 g L−1 yeast extract, 10 g L−1 tryptone). For aerobic and anaerobic growth experiments, all S. oneidensis strains were cultured in a defined salts medium (M1) supplemented with 20 mM lactate as carbon/energy source (Myers & Nealson, 1988). Vibrio parahaemolyticus and V. harveyi were tested for anaerobic metal reduction activity in marine broth (Difco) growth medium. Bacterial growth experiments were carried out in a B. Braun Biostat B batch reactor with automatic feedback control of pH, temperature, and dissolved O2 concentration. Electron acceptors were synthesized as previously described (Saffarini et al., 1994; Blakeney et al., 2000; Taratus et al., 2000; Payne & DiChristina, 2006; Neal et al., 2007) and added at the following final concentrations: inline image, 10 mM; inline image, 2 mM; Fe(III) citrate, 50 mM; amorphous MnO2, 15 mM; trimethylamine-N-oxide (TMAO), 25 mM; inline image, 10 mM; fumarate, 30 mM; and DMSO, 25 mM. Gentamycin was supplemented at 15 μg mL−1. For the growth of E. coli β2155 λ pir, diaminopimelate was amended at 100 μg mL−1.

Table 1. Strains and plasmids used in this study
 FeaturesSource
Strains
Shewanella oneidensis
MR-1Wild-type strainATCC
mtrBIn-frame deletion mutantThis study
C42ASite-directed mutantThis study
C45ASite-directed mutantThis study
C42A plus mtrBC42A complemented with wild-type mtrBThis study
Escherichia coli
β2155 λ pirthrB1004 pro thi strA hsdS lacZ_M15 (F9 lacZ∆M15 laclq traD36 proA1 proB1) ∆dapA::erm pir::RP4 KmRDehio & Meyer (1997)
XL10 GoldKmR electrocompetentAgilent
Vibrio parahaemolyticus Wild-type strain RIMD 2210633ATCC
Vibrio harveyi Wild-type strain BB120ATCC
Plasmids
pKO2.04.5-kb γR6K, mobRP4 sacB GmR lacZBurns & DiChristina (2009)
pBBR1MCSCmR lacZKovach et al. (1995)
pKO2.0-mtrBpKO2.0 with in-frame deletion of mtrBThis study
pKO2.0 + mtrBpKO2.0 containing wild-type copy of mtrBThis study

Analytical procedures

Cell growth was monitored by direct cell counts via epifluorescence microscopy and by measuring terminal electron acceptor depletion or end product accumulation. Acridine orange-stained cells were counted (Zeiss AxioImager Z1 Microscope) according to the previously described procedures (Burnes et al., 1998). Cell numbers at each time point were calculated as the average of 10 counts from two parallel yet independent anaerobic incubations. inline image was measured spectrophotometrically with sulfanilic acid-N-1-naphthyl-ethylenediamine dihydrochloride solution (Montgomery & Dymock, 1962). Fe(III) reduction was monitored by measuring HCl-extractable Fe(II) production with ferrozine (Stookey, 1970). Mn(IV) concentration was measured colorimetrically after reaction with benzidine hydrochloride as previously described (Burnes et al., 1998). Mn(III)-pyrophosphate concentration was measured colorimetrically as previously described (Kostka et al., 1995). inline image concentrations were measured by cyanolysis as previously described (Kelly & Wood, 1994). Growth on O2, TMAO, DMSO, and fumarate was monitored by measuring increases in cell density at 600 nm. Control experiments consisted of incubations with cells that were heat-killed at 80 °C for 30 min prior to inoculation.

Nucleotide and amino acid sequence analyses

Genome sequence data for S. oneidensis MR-1, S. putrefaciens 200, S. putrefaciens CN32, S. putrefaciens W3-18-1, S. amazonensis SB2B, S. denitrificans OS217, S. baltica OS155, S. baltica OS195, S. baltica OS185, S. baltica OS223, S. frigidimarina NCIMB400, S. pealeana ATCC 700345, S. woodyi ATCC 51908, S. sp. ANA-3, S. sp. MR-4, S. sp. MR-7, Sloihica PV-4, S. halifaxens HAW-EB4, S. piezotolerans WP3, S. sediminis HAW-EB3, and S. benthica KT99 were obtained from the National Center for Biotechnology Information (NCBI, http://www.ncbi.nlm.nih.gov) or the Department of Energy Joint Genome Institute (DOE-JGI, http://jgi.doe.gov). MtrB homologs in the NCBI databases were identified via blast analysis (Altschul et al., 1997) using S. oneidensis MtrB as the search query. Multiple alignments of MtrB homologs were generated with clustalw (http://www.ebi.ac.uk/Tools/clustalw2/index.html) (Chenna et al., 2003). β-Barrel architecture of the MtrB homologs was predicted using the program pred-tmbb (Bagos et al., 2004). logo diagrams were generated using the clustalw alignment files (Crooks et al., 2004).

In-frame gene deletion mutagenesis and genetic complementation analysis

mtrB was deleted from the S. oneidensis genome via application of a Shewanella in-frame gene deletion system (Burns & DiChristina, 2009). Regions corresponding to c. 750 bp upstream and downstream of mtrB were independently PCR-amplified and subsequently joined using overlap-extension PCR. Primers for mtrB deletion are listed in Table 2. The resulting fragment was cloned into suicide vector pKO2.0, which does not replicate in S. oneidensis. This construct (designated pKO-mtrB) was mobilized into wild-type MR-1 via conjugal transfer from E. coli donor strain β2155 λ pir. S. oneidensis strains with the plasmid integrated into the genome were selected on solid LB medium containing gentamycin (15 μg mL−1). Single integrations were verified via PCR with primers flanking the recombination region. Plasmids were resolved from the genomes of single integrants by plating on solid LB medium containing sucrose (10% w/v) with NaCl omitted. In-frame deletions were verified by PCR and direct DNA sequencing (GeneWiz, South Plainfield, NJ). Genetic complementation of ∆mtrB was carried out by cloning wild-type mtrB into broad-host-range cloning vector pBBR1MCS (Kovach et al., 1995) and conjugally transferring the recombinant vector into ∆mtrB via biparental mating procedures (DiChristina et al., 2002).

Table 2. Primers used for in-frame gene deletion mutagenesis, site-directed mutagenesis, and DNA sequencing
Deletion mutagenesis primers
MtrBD1GACTGGATCCCTCCTCTAAGAGTCCAATGGCTGGC
MtrBD2CAGCATCAGCATTTGTGCGGTGTAGCCTGTGTTGGCTAATAACGCTAGAGT
MtrBD3ACTCTAGCGTTATTAGCCAACACAGGCTACACCGCACAAATGCTGATGCTG
MtrBD4GACTGTCGACACATTTAGCCAAGCCCTAAGCCGT
MtrBDTFCAGAGCAAGTCGAAGCCACCTTAG
MtrBDTRCCATCGGTACTATGGCAAACAGAGC
Site-directed mutagenesis primers
C42A-SenseGTGAAATTATCCGCATGGAGCGCAAAAGGCTGCGTCGTTGAAACG
C42A-AntiCGTTTCAACGACGCAGCCTTTTGCGCTCCATGCGGATAATTTCAC
C45A-SenseGCATGGAGCTGTAAAGGCGCAGTCGTTGAAACGGGCACA
C45A-AntiTGTGCCCGTTTCAACGACTGCGCCTTTACAGCTCCATGC
Sequencing primers
MtrB-SeqFGATCACTCTAGCGTTATTAGCCAAC
MtrB-SeqRGTTGCTTGAACCTGCTGTTATC
MtrB cloning primers
MtrB-CompFGACTGGATCCGGTTCTAACCATCCAT
MtrB-CompRGACTGTCGACCAGAGGCGGGCTTTT

Site-directed mutagenesis

Single amino acid mutations in MtrB (C42A or C45A) were constructed using the Quickchange Lightning site-directed mutagenesis kit (Agilent Technologies, Santa Clara, CA). The mtrB gene and regions c. 750 bp upstream and downstream were PCR-amplified as a single fragment and subsequently cloned into pBBR1MCS. Mutagenesis primers C42A-sense, C42A-antisense, C45A-sense, and C45A-antisense (Table 2) were used in mutagenesis PCR according to the manufacturer's instructions. The resulting PCR products were subsequently transformed into XL10 Gold KanR competent cells (Agilent Technologies). Correct amino acid mutations (C42A or C45A) were verified by direct DNA sequencing using primers MTRB-SeqF and MTRB-SeqR (Table 2). The mutated mtrB constructs were subsequently cloned into suicide vector pKO2.0 and were ‘knocked in’ to the native chromosomal position. Nucleotide sequence changes were verified by PCR and DNA sequencing of S. oneidensis ‘knock-in’ transformants. Genetic complementation of mutant C42A was carried out by cloning wild-type mtrB into broad-host-range cloning vector pBBR1MCS (Kovach et al., 1995) and conjugally transferring the recombinant vector into mutant C42A via biparental mating procedures (DiChristina et al., 2002).

Results and discussion

Identification of N-terminal CXXC motifs in MtrB homologs within the genus Shewanella

Recent proteoliposome studies indicated that electrons are transferred from internal reduced methyl viologen to external Fe(III) substrates by a porin–cytochrome complex composed of S. oneidensis β-barrel protein MtrB and decaheme cytochromes MtrA and MtrC (Richardson et al., 2012; Richter et al., 2012; Shi et al., 2012b). Shewanella oneidensis MtrB was predicted to contain a 55-amino-acid N-terminus followed by 28 β-sheets that form a transmembrane β-barrel domain (White et al., 2013). MtrB homologs with high sequence similarity were identified in the genomes of 22 metal-reducing members of the genus Shewanella (Supporting Information, Table S1, Fig. S1), but not in the genome of nonmetal-reducing S. denitrificans (Brettar et al., 2002). Multiple sequence alignment of the 22 Shewanella MtrB homologs indicated that each consisted of a 46- to 82-amino-acid N-terminus followed by a C-terminus with 25–30 β-sheets (Table S1, Fig. S1). The N-terminus of all 22 Shewanella MtrB homologs contained a CKXC motif corresponding to amino acid positions 42–45 in S. oneidensis MtrB (Fig. 1, Table S1, Fig. S1). The S. oneidensis genome also contains three additional MtrB paralogs (MtrE, DmsF, and SO4359) (Gralnick et al., 2006) with lower overall amino acid sequence similarity to MtrB (43–55% and e-values ranging from 1e−38 to 4e−127). Each of the three additional MtrB paralogs also contained a conserved N-terminal CKXC motif (Table S2, Fig. S2).

Figure 1.

logo diagrams comparing the amino acids in the N-terminal CXXC motifs of MtrB homologs identified in the genomes of 22 metal-reducing Shewanella strains (top panel) and 20 CXXC-containing MtrB homologs in γ-proteobacteria outside the genus Shewanella (bottom panel) (corresponding to amino acid positions 42–45 of Shewanella oneidensisMtrB). Strain designations are listed in Table S1.

The identification of N-terminal CXXC motifs in the MtrB homologs of all 22 metal-reducing Shewanella strains was unusual because CXXC motifs are generally not found in transmembrane β-barrel proteins, most likely to avoid protein-folding problems caused by the redox-reactive cysteines during passage across the intermembrane space or periplasm (Tamm et al., 2004; Schleiff & Soll, 2005; Denoncin et al., 2010). CXXC motifs are generally found in cytoplasmic and periplasmic proteins where they carry out a diverse array of functions such as catalyzing disulfide bond exchanges, binding transition metals, or acting as the redox-sensing module of transcriptional activators (Ritz & Beckwith, 2001; Green & Paget, 2004; Antelmann & Helmann, 2011). Transmembrane β-barrel proteins found in the mitochondria and chloroplast of higher eukaryotes and the OM of gram-negative bacteria are generally involved in active ion transport or passive nutrient uptake (Schulz, 2000). Shewanella oneidensis MtrB appears to function as a structural sheath facilitating interaction and electron transfer from MtrA to MtrC in a transmembrane porin–cytochrome complex (Hartshorne et al., 2009; Firer-Sherwood et al., 2011a, b; White et al., 2013). The N-terminal CXXC motif of the Shewanella MtrB homologs may facilitate such electron transfer via as yet unknown molecular interactions.

Identification of N-terminal CXXC motifs in MtrB homologs outside the genus Shewanella

Nine MtrB homologs displaying amino acid sequence similarity to S. oneidensis MtrB had been previously reported in bacterial genomes outside the genus Shewanella, including metal- and nonmetal-reducing Acidobacteria and α-, β-, γ-, and δ-proteobacteria (Hartshorne et al., 2009). Four additional MtrB homologs were subsequently identified in the MtrAB modules of Fe(II)-oxidizing α- and β-proteobacteria (Shi et al., 2012a, b). The rapid expansion of sequenced bacterial genomes has resulted in a sharp increase in the number of proteins displaying similarity to S. oneidensis MtrB. As of July 2013, the list of MtrB homologs identified outside the Shewanella genus numbered 52 (Table S3, Fig. S3), including one each from the phyla Acidobacteria and NC10 group, and 50 from the α-, β-, γ-, and δ-proteobacteria. The 52 MtrB homologs facilitated amino acid sequence analysis of MtrB homologs in bacteria that cross phylogenetic and phenotypic lines, including metal- and nonmetal-reducing strains.

Literature searches were conducted to determine the dissimilatory metal reduction capability of the host strains harboring each of the 52 MtrB homologs (Table S3). Correlations between the similarity of the 52 MtrB homologs and the ability of the corresponding host strains to catalyze dissimilatory metal reduction were not observed. The 52 MtrB homologs found outside the Shewanella genus were subsequently ranked according to e-value, ranging from the MtrB homolog of the metal-reducing γ-proteobacterium Ferrimonas balearica (e-value of 7.00e-145) to the MtrB homolog of the metal-reducing δ-proteobacterium Geobacter metallireducens (e-value of 0.28). clustalw analyses of the 52 MtrB homologs (Table S3) indicated that N-terminal length varied from 4 to 132 amino acids, while the number of C-terminal β-sheets varied from 22 to 32 sheets. MtrB homologs of the γ-proteobacteria Ferrimonas, Aeromonas, and Vibrio were represented in 20 of the top 21 MtrB homologs, and each of the 20 Ferrimonas, Aeromonas, and Vibrio homologs contained an N-terminal CXXC motif (Fig. 1, Table S3). The threshold e-value for MtrB homologs containing an N-terminal CXXC motif was 4.00e-43 displayed by the MtrB homolog of V. vulnificus YJ016. Ferrimonas and Aeromonas species are facultatively anaerobic γ-proteobacteria capable of dissimilatory metal reduction (Knight & Blakemore, 1998; Martin-Carnahan & Joseph, 2005; Nolan et al., 2010), while Vibrio species have not been previously examined for dissimilatory metal reduction activity. Of the top 21 MtrB homologs, only the MtrB homolog of the γ-proteobacterium Nitrosococcus halophilus Tc4 lacked an N-terminal CXXC motif (Table S3). N. halophilus Tc4 is a nitrifying chemolithotroph that obligately respires oxygen as terminal electron acceptor (Campbell et al., 2011). These results indicate that N-terminal CXXC motifs are found in MtrB homologs of γ-proteobacteria capable of dissimilatory metal reduction, while N-terminal CXXC motifs are missing from the MtrB homolog of an obligately aerobic, nonmetal-reducing γ-proteobacterium.

The remaining 29 MtrB homologs were found in one Acidobacterium, one NC10 group strain, and 27 α-, β-, γ-, and δ-proteobacteria (Table S3). None of the remaining 29 MtrB homologs contained an N-terminal CXXC motif. α- and β-Proteobacteria were represented in 18 of the 29 MtrB homologs lacking an N-terminal CXXC motif, including the MtrB homologs of the Fe(II)-oxidizing β-proteobacteria Dechloromonas aromatica, Gallionella capsiferriformans, and Sideroxydans lithotrophicus (Emerson & Moyer, 1997; Chakraborty et al., 2005; Hedrich et al., 2011). CXXC motifs were also missing from the N-terminus of PioB, the MtrB homolog of the Fe(II)-oxidizing α-proteobacterium Rhodopseudomonas palustris (Jiao & Newman, 2007), and from the MtrB homolog of the γ-proteobacterium Halorhodospira halophila, a sulfur-oxidizing anoxygenic phototroph (Challacombe et al., 2013). Three of the 29 MtrB homologs lacking an N-terminal CXXC motif were found in metal-reducing bacteria, including the β-proteobacterium Rhodoferax ferrireducens (Finneran et al., 2003) and the δ-proteobacteria Geobacter sp. M21, G. metallireducens and G. uraniireducens (Shelobolina et al., 2008). These results indicate that MtrB homologs of metal-reducing γ-proteobacteria contain an N-terminal CXXC motif that is missing from MtrB homologs of nonmetal-reducing γ-proteobacteria and from all bacteria outside the γ-proteobacteria, including those catalyzing dissimilatory metal reduction or oxidation reactions.

The first conserved cysteine in the N-terminal CXXC motif of MtrB is required for dissimilatory metal reduction by S. oneidensis

To determine whether the N-terminal CXXC motif of MtrB was required for dissimilatory metal reduction, the N-terminal CXXC motif of S. oneidensis MtrB was selected for site-directed mutational analysis, and the resulting CXXC mutants were tested for dissimilatory metal reduction activity. S. oneidensis mutant strain C42A was unable to reduce Fe(III) or Mn(IV) as terminal electron acceptor (i.e. displayed metal reduction-deficient phenotypes identical to ∆mtrB; Fig. 2), yet retained wild-type respiratory activity on all nonmetal electron acceptors, including O2, inline image, inline image, inline image, fumarate, DMSO, and TMAO (Fig. S3). S. oneidensis mutant strain C45A, on the other hand, displayed wild-type reduction activity of all electron acceptors, including Fe(III) and Mn(IV) (Figs 2 and S3). The involvement of C42 in metal reduction activity was confirmed via restoration of wild-type metal reduction activity to C42A transconjugates provided with wild-type mtrB on pBBR1MCS (Fig. 2). These findings indicate that the first, but not the second, cysteine in the N-terminal CXXC motif of MtrB is required for dissimilatory metal reduction by S. oneidensis. These findings also indicate that overlapping MtrB function is not provided by the MtrB paralogs MtrE, DmsF, and SO4359 or that these paralogs are expressed under metal-reducing conditions different than those employed in the present study (Myers & Myers, 2002; Gralnick et al., 2006).

Figure 2.

Dissimilatory metal reduction activity of strains Shewanella oneidensis wild-type, wild-type containing pBBR1MCS, ∆mtrB, C45A, C42A, and C42A complemented by wild-type mtrB with either Fe(III) (left panel) or Mn(IV) (right panel) as terminal electron acceptor. Values are the means of two parallel but independent anaerobic incubations; error bars represent standard deviations. Some error bars cannot be seen due to small standard deviations.

The involvement of C42 in metal reduction by S. oneidensis and the absence of the corresponding N-terminal CXXC motif in MtrB homologs of metal-reducing Rhodoferax and Geobacter species indicate that the molecular mechanism of metal reduction by γ-, β-, and δ-proteobacteria differs in at least one fundamental aspect. The biochemical function of C42 in metal reduction by S. oneidensis is currently unknown. Based on the participation of CXXC motifs in metal binding, redox sensing, and disulfide bond formation (Ritz & Beckwith, 2001; Green & Paget, 2004; Antelmann & Helmann, 2011), potential roles for C42 include the binding of metals or cofactors required for electron transport by the MtrCAB complex, sensing redox conditions via sulfur redox chemistry, or enhancing MtrB interaction with other cysteine-containing metabolites and proteins via heterologous disulfide bond formation. Current work is focused on examining these possibilities during metal reduction by S. oneidensis.

Prediction of dissimilatory metal reduction activity by γ-proteobacteria with unknown metal reduction capability

As described above, 20 of the top 21 MtrB homologs were identified in the genera Ferrimonas, Aeromonas, and Vibrio (Table S3). Although Ferrimonas and Aeromonas species are known to catalyze dissimilatory metal reduction (Knight & Blakemore, 1998; Nakagawa et al., 2006; Nolan et al., 2010), the dissimilatory metal reduction capability of Vibrios is not well studied. The ability to predict dissimilatory metal reduction by a γ-proteobacterium with unknown metal reduction capability was tested with V. parahaemolyticus, a pathogen whose genome encodes an MtrB homolog with an N-terminal CXXC motif. A CSEC motif was identified in the N-terminus of the V. parahaemolyticus MtrB homolog VP1218 (87QD1_VIBPA; Table S3). Subsequent anaerobic incubations demonstrated that V. parahaemolyticus reduced Fe(III) and Mn(IV) as terminal electron acceptors (Fig. 3), while V. harveyi, a Vibrio control strain lacking the MtrB homolog, was deficient in Fe(III) and Mn(IV) reduction activity (Fig. 3).

Figure 3.

Dissimilatory metal reduction activity of Vibrio parahaemolyticus and V. harveyi wild-type strains with either Fe(III) (left panel) or Mn(IV) (right panel) as terminal electron acceptor. Values are the means of two parallel but independent anaerobic incubations; error bars represent standard deviations. Some error bars cannot be seen due to small standard deviations.

Results of the present study indicate that MtrB homologs of metal-reducing γ-proteobacteria contain an N-terminal CXXC motif that is missing from the MtrB homologs of Acidobacteria and NC10 group strains, nonmetal-reducing γ-proteobacteria, and all α-, β-, and δ-proteobacteria, including those catalyzing dissimilatory metal reduction or oxidation reactions. The N-terminal CXXC motif of MtrB is required for dissimilatory metal reduction by the representative metal-reducing γ-proteobacterium S. oneidensis, and the ability to predict dissimilatory metal reduction by a γ-proteobacterium with unknown metal reduction capability was confirmed with V. parahaemolyticus, a pathogen whose genome encodes an MtrB homolog with an N-terminal CXXC motif. MtrB homologs with N-terminal CXXC motifs may thus represent a molecular signature unique to metal-reducing members of the γ-proteobacteria, with the potential for further development as a biomarker for tracking the presence and activity of metal-reducing γ-proteobacteria in natural and engineered systems.

Acknowledgements

This work was supported by the National Science Foundation, the Department of Energy, and the Public Service Department of Malaysia. We would like to thank Dawayland Cobb and Ramiro Garza for laboratory assistance.

Ancillary